diff options
author | Arnold D. Robbins <arnold@skeeve.com> | 2016-10-25 21:40:16 +0300 |
---|---|---|
committer | Arnold D. Robbins <arnold@skeeve.com> | 2016-10-25 21:40:16 +0300 |
commit | 24e562f07cb9c6d70f49eeb9a74ffba8101ba834 (patch) | |
tree | 24ed74f7ff9f6eb8dbb866e09bd9d4d23d0b39e8 | |
parent | e56b6eabe183ed5fa1352ef0f5f49fb6d894578c (diff) | |
parent | 8231da563c810ce210ce309ee1a022bad22a1e13 (diff) | |
download | egawk-24e562f07cb9c6d70f49eeb9a74ffba8101ba834.tar.gz egawk-24e562f07cb9c6d70f49eeb9a74ffba8101ba834.tar.bz2 egawk-24e562f07cb9c6d70f49eeb9a74ffba8101ba834.zip |
Merge branch 'master' into feature/nocopy
-rw-r--r-- | ChangeLog | 9 | ||||
-rw-r--r-- | NEWS | 3 | ||||
-rw-r--r-- | builtin.c | 35 | ||||
-rw-r--r-- | doc/ChangeLog | 7 | ||||
-rw-r--r-- | doc/gawk.1 | 5 | ||||
-rw-r--r-- | doc/gawk.info | 35733 | ||||
-rw-r--r-- | doc/gawk.texi | 134 | ||||
-rw-r--r-- | doc/gawkinet.info | 4406 | ||||
-rw-r--r-- | doc/gawktexi.in | 66 | ||||
-rw-r--r-- | mpfr.c | 33 | ||||
-rw-r--r-- | vms/ChangeLog | 5 | ||||
-rw-r--r-- | vms/backup_gawk_src.com | 4 | ||||
-rw-r--r-- | vms/pcsi_product_gawk.com | 35 |
13 files changed, 270 insertions, 40205 deletions
@@ -1,3 +1,12 @@ +2016-10-25 Arnold D. Robbins <arnold@skeeve.com> + + Disallow negative arguments to the bitwise functions. + + * NEWS: Document this. + * builtin.c (do_lshift, do_rshift, do_and, do_or, do_xor, do_compl): + Make negative arguments a fatal error. + * mpfr.c (do_mpfr_compl, get_intval): Ditto. + 2016-10-23 Arnold D. Robbins <arnold@skeeve.com> * General: Remove trailing whitespace from all relevant files. @@ -82,6 +82,9 @@ Changes from 4.1.x to 4.2.0 21. Pretty printing now uses the original text of constant numeric values for pretty printing and profiling. +22. Passing negative operands to any of the bitwise functions now + produces a fatal error. + Changes from 4.1.3 to 4.1.4 --------------------------- @@ -3333,11 +3333,13 @@ do_lshift(int nargs) if ((fixtype(s2)->flags & NUMBER) == 0) lintwarn(_("lshift: received non-numeric second argument")); } + val = force_number(s1)->numbr; shift = force_number(s2)->numbr; + if (val < 0 || shift < 0) + fatal(_("lshift(%f, %f): negative values are not allowed"), val, shift); + if (do_lint) { - if (val < 0 || shift < 0) - lintwarn(_("lshift(%f, %f): negative values will give strange results"), val, shift); if (double_to_int(val) != val || double_to_int(shift) != shift) lintwarn(_("lshift(%f, %f): fractional values will be truncated"), val, shift); if (shift >= sizeof(uintmax_t) * CHAR_BIT) @@ -3370,11 +3372,13 @@ do_rshift(int nargs) if ((fixtype(s2)->flags & NUMBER) == 0) lintwarn(_("rshift: received non-numeric second argument")); } + val = force_number(s1)->numbr; shift = force_number(s2)->numbr; + if (val < 0 || shift < 0) + fatal(_("rshift(%f, %f): negative values are not allowed"), val, shift); + if (do_lint) { - if (val < 0 || shift < 0) - lintwarn(_("rshift(%f, %f): negative values will give strange results"), val, shift); if (double_to_int(val) != val || double_to_int(shift) != shift) lintwarn(_("rshift(%f, %f): fractional values will be truncated"), val, shift); if (shift >= sizeof(uintmax_t) * CHAR_BIT) @@ -3411,8 +3415,8 @@ do_and(int nargs) lintwarn(_("and: argument %d is non-numeric"), i); val = force_number(s1)->numbr; - if (do_lint && val < 0) - lintwarn(_("and: argument %d negative value %g will give strange results"), i, val); + if (val < 0) + fatal(_("and: argument %d negative value %g is not allowed"), i, val); uval = (uintmax_t) val; res &= uval; @@ -3443,8 +3447,8 @@ do_or(int nargs) lintwarn(_("or: argument %d is non-numeric"), i); val = force_number(s1)->numbr; - if (do_lint && val < 0) - lintwarn(_("or: argument %d negative value %g will give strange results"), i, val); + if (val < 0) + fatal(_("or: argument %d negative value %g is not allowed"), i, val); uval = (uintmax_t) val; res |= uval; @@ -3475,8 +3479,8 @@ do_xor(int nargs) lintwarn(_("xor: argument %d is non-numeric"), i); val = force_number(s1)->numbr; - if (do_lint && val < 0) - lintwarn(_("xor: argument %d negative value %g will give strange results"), i, val); + if (val < 0) + fatal(_("xor: argument %d negative value %g is not allowed"), i, val); uval = (uintmax_t) val; if (i == 1) @@ -3505,12 +3509,11 @@ do_compl(int nargs) d = force_number(tmp)->numbr; DEREF(tmp); - if (do_lint) { - if (d < 0) - lintwarn(_("compl(%f): negative value will give strange results"), d); - if (double_to_int(d) != d) - lintwarn(_("compl(%f): fractional value will be truncated"), d); - } + if (d < 0) + fatal(_("compl(%f): negative value is not allowed"), d); + + if (do_lint && double_to_int(d) != d) + lintwarn(_("compl(%f): fractional value will be truncated"), d); uval = (uintmax_t) d; uval = ~ uval; diff --git a/doc/ChangeLog b/doc/ChangeLog index 305fc8e4..a3069283 100644 --- a/doc/ChangeLog +++ b/doc/ChangeLog @@ -1,3 +1,10 @@ +2016-10-25 Arnold D. Robbins <arnold@skeeve.com> + + * gawktexi.in: Document that negative arguments are not allowed + for bitwise functions. Add a sidebar explaining it a bit and + also showing the difference with and without -M. + * gawk.1: Document that negative arguments are not allowed. + 2016-10-23 Arnold D. Robbins <arnold@skeeve.com> * gawktexi.in: Remove references to MS-DOS and OS/2, @@ -3181,6 +3181,11 @@ values to .B uintmax_t integers, doing the operation, and then converting the result back to floating point. +.PP +.BR NOTE : +Passing negative operands to any of these functions causes +a fatal error. +.PP The functions are: .TP "\w'\fBrshift(\fIval\fB, \fIcount\fB)\fR'u+2n" \fBand(\fIv1\fB, \fIv2 \fR[, ...]\fB)\fR diff --git a/doc/gawk.info b/doc/gawk.info deleted file mode 100644 index 1faa775c..00000000 --- a/doc/gawk.info +++ /dev/null @@ -1,35733 +0,0 @@ -This is gawk.info, produced by makeinfo version 6.1 from gawk.texi. - -Copyright (C) 1989, 1991, 1992, 1993, 1996-2005, 2007, 2009-2016 -Free Software Foundation, Inc. - - - This is Edition 4.1 of 'GAWK: Effective AWK Programming: A User's -Guide for GNU Awk', for the 4.1.4 (or later) version of the GNU -implementation of AWK. - - Permission is granted to copy, distribute and/or modify this document -under the terms of the GNU Free Documentation License, Version 1.3 or -any later version published by the Free Software Foundation; with the -Invariant Sections being "GNU General Public License", with the -Front-Cover Texts being "A GNU Manual", and with the Back-Cover Texts as -in (a) below. A copy of the license is included in the section entitled -"GNU Free Documentation License". - - a. The FSF's Back-Cover Text is: "You have the freedom to copy and - modify this GNU manual." -INFO-DIR-SECTION Text creation and manipulation -START-INFO-DIR-ENTRY -* Gawk: (gawk). A text scanning and processing language. -END-INFO-DIR-ENTRY - -INFO-DIR-SECTION Individual utilities -START-INFO-DIR-ENTRY -* awk: (gawk)Invoking gawk. Text scanning and processing. -END-INFO-DIR-ENTRY - - -File: gawk.info, Node: Top, Next: Foreword3, Up: (dir) - -General Introduction -******************** - -This file documents 'awk', a program that you can use to select -particular records in a file and perform operations upon them. - - Copyright (C) 1989, 1991, 1992, 1993, 1996-2005, 2007, 2009-2016 -Free Software Foundation, Inc. - - - This is Edition 4.1 of 'GAWK: Effective AWK Programming: A User's -Guide for GNU Awk', for the 4.1.4 (or later) version of the GNU -implementation of AWK. - - Permission is granted to copy, distribute and/or