diff options
author | Arnold D. Robbins <arnold@skeeve.com> | 2020-09-24 21:18:00 +0300 |
---|---|---|
committer | Arnold D. Robbins <arnold@skeeve.com> | 2020-09-24 21:18:00 +0300 |
commit | 8af388593f518ab494380abaf084670a92b82fba (patch) | |
tree | 12391a69680670231721b3b6aec61943ad10fb22 | |
parent | 7d66303476829624ab534dc071ab0f0eef5f84fe (diff) | |
download | egawk-8af388593f518ab494380abaf084670a92b82fba.tar.gz egawk-8af388593f518ab494380abaf084670a92b82fba.tar.bz2 egawk-8af388593f518ab494380abaf084670a92b82fba.zip |
Add spell checking for gawkinet.texi.
-rw-r--r-- | doc/ChangeLog | 2 | ||||
-rw-r--r-- | doc/Makefile.am | 7 | ||||
-rw-r--r-- | doc/Makefile.in | 7 | ||||
-rw-r--r-- | doc/wordlist4 | 597 |
4 files changed, 611 insertions, 2 deletions
diff --git a/doc/ChangeLog b/doc/ChangeLog index 89b39459..bb6aa39e 100644 --- a/doc/ChangeLog +++ b/doc/ChangeLog @@ -4,6 +4,8 @@ * wordlist, wordlist2, wordlist3: Remove words that spell now recognizes as real words. * gawkinet.texi: Fix a spelling error. + * Makefile.am (spellinet): New target. + * wordlist4: New file. 2020-09-18 Arnold D. Robbins <arnold@skeeve.com> diff --git a/doc/Makefile.am b/doc/Makefile.am index 24dd0405..d95d5660 100644 --- a/doc/Makefile.am +++ b/doc/Makefile.am @@ -110,7 +110,7 @@ awkcard.nc: $(CARDFILES) awkcard.pdf: awkcard.ps ps2pdf awkcard.ps awkcard.pdf -spell: spellmanual spellworkflow spellmanpage +spell: spellmanual spellworkflow spellmanpage spellinet spellmanual: @echo ==== gawktexi.in ====; @@ -126,3 +126,8 @@ spellmanpage: @echo ==== gawk.1 ==== export LC_ALL=C ; spell "$(srcdir)"/gawk.1 | \ sort -u | comm -23 - "$(srcdir)"/wordlist3 + +spellinet: + @echo ==== gawkinet.texi ==== + export LC_ALL=C ; spell "$(srcdir)"/gawkinet.texi | \ + sort -u | comm -23 - "$(srcdir)"/wordlist4 diff --git a/doc/Makefile.in b/doc/Makefile.in index c457ea1a..5d33b8a5 100644 --- a/doc/Makefile.in +++ b/doc/Makefile.in @@ -933,7 +933,7 @@ awkcard.nc: $(CARDFILES) awkcard.pdf: awkcard.ps ps2pdf awkcard.ps awkcard.pdf -spell: spellmanual spellworkflow spellmanpage +spell: spellmanual spellworkflow spellmanpage spellinet spellmanual: @echo ==== gawktexi.in ====; @@ -950,6 +950,11 @@ spellmanpage: export LC_ALL=C ; spell "$(srcdir)"/gawk.1 | \ sort -u | comm -23 - "$(srcdir)"/wordlist3 +spellinet: + @echo ==== gawkinet.texi ==== + export LC_ALL=C ; spell "$(srcdir)"/gawkinet.texi | \ + sort -u | comm -23 - "$(srcdir)"/wordlist4 + # Tell versions [3.59,3.63) of GNU make to not export all variables. # Otherwise a system limit (for SysV at least) may be exceeded. .NOEXPORT: diff --git a/doc/wordlist4 b/doc/wordlist4 new file mode 100644 index 00000000..f267327a --- /dev/null +++ b/doc/wordlist4 @@ -0,0 +1,597 @@ +AA +ADR +ALINK +API +ARGC +ARGV +AWK +AXP +AboutELIZA +AboutServer +AvoidCount +Awk +Ayalon +BGCOLOR +BLASTService +BR +Boutell +CC +CELLPADDING +CEST +CGI +CNN +CSV +CTD +CatPipe +ChangeConfig +CheckConfig +CleanUp +ConfigFile +CorrectCount +DARKCORNER +DATALIB +DD +DDBJ +DECnet +DEF +DONT +DTD +Degeneres +DownCount +EK +EMBL +EPROMs +EQUIV +ElizaSays +EndOfMySelf +EnterParameters +Etzioni +FASTA +FDL +FFN +FIXME +FN +FS +FUNC +Fasta +Flannery +GAWK's +GETARG +GETURL +GNUPLOT +GNUPlot +GUIs +GenBank +GenInfo +GetHeader +GetThisHeader +GnuPlot +HD +HREF +HWP +HandleGET +Hethmon +Hoare +Hoare's +HotCount +HttpService +Humphrys +HyperText +IM +IMG +INTC +IPX +IPv +ISBN +IUB +IUPAC +IVE +Immuno +Init +Internetworking +JK +JNJ +JPG +JPM +Juergen +Jul +Jun +KAREL +KO +Kabat's +Kahrs +LF +Loebner +Loui +MCD +MMC +MMM +MOBAG +MOBAGWHO +MOBFUN +MOBVAR +MOT +MRK +MSFT +MailPipe +MakeMaze +MiniSQL +MobAg +MobCode +MobileAgent +Multiauthor +MyHost +MyInit +MyJob +MyOrigin +MyPort +MyPrefix +MyProxy +NBRF +NCBI +NCBI's +NF +NR +NetService +NeutralCount +NewLength +Nof +Nov +Novell's +ORS +Oren +PARAM +PARAMS +PARAMs +PATCHLEVEL +PDF +PG +PIR +PNG +POPService +POSIXed +PROT +PROTBASE +PS +Param +Perlis +PointLight +PostAgent +PostScript +Pragma +Prez +ProxyPort +REMCONF +RFCs +RP +RT +ReadConfig +ReadMySelf +ReadQuotes +Rumpelstilzchen +SA +SBC +SNMP +SPAK +SRC +STARTOFRANGE +STATIST +STOXPRED +SUBSEP +Salmagundi +SaveConfig +Sbjct +SendMail +Sep +SetUpEliza +SetUpServer +StartELIZA +StockCount +TD +TR +Tck +Tcl +Teukolsky +Texinfo +Tk +TopDoc +TopFooter +TopHeader +UL +UMBC +URI +URLCHK +URLfile +UTX +UpCount +VLINK +VRML +VRMLtest +Vetterling +WEBGRAB +WINNT +WMT +Waterman's +Weizenbaum +WorldWideWeb +XBM +XCF +XINU +XOM +XP +XSIZE +XYZ +YOURE +YOUVE +YSIZE +YahooData +YouSay +abcdef +acm +adelphia +adenosine +advperl +ai +ambientIntensity +amd +arnold +asc +ascii +asis +au +awk +awkforai +awkinet +bbs +bierce +bigskip +bioskills +bitcont +biz +blastcl +blastmail +blastn +blasturl +boutell +br +caccaccatggacagcaaa +canberra +cgi +cgilib +ch +chargen +charset +chayden +chrisc +cindex +codon +columnfractions +com +compapp +config +conj +cont +contrib +coprocess +copyleft +copyrightable +coreserv +cp +cr +crontab +csv +cytidine +dartmouth +datacount +daycount +dbj +dcu +dd +de +dec +defeasible +denhaag +deontic +detailmenu +dev +devvax +df +dfn +dict +diffuseColor +dir +dircategory +direntry +dist +ducktown +edu +eg +ek +eliza +emailhost +emb +embedpc +emph +endfile +epd +evenheading +exp +fakenode +fasta +ff +ffffff +fi +filenet +filll +finalout +fingerclient +fn +foo +fr +fsbassociates +fsf +ftest +gawcon +gawkinet +gawknet +gawnetf +gd +geninfo +getline +geturl +gif +gnl +gnuawk +gnuplot +gov +groundAngle +groundColor +gsub +guanine +halign +headitem +hexdigs +hfil +highgate +hrule +htm +html +htmlx +http +httpd +https +httpserver +hughes +humphrys +iX +ibeta +ibm +ie +ifhtml +ifinfo +ifnotinfo +ifnottex +iftex +igawk +inet +inetlib +inmargin +insertcopying +int +intc +intel +interline +introcb +invsqrt +ip +irc +iso +java +jp +jpl +kabat +kazusa +keto +keynes +kohala +laplace +len +lflashlight +li +libc +lifeisgood +lineo +linespace +linux +localhost +localport +loebner +loui +mailto +marx +mkdir +mobag +moritz +multiline +multitable +myhost +nAgent +nBEGIN +nThe +nThis +nasa +ncbi +netblast +netcon +netcraft +netfunny +netgawf +netgawk +netscape +netstat +nih +nl +nlm +nntp +noalign +nof +noindent +noncausal +noncommercially +nph +nr +nthese +nwe +oddheading +offinterlineskip +openURL +oreilly +org +overfulls +pF +paris +passwd +pdb +pdict +perl +pir +png +postoffice +pre +prepinfo +prf +printenv +printf +printindex +protbase +ps +pt +purdue +purine +pxref +pyrimidine +qold +rand +readnews +remconf +remoteport +rendez +retr +rf +rflashlight +rhf +rm +rstevens +rvices +samp +sapiens +sc +scriptics +sd +seealso +seeentry +serv +serweb +setTimeout +setchapternewpage +setfilename +settitle +sez +shtml +skeeve +skyAngle +skyColor +smallbook +smallexample +smtp +softbot +sp +spak +spinoza +spoonsful +sprintf +srand +statist +stderr +stdin +stdout +stoxdata +stoxpred +str +strftime +subentry +subj +subjold +sublicense +subnode +substr +subsubsection +suse +synchronicity +syncodeindex +synindex +systime +tcl +tcp +tcpcon +tcpip +technicalinfo +testserv +tex +texinfo +tgcttggctgaggagccataggacgagagcttcctggtgaagtgtgtttcttgaaatcat +tggtgaagtgtgtttcttg +thischapter +thispage +thttp +thymidine +titlepage +tjhsst +tmp +tolower +toupper +ttytst +tutest +txt +uclinux +udp +uk +ul +umbc +uname +unnumberedsec +unregarded +untp +uref +urgen +urgen's +uri +uridine +url +urlchk +userfriendly +utf +uthscsa +val +var +vars +vbox +vous +vr +vrml +vrule +vskip +webclient +webgrab +webser +webserx +wold +wotsit +wouldnt +wustl +www +xbm +xinu +xrds +youre +yrange |