modify this document -under the terms of the GNU Free Documentation License, Version 1.3 or -any later version published by the Free Software Foundation; with the -Invariant Sections being "GNU General Public License", with the -Front-Cover Texts being "A GNU Manual", and with the Back-Cover Texts as -in (a) below. A copy of the license is included in the section entitled -"GNU Free Documentation License". - - a. The FSF's Back-Cover Text is: "You have the freedom to copy and - modify this GNU manual." - -* Menu: - -* Foreword3:: Some nice words about this - Info file. -* Foreword4:: More nice words. -* Preface:: What this Info file is about; brief - history and acknowledgments. -* Getting Started:: A basic introduction to using - 'awk'. How to run an 'awk' - program. Command-line syntax. -* Invoking Gawk:: How to run 'gawk'. -* Regexp:: All about matching things using regular - expressions. -* Reading Files:: How to read files and manipulate fields. -* Printing:: How to print using 'awk'. Describes - the 'print' and 'printf' - statements. Also describes redirection of - output. -* Expressions:: Expressions are the basic building blocks - of statements. -* Patterns and Actions:: Overviews of patterns and actions. -* Arrays:: The description and use of arrays. Also - includes array-oriented control statements. -* Functions:: Built-in and user-defined functions. -* Library Functions:: A Library of 'awk' Functions. -* Sample Programs:: Many 'awk' programs with complete - explanations. -* Advanced Features:: Stuff for advanced users, specific to - 'gawk'. -* Internationalization:: Getting 'gawk' to speak your - language. -* Debugger:: The 'gawk' debugger. -* Arbitrary Precision Arithmetic:: Arbitrary precision arithmetic with - 'gawk'. -* Dynamic Extensions:: Adding new built-in functions to - 'gawk'. -* Language History:: The evolution of the 'awk' - language. -* Installation:: Installing 'gawk' under various - operating systems. -* Notes:: Notes about adding things to 'gawk' - and possible future work. -* Basic Concepts:: A very quick introduction to programming - concepts. -* Glossary:: An explanation of some unfamiliar terms. -* Copying:: Your right to copy and distribute - 'gawk'. -* GNU Free Documentation License:: The license for this Info file. -* Index:: Concept and Variable Index. - -* History:: The history of 'gawk' and - 'awk'. -* Names:: What name to use to find - 'awk'. -* This Manual:: Using this Info file. Includes - sample input files that you can use. -* Conventions:: Typographical Conventions. -* Manual History:: Brief history of the GNU project and - this Info file. -* How To Contribute:: Helping to save the world. -* Acknowledgments:: Acknowledgments. -* Running gawk:: How to run 'gawk' programs; - includes command-line syntax. -* One-shot:: Running a short throwaway - 'awk' program. -* Read Terminal:: Using no input files (input from the - keyboard instead). -* Long:: Putting permanent 'awk' - programs in files. -* Executable Scripts:: Making self-contained 'awk' - programs. -* Comments:: Adding documentation to 'gawk' - programs. -* Quoting:: More discussion of shell quoting - issues. -* DOS Quoting:: Quoting in Windows Batch Files. -* Sample Data Files:: Sample data files for use in the - 'awk' programs illustrated in - this Info file. -* Very Simple:: A very simple example. -* Two Rules:: A less simple one-line example using - two rules. -* More Complex:: A more complex example. -* Statements/Lines:: Subdividing or combining statements - into lines. -* Other Features:: Other Features of 'awk'. -* When:: When to use 'gawk' and when to - use other things. -* Intro Summary:: Summary of the introduction. -* Command Line:: How to run 'awk'. -* Options:: Command-line options and their - meanings. -* Other Arguments:: Input file names and variable - assignments. -* Naming Standard Input:: How to specify standard input with - other files. -* Environment Variables:: The environment variables - 'gawk' uses. -* AWKPATH Variable:: Searching directories for - 'awk' programs. -* AWKLIBPATH Variable:: Searching directories for - 'awk' shared libraries. -* Other Environment Variables:: The environment variables. -* Exit Status:: 'gawk''s exit status. -* Include Files:: Including other files into your - program. -* Loading Shared Libraries:: Loading shared libraries into your - program. -* Obsolete:: Obsolete Options and/or features. -* Undocumented:: Undocumented Options and Features. -* Invoking Summary:: Invocation summary. -* Regexp Usage:: How to Use Regular Expressions. -* Escape Sequences:: How to write nonprinting characters. -* Regexp Operators:: Regular Expression Operators. -* Bracket Expressions:: What can go between '[...]'. -* Leftmost Longest:: How much text matches. -* Computed Regexps:: Using Dynamic Regexps. -* GNU Regexp Operators:: Operators specific to GNU software. -* Case-sensitivity:: How to do case-insensitive matching. -* Strong Regexp Constants:: Strongly typed regexp constants. -* Regexp Summary:: Regular expressions summary. -* Records:: Controlling how data is split into - records. -* awk split records:: How standard 'awk' splits - records. -* gawk split records:: How 'gawk' splits records. -* Fields:: An introduction to fields. -* Nonconstant Fields:: Nonconstant Field Numbers. -* Changing Fields:: Changing the Contents of a Field. -* Field Separators:: The field separator and how to change - it. -* Default Field Splitting:: How fields are normally separated. -* Regexp Field Splitting:: Using regexps as the field separator. -* Single Character Fields:: Making each character a separate - field. -* Command Line Field Separator:: Setting 'FS' from the command - line. -* Full Line Fields:: Making the full line be a single - field. -* Field Splitting Summary:: Some final points and a summary table. -* Constant Size:: Reading constant width data. -* Splitting By Content:: Defining Fields By Content -* Multiple Line:: Reading multiline records. -* Getline:: Reading files under explicit program - control using the 'getline' - function. -* Plain Getline:: Using 'getline' with no - arguments. -* Getline/Variable:: Using 'getline' into a variable. -* Getline/File:: Using 'getline' from a file. -* Getline/Variable/File:: Using 'getline' into a variable - from a file. -* Getline/Pipe:: Using 'getline' from a pipe. -* Getline/Variable/Pipe:: Using 'getline' into a variable - from a pipe. -* Getline/Coprocess:: Using 'getline' from a coprocess. -* Getline/Variable/Coprocess:: Using 'getline' into a variable - from a coprocess. -* Getline Notes:: Important things to know about - 'getline'. -* Getline Summary:: Summary of 'getline' Variants. -* Read Timeout:: Reading input with a timeout. -* Retrying Input:: Retrying input after certain errors. -* Command-line directories:: What happens if you put a directory on - the command line. -* Input Summary:: Input summary. -* Input Exercises:: Exercises. -* Print:: The 'print' statement. -* Print Examples:: Simple examples of 'print' - statements. -* Output Separators:: The output separators and how to - change them. -* OFMT:: Controlling Numeric Output With - 'print'. -* Printf:: The 'printf' statement. -* Basic Printf:: Syntax of the 'printf' statement. -* Control Letters:: Format-control letters. -* Format Modifiers:: Format-specification modifiers. -* Printf Examples:: Several examples. -* Redirection:: How to redirect output to multiple - files and pipes. -* Special FD:: Special files for I/O. -* Special Files:: File name interpretation in - 'gawk'. 'gawk' allows - access to inherited file descriptors. -* Other Inherited Files:: Accessing other open files with - 'gawk'. -* Special Network:: Special files for network - communications. -* Special Caveats:: Things to watch out for. -* Close Files And Pipes:: Closing Input and Output Files and - Pipes. -* Nonfatal:: Enabling Nonfatal Output. -* Output Summary:: Output summary. -* Output Exercises:: Exercises. -* Values:: Constants, Variables, and Regular - Expressions. -* Constants:: String, numeric and regexp constants. -* Scalar Constants:: Numeric and string constants. -* Nondecimal-numbers:: What are octal and hex numbers. -* Regexp Constants:: Regular Expression constants. -* Using Constant Regexps:: When and how to use a regexp constant. -* Variables:: Variables give names to values for - later use. -* Using Variables:: Using variables in your programs. -* Assignment Options:: Setting variables on the command line - and a summary of command-line syntax. - This is an advanced method of input. -* Conversion:: The conversion of strings to numbers - and vice versa. -* Strings And Numbers:: How 'awk' Converts Between - Strings And Numbers. -* Locale influences conversions:: How the locale may affect conversions. -* All Operators:: 'gawk''s operators. -* Arithmetic Ops:: Arithmetic operations ('+', - '-', etc.) -* Concatenation:: Concatenating strings. -* Assignment Ops:: Changing the value of a variable or a - field. -* Increment Ops:: Incrementing the numeric value of a - variable. -* Truth Values and Conditions:: Testing for true and false. -* Truth Values:: What is "true" and what is - "false". -* Typing and Comparison:: How variables acquire types and how - this affects comparison of numbers and - strings with '<', etc. -* Variable Typing:: String type versus numeric type. -* Comparison Operators:: The comparison operators. -* POSIX String Comparison:: String comparison with POSIX rules. -* Boolean Ops:: Combining comparison expressions using - boolean operators '||' ("or"), - '&&' ("and") and '!' - ("not"). -* Conditional Exp:: Conditional expressions select between - two subexpressions under control of a - third subexpression. -* Function Calls:: A function call is an expression. -* Precedence:: How various operators nest. -* Locales:: How the locale affects things. -* Expressions Summary:: Expressions summary. -* Pattern Overview:: What goes into a pattern. -* Regexp Patterns:: Using regexps as patterns. -* Expression Patterns:: Any expression can be used as a - pattern. -* Ranges:: Pairs of patterns specify record - ranges. -* BEGIN/END:: Specifying initialization and cleanup - rules. -* Using BEGIN/END:: How and why to use BEGIN/END rules. -* I/O And BEGIN/END:: I/O issues in BEGIN/END rules. -* BEGINFILE/ENDFILE:: Two special patterns for advanced - control. -* Empty:: The empty pattern, which matches every - record. -* Using Shell Variables:: How to use shell variables with - 'awk'. -* Action Overview:: What goes into an action. -* Statements:: Describes the various control - statements in detail. -* If Statement:: Conditionally execute some - 'awk' statements. -* While Statement:: Loop until some condition is - satisfied. -* Do Statement:: Do specified action while looping - until some condition is satisfied. -* For Statement:: Another looping statement, that - provides initialization and increment - clauses. -* Switch Statement:: Switch/case evaluation for conditional - execution of statements based on a - value. -* Break Statement:: Immediately exit the innermost - enclosing loop. -* Continue Statement:: Skip to the end of the innermost - enclosing loop. -* Next Statement:: Stop processing the current input - record. -* Nextfile Statement:: Stop processing the current file. -* Exit Statement:: Stop execution of 'awk'. -* Built-in Variables:: Summarizes the predefined variables. -* User-modified:: Built-in variables that you change to - control 'awk'. -* Auto-set:: Built-in variables where 'awk' - gives you information. -* ARGC and ARGV:: Ways to use 'ARGC' and - 'ARGV'. -* Pattern Action Summary:: Patterns and Actions summary. -* Array Basics:: The basics of arrays. -* Array Intro:: Introduction to Arrays -* Reference to Elements:: How to examine one element of an - array. -* Assigning Elements:: How to change an element of an array. -* Array Example:: Basic Example of an Array -* Scanning an Array:: A variation of the 'for' - statement. It loops through the - indices of an array's existing - elements. -* Controlling Scanning:: Controlling the order in which arrays - are scanned. -* Numeric Array Subscripts:: How to use numbers as subscripts in - 'awk'. -* Uninitialized Subscripts:: Using Uninitialized variables as - subscripts. -* Delete:: The 'delete' statement removes an - element from an array. -* Multidimensional:: Emulating multidimensional arrays in - 'awk'. -* Multiscanning:: Scanning multidimensional arrays. -* Arrays of Arrays:: True multidimensional arrays. -* Arrays Summary:: Summary of arrays. -* Built-in:: Summarizes the built-in functions. -* Calling Built-in:: How to call built-in functions. -* Numeric Functions:: Functions that work with numbers, - including 'int()', 'sin()' - and 'rand()'. -* String Functions:: Functions for string manipulation, - such as 'split()', 'match()' - and 'sprintf()'. -* Gory Details:: More than you want to know about - '\' and '&' with - 'sub()', 'gsub()', and - 'gensub()'. -* I/O Functions:: Functions for files and shell - commands. -* Time Functions:: Functions for dealing with timestamps. -* Bitwise Functions:: Functions for bitwise operations. -* Type Functions:: Functions for type information. -* I18N Functions:: Functions for string translation. -* User-defined:: Describes User-defined functions in - detail. -* Definition Syntax:: How to write definitions and what they - mean. -* Function Example:: An example function definition and - what it does. -* Function Caveats:: Things to watch out for. -* Calling A Function:: Don't use spaces. -* Variable Scope:: Controlling variable scope. -* Pass By Value/Reference:: Passing parameters. -* Return Statement:: Specifying the value a function - returns. -* Dynamic Typing:: How variable types can change at - runtime. -* Indirect Calls:: Choosing the function to call at - runtime. -* Functions Summary:: Summary of functions. -* Library Names:: How to best name private global - variables in library functions. -* General Functions:: Functions that are of general use. -* Strtonum Function:: A replacement for the built-in - 'strtonum()' function. -* Assert Function:: A function for assertions in - 'awk' programs. -* Round Function:: A function for rounding if - 'sprintf()' does not do it - correctly. -* Cliff Random Function:: The Cliff Random Number Generator. -* Ordinal Functions:: Functions for using characters as - numbers and vice versa. -* Join Function:: A function to join an array into a - string. -* Getlocaltime Function:: A function to get formatted times. -* Readfile Function:: A function to read an entire file at - once. -* Shell Quoting:: A function to quote strings for the - shell. -* Data File Management:: Functions for managing command-line - data files. -* Filetrans Function:: A function for handling data file - transitions. -* Rewind Function:: A function for rereading the current - file. -* File Checking:: Checking that data files are readable. -* Empty Files:: Checking for zero-length files. -* Ignoring Assigns:: Treating assignments as file names. -* Getopt Function:: A function for processing command-line - arguments. -* Passwd Functions:: Functions for getting user - information. -* Group Functions:: Functions for getting group - information. -* Walking Arrays:: A function to walk arrays of arrays. -* Library Functions Summary:: Summary of library functions. -* Library Exercises:: Exercises. -* Running Examples:: How to run these examples. -* Clones:: Clones of common utilities. -* Cut Program:: The 'cut' utility. -* Egrep Program:: The 'egrep' utility. -* Id Program:: The 'id' utility. -* Split Program:: The 'split' utility. -* Tee Program:: The 'tee' utility. -* Uniq Program:: The 'uniq' utility. -* Wc Program:: The 'wc' utility. -* Miscellaneous Programs:: Some interesting 'awk' - programs. -* Dupword Program:: Finding duplicated words in a - document. -* Alarm Program:: An alarm clock. -* Translate Program:: A program similar to the 'tr' - utility. -* Labels Program:: Printing mailing labels. -* Word Sorting:: A program to produce a word usage - count. -* History Sorting:: Eliminating duplicate entries from a - history file. -* Extract Program:: Pulling out programs from Texinfo - source files. -* Simple Sed:: A Simple Stream Editor. -* Igawk Program:: A wrapper for 'awk' that - includes files. -* Anagram Program:: Finding anagrams from a dictionary. -* Signature Program:: People do amazing things with too much - time on their hands. -* Programs Summary:: Summary of programs. -* Programs Exercises:: Exercises. -* Nondecimal Data:: Allowing nondecimal input data. -* Array Sorting:: Facilities for controlling array - traversal and sorting arrays. -* Controlling Array Traversal:: How to use PROCINFO["sorted_in"]. -* Array Sorting Functions:: How to use 'asort()' and - 'asorti()'. -* Two-way I/O:: Two-way communications with another - process. -* TCP/IP Networking:: Using 'gawk' for network - programming. -* Profiling:: Profiling your 'awk' programs. -* Advanced Features Summary:: Summary of advanced features. -* I18N and L10N:: Internationalization and Localization. -* Explaining gettext:: How GNU 'gettext' works. -* Programmer i18n:: Features for the programmer. -* Translator i18n:: Features for the translator. -* String Extraction:: Extracting marked strings. -* Printf Ordering:: Rearranging 'printf' arguments. -* I18N Portability:: 'awk'-level portability - issues. -* I18N Example:: A simple i18n example. -* Gawk I18N:: 'gawk' is also - internationalized. -* I18N Summary:: Summary of I18N stuff. -* Debugging:: Introduction to 'gawk' - debugger. -* Debugging Concepts:: Debugging in General. -* Debugging Terms:: Additional Debugging Concepts. -* Awk Debugging:: Awk Debugging. -* Sample Debugging Session:: Sample debugging session. -* Debugger Invocation:: How to Start the Debugger. -* Finding The Bug:: Finding the Bug. -* List of Debugger Commands:: Main debugger commands. -* Breakpoint Control:: Control of Breakpoints. -* Debugger Execution Control:: Control of Execution. -* Viewing And Changing Data:: Viewing and Changing Data. -* Execution Stack:: Dealing with the Stack. -* Debugger Info:: Obtaining Information about the - Program and the Debugger State. -* Miscellaneous Debugger Commands:: Miscellaneous Commands. -* Readline Support:: Readline support. -* Limitations:: Limitations and future plans. -* Debugging Summary:: Debugging summary. -* Computer Arithmetic:: A quick intro to computer math. -* Math Definitions:: Defining terms used. -* MPFR features:: The MPFR features in 'gawk'. -* FP Math Caution:: Things to know. -* Inexactness of computations:: Floating point math is not exact. -* Inexact representation:: Numbers are not exactly represented. -* Comparing FP Values:: How to compare floating point values. -* Errors accumulate:: Errors get bigger as they go. -* Getting Accuracy:: Getting more accuracy takes some work. -* Try To Round:: Add digits and round. -* Setting precision:: How to set the precision. -* Setting the rounding mode:: How to set the rounding mode. -* Arbitrary Precision Integers:: Arbitrary Precision Integer Arithmetic - with 'gawk'. -* POSIX Floating Point Problems:: Standards Versus Existing Practice. -* Floating point summary:: Summary of floating point discussion. -* Extension Intro:: What is an extension. -* Plugin License:: A note about licensing. -* Extension Mechanism Outline:: An outline of how it works. -* Extension API Description:: A full description of the API. -* Extension API Functions Introduction:: Introduction to the API functions. -* General Data Types:: The data types. -* Memory Allocation Functions:: Functions for allocating memory. -* Constructor Functions:: Functions for creating values. -* Registration Functions:: Functions to register things with - 'gawk'. -* Extension Functions:: Registering extension functions. -* Exit Callback Functions:: Registering an exit callback. -* Extension Version String:: Registering a version string. -* Input Parsers:: Registering an input parser. -* Output Wrappers:: Registering an output wrapper. -* Two-way processors:: Registering a two-way processor. -* Printing Messages:: Functions for printing messages. -* Updating ERRNO:: Functions for updating 'ERRNO'. -* Requesting Values:: How to get a value. -* Accessing Parameters:: Functions for accessing parameters. -* Symbol Table Access:: Functions for accessing global - variables. -* Symbol table by name:: Accessing variables by name. -* Symbol table by cookie:: Accessing variables by "cookie". -* Cached values:: Creating and using cached values. -* Array Manipulation:: Functions for working with arrays. -* Array Data Types:: Data types for working with arrays. -* Array Functions:: Functions for working with arrays. -* Flattening Arrays:: How to flatten arrays. -* Creating Arrays:: How to create and populate arrays. -* Redirection API:: How to access and manipulate redirections. -* Extension API Variables:: Variables provided by the API. -* Extension Versioning:: API Version information. -* Extension API Informational Variables:: Variables providing information about - 'gawk''s invocation. -* Extension API Boilerplate:: Boilerplate code for using the API. -* Finding Extensions:: How 'gawk' finds compiled - extensions. -* Extension Example:: Example C code for an extension. -* Internal File Description:: What the new functions will do. -* Internal File Ops:: The code for internal file operations. -* Using Internal File Ops:: How to use an external extension. -* Extension Samples:: The sample extensions that ship with - 'gawk'. -* Extension Sample File Functions:: The file functions sample. -* Extension Sample Fnmatch:: An interface to 'fnmatch()'. -* Extension Sample Fork:: An interface to 'fork()' and - other process functions. -* Extension Sample Inplace:: Enabling in-place file editing. -* Extension Sample Ord:: Character to value to character - conversions. -* Extension Sample Readdir:: An interface to 'readdir()'. -* Extension Sample Revout:: Reversing output sample output - wrapper. -* Extension Sample Rev2way:: Reversing data sample two-way - processor. -* Extension Sample Read write array:: Serializing an array to a file. -* Extension Sample Readfile:: Reading an entire file into a string. -* Extension Sample Time:: An interface to 'gettimeofday()' - and 'sleep()'. -* Extension Sample API Tests:: Tests for the API. -* gawkextlib:: The 'gawkextlib' project. -* Extension summary:: Extension summary. -* Extension Exercises:: Exercises. -* V7/SVR3.1:: The major changes between V7 and - System V Release 3.1. -* SVR4:: Minor changes between System V - Releases 3.1 and 4. -* POSIX:: New features from the POSIX standard. -* BTL:: New features from Brian Kernighan's - version of 'awk'. -* POSIX/GNU:: The extensions in 'gawk' not - in POSIX 'awk'. -* Feature History:: The history of the features in - 'gawk'. -* Common Extensions:: Common Extensions Summary. -* Ranges and Locales:: How locales used to affect regexp - ranges. -* Contributors:: The major contributors to - 'gawk'. -* History summary:: History summary. -* Gawk Distribution:: What is in the 'gawk' - distribution. -* Getting:: How to get the distribution. -* Extracting:: How to extract the distribution. -* Distribution contents:: What is in the distribution. -* Unix Installation:: Installing 'gawk' under - various versions of Unix. -* Quick Installation:: Compiling 'gawk' under Unix. -* Shell Startup Files:: Shell convenience functions. -* Additional Configuration Options:: Other compile-time options. -* Configuration Philosophy:: How it's all supposed to work. -* Non-Unix Installation:: Installation on Other Operating - Systems. -* PC Installation:: Installing and Compiling 'gawk' on - Microsoft Windows. -* PC Binary Installation:: Installing a prepared distribution. -* PC Compiling:: Compiling 'gawk' for Windows32. -* PC Using:: Running 'gawk' on Windows32. -* Cygwin:: Building and running 'gawk' - for Cygwin. -* MSYS:: Using 'gawk' In The MSYS - Environment. -* VMS Installation:: Installing 'gawk' on VMS. -* VMS Compilation:: How to compile 'gawk' under - VMS. -* VMS Dynamic Extensions:: Compiling 'gawk' dynamic - extensions on VMS. -* VMS Installation Details:: How to install 'gawk' under - VMS. -* VMS Running:: How to run 'gawk' under VMS. -* VMS GNV:: The VMS GNV Project. -* VMS Old Gawk:: An old version comes with some VMS - systems. -* Bugs:: Reporting Problems and Bugs. -* Bug address:: Where to send reports to. -* Usenet:: Where not to send reports to. -* Maintainers:: Maintainers of non-*nix ports. -* Other Versions:: Other freely available 'awk' - implementations. -* Installation summary:: Summary of installation. -* Compatibility Mode:: How to disable certain 'gawk' - extensions. -* Additions:: Making Additions To 'gawk'. -* Accessing The Source:: Accessing the Git repository. -* Adding Code:: Adding code to the main body of - 'gawk'. -* New Ports:: Porting 'gawk' to a new - operating system. -* Derived Files:: Why derived files are kept in the Git - repository. -* Future Extensions:: New features that may be implemented - one day. -* Implementation Limitations:: Some limitations of the - implementation. -* Extension Design:: Design notes about the extension API. -* Old Extension Problems:: Problems with the old mechanism. -* Extension New Mechanism Goals:: Goals for the new mechanism. -* Extension Other Design Decisions:: Some other design decisions. -* Extension Future Growth:: Some room for future growth. -* Old Extension Mechanism:: Some compatibility for old extensions. -* Notes summary:: Summary of implementation notes. -* Basic High Level:: The high level view. -* Basic Data Typing:: A very quick intro to data types. - - To my parents, for their love, and for the wonderful example they set -for me. - - To my wife Miriam, for making me complete. Thank you for building -your life together with me. - - To our children Chana, Rivka, Nachum and Malka, for enrichening our -lives in innumerable ways. - - -File: gawk.info, Node: Foreword3, Next: Foreword4, Prev: Top, Up: Top - -Foreword to the Third Edition -***************************** - -Arnold Robbins and I are good friends. We were introduced in 1990 by -circumstances--and our favorite programming language, AWK. The -circumstances started a couple of years earlier. I was working at a new -job and noticed an unplugged Unix computer sitting in the corner. No -one knew how to use it, and neither did I. However, a couple of days -later, it was running, and I was 'root' and the one-and-only user. That -day, I began the transition from statistician to Unix programmer. - - On one of many trips to the library or bookstore in search of books -on Unix, I found the gray AWK book, a.k.a. Alfred V. Aho, Brian W. -Kernighan, and Peter J. Weinberger's 'The AWK Programming Language' -(Addison-Wesley, 1988). 'awk''s simple programming paradigm--find a -pattern in the input and then perform an action--often reduced complex -or tedious data manipulations to a few lines of code. I was excited to -try my hand at programming in AWK. - - Alas, the 'awk' on my computer was a limited version of the language -described in the gray book. I discovered that my computer had "old -'awk'" and the book described "new 'awk'." I learned that this was -typical; the old version refused to step aside or relinquish its name. -If a system had a new 'awk', it was invariably called 'nawk', and few -systems had it. The best way to get a new 'awk' was to 'ftp' the source -code for 'gawk' from 'prep.ai.mit.edu'. 'gawk' was a version of new -'awk' written by David Trueman and Arnold, and available under the GNU -General Public License. - - (Incidentally, it's no longer difficult to find a new 'awk'. 'gawk' -ships with GNU/Linux, and you can download binaries or source code for -almost any system; my wife uses 'gawk' on her VMS box.) - - My Unix system started out unplugged from the wall; it certainly was -not plugged into a network. So, oblivious to the existence of 'gawk' -and the Unix community in general, and desiring a new 'awk', I wrote my -own, called 'mawk'. Before I was finished, I knew about 'gawk', but it -was too late to stop, so I eventually posted to a 'comp.sources' -newsgroup. - - A few days after my posting, I got a friendly email from Arnold -introducing himself. He suggested we share design and algorithms and -attached a draft of the POSIX standard so that I could update 'mawk' to -support language extensions added after publication of 'The AWK -Programming Language'. - - Frankly, if our roles had been reversed, I would not have been so -open and we probably would have never met. I'm glad we did meet. He is -an AWK expert's AWK expert and a genuinely nice person. Arnold -contributes significant amounts of his expertise and time to the Free -Software Foundation. - - This book is the 'gawk' reference manual, but at its core it is a -book about AWK programming that will appeal to a wide audience. It is a -definitive reference to the AWK language as defined by the 1987 Bell -Laboratories release and codified in the 1992 POSIX Utilities standard. - - On the other hand, the novice AWK programmer can study a wealth of -practical programs that emphasize the power of AWK's basic idioms: -data-driven control flow, pattern matching with regular expressions, and -associative arrays. Those looking for something new can try out -'gawk''s interface to network protocols via special '/inet' files. - - The programs in this book make clear that an AWK program is typically -much smaller and faster to develop than a counterpart written in C. -Consequently, there is often a payoff to prototyping an algorithm or -design in AWK to get it running quickly and expose problems early. -Often, the interpreted performance is adequate and the AWK prototype -becomes the product. - - The new 'pgawk' (profiling 'gawk'), produces program execution -counts. I recently experimented with an algorithm that for n lines of -input, exhibited ~ C n^2 performance, while theory predicted ~ C n log n -behavior. A few minutes poring over the 'awkprof.out' profile -pinpointed the problem to a single line of code. 'pgawk' is a welcome -addition to my programmer's toolbox. - - Arnold has distilled over a decade of experience writing and using -AWK programs, and developing 'gawk', into this book. If you use AWK or -want to learn how, then read this book. - - Michael Brennan - Author of 'mawk' - March 2001 - - -File: gawk.info, Node: Foreword4, Next: Preface, Prev: Foreword3, Up: Top - -Foreword to the Fourth Edition -****************************** - -Some things don't change. Thirteen years ago I wrote: "If you use AWK -or want to learn how, then read this book." True then, and still true -today. - - Learning to use a programming language is about more than mastering -the syntax. One needs to acquire an understanding of how to use the -features of the language to solve practical programming problems. A -focus of this book is many examples that show how to use AWK. - - Some things do change. Our computers are much faster and have more -memory. Consequently, speed and storage inefficiencies of a high-level -language matter less. Prototyping in AWK and then rewriting in C for -performance reasons happens less, because more often the prototype is -fast enough. - - Of course, there are computing operations that are best done in C or -C++. With 'gawk' 4.1 and later, you do not have to choose between -writing your program in AWK or in C/C++. You can write most of your -program in AWK and the aspects that require C/C++ capabilities can be -written in C/C++, and then the pieces glued together when the 'gawk' -module loads the C/C++ module as a dynamic plug-in. *note Dynamic -Extensions::, has all the details, and, as expected, many examples to -help you learn the ins and outs. - - I enjoy programming in AWK and had fun (re)reading this book. I -think you will too. - - Michael Brennan - Author of 'mawk' - October 2014 - - -File: gawk.info, Node: Preface, Next: Getting Started, Prev: Foreword4, Up: Top - -Preface -******* - -Several kinds of tasks occur repeatedly when working with text files. -You might want to extract certain lines and discard the rest. Or you -may need to make changes wherever certain patterns appear, but leave the -rest of the file alone. Such jobs are often easy with 'awk'. The 'awk' -utility interprets a special-purpose programming language that makes it -easy to handle simple data-reformatting jobs. - - The GNU implementation of 'awk' is called 'gawk'; if you invoke it -with the proper options or environment variables, it is fully compatible -with the POSIX(1) specification of the 'awk' language and with the Unix -version of 'awk' maintained by Brian Kernighan. This means that all -properly written 'awk' programs should work with 'gawk'. So most of the -time, we don't distinguish between 'gawk' and other 'awk' -implementations. - - Using 'awk' you can: - - * Manage small, personal databases - - * Generate reports - - * Validate data - - * Produce indexes and perform other document-preparation tasks - - * Experiment with algorithms that you can adapt later to other - computer languages - - In addition, 'gawk' provides facilities that make it easy to: - - * Extract bits and pieces of data for processing - - * Sort data - - * Perform simple network communications - - * Profile and debug 'awk' programs - - * Extend the language with functions written in C or C++ - - This Info file teaches you about the 'awk' language and how you can -use it effectively. You should already be familiar with basic system -commands, such as 'cat' and 'ls',(2) as well as basic shell facilities, -such as input/output (I/O) redirection and pipes. - - Implementations of the 'awk' language are available for many -different computing environments. This Info file, while describing the -'awk' language in general, also describes the particular implementation -of 'awk' called 'gawk' (which stands for "GNU 'awk'"). 'gawk' runs on a -broad range of Unix systems, ranging from Intel-architecture PC-based -computers up through large-scale systems. 'gawk' has also been ported -to Mac OS X, Microsoft Windows (all versions), and OpenVMS.(3) - -* Menu: - -* History:: The history of 'gawk' and - 'awk'. -* Names:: What name to use to find 'awk'. -* This Manual:: Using this Info file. Includes sample - input files that you can use. -* Conventions:: Typographical Conventions. -* Manual History:: Brief history of the GNU project and this - Info file. -* How To Contribute:: Helping to save the world. -* Acknowledgments:: Acknowledgments. - - ---------- Footnotes ---------- - - (1) The 2008 POSIX standard is accessible online at -<http://www.opengroup.org/onlinepubs/9699919799/>. - - (2) These utilities are available on POSIX-compliant systems, as well -as on traditional Unix-based systems. If you are using some other -operating system, you still need to be familiar with the ideas of I/O -redirection and pipes. - - (3) Some other, obsolete systems to which 'gawk' was once ported are -no longer supported and the code for those systems has been removed. - - -File: gawk.info, Node: History, Next: Names, Up: Preface - -History of 'awk' and 'gawk' -=========================== - - Recipe for a Programming Language - - 1 part 'egrep' 1 part 'snobol' - 2 parts 'ed' 3 parts C - - Blend all parts well using 'lex' and 'yacc'. Document minimally and -release. - - After eight years, add another part 'egrep' and two more parts C. -Document very well and release. - - The name 'awk' comes from the initials of its designers: Alfred V. -Aho, Peter J. Weinberger, and Brian W. Kernighan. The original version -of 'awk' was written in 1977 at AT&T Bell Laboratories. In 1985, a new -version made the programming language more powerful, introducing -user-defined functions, multiple input streams, and computed regular -expressions. This new version became widely available with Unix System -V Release 3.1 (1987). The version in System V Release 4 (1989) added -some new features and cleaned up the behavior in some of the "dark -corners" of the language. The specification for 'awk' in the POSIX -Command Language and Utilities standard further clarified the language. -Both the 'gawk' designers and the original 'awk' designers at Bell -Laboratories provided feedback for the POSIX specification. - - Paul Rubin wrote 'gawk' in 1986. Jay Fenlason completed it, with -advice from Richard Stallman. John Woods contributed parts of the code -as well. In 1988 and 1989, David Trueman, with help from me, thoroughly -reworked 'gawk' for compatibility with the newer 'awk'. Circa 1994, I -became the primary maintainer. Current development focuses on bug -fixes, performance improvements, standards compliance, and, -occasionally, new features. - - In May 1997, Ju"rgen Kahrs felt the need for network access from -'awk', and with a little help from me, set about adding features to do -this for 'gawk'. At that time, he also wrote the bulk of 'TCP/IP -Internetworking with 'gawk'' (a separate document, available as part of -the 'gawk' distribution). His code finally became part of the main -'gawk' distribution with 'gawk' version 3.1. - - John Haque rewrote the 'gawk' internals, in the process providing an -'awk'-level debugger. This version became available as 'gawk' version -4.0 in 2011. - - *Note Contributors:: for a full list of those who have made important -contributions to 'gawk'. - - -File: gawk.info, Node: Names, Next: This Manual, Prev: History, Up: Preface - -A Rose by Any Other Name -======================== - -The 'awk' language has evolved over the years. Full details are -provided in *note Language History::. The language described in this -Info file is often referred to as "new 'awk'." By analogy, the original -version of 'awk' is referred to as "old 'awk'." - - On most current systems, when you run the 'awk' utility you get some -version of new 'awk'.(1) If your system's standard 'awk' is the old -one, you will see something like this if you try the test program: - - $ awk 1 /dev/null - error-> awk: syntax error near line 1 - error-> awk: bailing out near line 1 - -In this case, you should find a version of new 'awk', or just install -'gawk'! - - Throughout this Info file, whenever we refer to a language feature -that should be available in any complete implementation of POSIX 'awk', -we simply use the term 'awk'. When referring to a feature that is -specific to the GNU implementation, we use the term 'gawk'. - - ---------- Footnotes ---------- - - (1) Only Solaris systems still use an old 'awk' for the default 'awk' -utility. A more modern 'awk' lives in '/usr/xpg6/bin' on these systems. - - -File: gawk.info, Node: This Manual, Next: Conventions, Prev: Names, Up: Preface - -Using This Book -=============== - -The term 'awk' refers to a particular program as well as to the language -you use to tell this program what to do. When we need to be careful, we -call the language "the 'awk' language," and the program "the 'awk' -utility." This Info file explains both how to write programs in the -'awk' language and how to run the 'awk' utility. The term "'awk' -program" refers to a program written by you in the 'awk' programming -language. - - Primarily, this Info file explains the features of 'awk' as defined -in the POSIX standard. It does so in the context of the 'gawk' -implementation. While doing so, it also attempts to describe important -differences between 'gawk' and other 'awk' implementations.(1) Finally, -it notes any 'gawk' features that are not in the POSIX standard for -'awk'. - - There are sidebars scattered throughout the Info file. They add a -more complete explanation of points that are relevant, but not likely to -be of interest on first reading. All appear in the index, under the -heading "sidebar." - - Most of the time, the examples use complete 'awk' programs. Some of -the more advanced minor nodes show only the part of the 'awk' program -that illustrates the concept being described. - - Although this Info file is aimed principally at people who have not -been exposed to 'awk', there is a lot of information here that even the -'awk' expert should find useful. In particular, the description of -POSIX 'awk' and the example programs in *note Library Functions::, and -in *note Sample Programs::, should be of interest. - - This Info file is split into several parts, as follows: - - * Part I describes the 'awk' language and the 'gawk' program in - detail. It starts with the basics, and continues through all of - the features of 'awk'. It contains the following chapters: - - - *note Getting Started::, provides the essentials you need to - know to begin using 'awk'. - - - *note Invoking Gawk::, describes how to run 'gawk', the - meaning of its command-line options, and how it finds 'awk' - program source files. - - - *note Regexp::, introduces regular expressions in general, and - in particular the flavors supported by POSIX 'awk' and 'gawk'. - - - *note Reading Files::, describes how 'awk' reads your data. - It introduces the concepts of records and fields, as well as - the 'getline' command. I/O redirection is first described - here. Network I/O is also briefly introduced here. - - - *note Printing::, describes how 'awk' programs can produce - output with 'print' and 'printf'. - - - *note Expressions::, describes expressions, which are the - basic building blocks for getting most things done in a - program. - - - *note Patterns and Actions::, describes how to write patterns - for matching records, actions for doing something when a - record is matched, and the predefined variables 'awk' and - 'gawk' use. - - - *note Arrays::, covers 'awk''s one-and-only data structure: - the associative array. Deleting array elements and whole - arrays is described, as well as sorting arrays in 'gawk'. The - major node also describes how 'gawk' provides arrays of - arrays. - - - *note Functions::, describes the built-in functions 'awk' and - 'gawk' provide, as well as how to define your own functions. - It also discusses how 'gawk' lets you call functions - indirectly. - - * Part II shows how to use 'awk' and 'gawk' for problem solving. - There is lots of code here for you to read and learn from. This - part contains the following chapters: - - - *note Library Functions::, provides a number of functions - meant to be used from main 'awk' programs. - - - *note Sample Programs::, provides many sample 'awk' programs. - - Reading these two chapters allows you to see 'awk' solving real - problems. - - * Part III focuses on features specific to 'gawk'. It contains the - following chapters: - - - *note Advanced Features::, describes a number of advanced - features. Of particular note are the abilities to control the - order of array traversal, have two-way communications with - another process, perform TCP/IP networking, and profile your - 'awk' programs. - - - *note Internationalization::, describes special features for - translating program messages into different languages at - runtime. - - - *note Debugger::, describes the 'gawk' debugger. - - - *note Arbitrary Precision Arithmetic::, describes advanced - arithmetic facilities. - - - *note Dynamic Extensions::, describes how to add new variables - and functions to 'gawk' by writing extensions in C or C++. - - * Part IV provides the appendices, the Glossary, and two licenses - that cover the 'gawk' source code and this Info file, respectively. - It contains the following appendices: - - - *note Language History::, describes how the 'awk' language has - evolved since its first release to the present. It also - describes how 'gawk' has acquired features over time. - - - *note Installation::, describes how to get 'gawk', how to - compile it on POSIX-compatible systems, and how to compile and - use it on different non-POSIX systems. It also describes how - to report bugs in 'gawk' and where to get other freely - available 'awk' implementations. - - - *note Notes::, describes how to disable 'gawk''s extensions, - as well as how to contribute new code to 'gawk', and some - possible future directions for 'gawk' development. - - - *note Basic Concepts::, provides some very cursory background - material for those who are completely unfamiliar with computer - programming. - - The *note Glossary::, defines most, if not all, of the - significant terms used throughout the Info file. If you find - terms that you aren't familiar with, try looking them up here. - - - *note Copying::, and *note GNU Free Documentation License::, - present the licenses that cover the 'gawk' source code and - this Info file, respectively. - - ---------- Footnotes ---------- - - (1) All such differences appear in the index under the entry -"differences in 'awk' and 'gawk'." - - -File: gawk.info, Node: Conventions, Next: Manual History, Prev: This Manual, Up: Preface - -Typographical Conventions -========================= - -This Info file is written in Texinfo -(http://www.gnu.org/software/texinfo/), the GNU documentation formatting -language. A single Texinfo source file is used to produce both the -printed and online versions of the documentation. This minor node -briefly documents the typographical conventions used in Texinfo. - - Examples you would type at the command line are preceded by the -common shell primary and secondary prompts, '$' and '>'. Input that you -type is shown 'like this'. Output from the command is preceded by the -glyph "-|". This typically represents the command's standard output. -Error messages and other output on the command's standard error are -preceded by the glyph "error->". For example: - - $ echo hi on stdout - -| hi on stdout - $ echo hello on stderr 1>&2 - error-> hello on stderr - - Characters that you type at the keyboard look 'like this'. In -particular, there are special characters called "control characters." -These are characters that you type by holding down both the 'CONTROL' -key and another key, at the same time. For example, a 'Ctrl-d' is typed -by first pressing and holding the 'CONTROL' key, next pressing the 'd' -key, and finally releasing both keys. - - For the sake of brevity, throughout this Info file, we refer to Brian -Kernighan's version of 'awk' as "BWK 'awk'." (*Note Other Versions:: -for information on his and other versions.) - -Dark Corners ------------- - - Dark corners are basically fractal--no matter how much you - illuminate, there's always a smaller but darker one. - -- _Brian Kernighan_ - - Until the POSIX standard (and 'GAWK: Effective AWK Programming'), -many features of 'awk' were either poorly documented or not documented -at all. Descriptions of such features (often called "dark corners") are -noted in this Info file with "(d.c.)." They also appear in the index -under the heading "dark corner." - - But, as noted by the opening quote, any coverage of dark corners is -by definition incomplete. - - Extensions to the standard 'awk' language that are supported by more -than one 'awk' implementation are marked "(c.e.)," and listed in the -index under "common extensions" and "extensions, common." - - -File: gawk.info, Node: Manual History, Next: How To Contribute, Prev: Conventions, Up: Preface - -The GNU Project and This Book -============================= - -The Free Software Foundation (FSF) is a nonprofit organization dedicated -to the production and distribution of freely distributable software. It -was founded by Richard M. Stallman, the author of the original Emacs -editor. GNU Emacs is the most widely used version of Emacs today. - - The GNU(1) Project is an ongoing effort on the part of the Free -Software Foundation to create a complete, freely distributable, -POSIX-compliant computing environment. The FSF uses the GNU General -Public License (GPL) to ensure that its software's source code is always -available to the end user. A copy of the GPL is included for your -reference (*note Copying::). The GPL applies to the C language source -code for 'gawk'. To find out more about the FSF and the GNU Project -online, see the GNU Project's home page (http://www.gnu.org). This Info -file may also be read from GNU's website -(http://www.gnu.org/software/gawk/manual/). - - A shell, an editor (Emacs), highly portable optimizing C, C++, and -Objective-C compilers, a symbolic debugger and dozens of large and small -utilities (such as 'gawk'), have all been completed and are freely -available. The GNU operating system kernel (the HURD), has been -released but remains in an early stage of development. - - Until the GNU operating system is more fully developed, you should -consider using GNU/Linux, a freely distributable, Unix-like operating -system for Intel, Power Architecture, Sun SPARC, IBM S/390, and other -systems.(2) Many GNU/Linux distributions are available for download -from the Internet. - - The Info file itself has gone through multiple previous editions. -Paul Rubin wrote the very first draft of 'The GAWK Manual'; it was -around 40 pages long. Diane Close and Richard Stallman improved it, -yielding a version that was around 90 pages and barely described the -original, "old" version of 'awk'. - - I started working with that version in the fall of 1988. As work on -it progressed, the FSF published several preliminary versions (numbered -0.X). In 1996, edition 1.0 was released with 'gawk' 3.0.0. The FSF -published the first two editions under the title 'The GNU Awk User's -Guide'. - - This edition maintains the basic structure of the previous editions. -For FSF edition 4.0, the content was thoroughly reviewed and updated. -All references to 'gawk' versions prior to 4.0 were removed. Of -significant note for that edition was the addition of *note Debugger::. - - For FSF edition 4.1, the content has been reorganized into parts, and -the major new additions are *note Arbitrary Precision Arithmetic::, and -*note Dynamic Extensions::. - - This Info file will undoubtedly continue to evolve. If you find an -error in the Info file, please report it! *Note Bugs:: for information -on submitting problem reports electronically. - - ---------- Footnotes ---------- - - (1) GNU stands for "GNU's Not Unix." - - (2) The terminology "GNU/Linux" is explained in the *note Glossary::. - - -File: gawk.info, Node: How To Contribute, Next: Acknowledgments, Prev: Manual History, Up: Preface - -How to Contribute -================= - -As the maintainer of GNU 'awk', I once thought that I would be able to -manage a collection of publicly available 'awk' programs and I even -solicited contributions. Making things available on the Internet helps -keep the 'gawk' distribution down to manageable size. - - The initial collection of material, such as it is, is still available -at <ftp://ftp.freefriends.org/arnold/Awkstuff>. In the hopes of doing -something more broad, I acquired the 'awk.info' domain. - - However, I found that I could not dedicate enough time to managing -contributed code: the archive did not grow and the domain went unused -for several years. - - Late in 2008, a volunteer took on the task of setting up an -'awk'-related website--<http://awk.info>--and did a very nice job. - - If you have written an interesting 'awk' program, or have written a -'gawk' extension that you would like to share with the rest of the -world, please see <http://awk.info/?contribute> for how to contribute it -to the website. - - -File: gawk.info, Node: Acknowledgments, Prev: How To Contribute, Up: Preface - -Acknowledgments -=============== - -The initial draft of 'The GAWK Manual' had the following -acknowledgments: - - Many people need to be thanked for their assistance in producing - this manual. Jay Fenlason contributed many ideas and sample - programs. Richard Mlynarik and Robert Chassell gave helpful - comments on drafts of this manual. The paper 'A Supplemental - Document for AWK' by John W. Pierce of the Chemistry Department at - UC San Diego, pinpointed several issues relevant both to 'awk' - implementation and to this manual, that would otherwise have - escaped us. - - I would like to acknowledge Richard M. Stallman, for his vision of a -better world and for his courage in founding the FSF and starting the -GNU Project. - - Earlier editions of this Info file had the following -acknowledgements: - - The following people (in alphabetical order) provided helpful - comments on various versions of this book: Rick Adams, Dr. Nelson - H.F. Beebe, Karl Berry, Dr. Michael Brennan, Rich Burridge, Claire - Cloutier, Diane Close, Scott Deifik, Christopher ("Topher") Eliot, - Jeffrey Friedl, Dr. Darrel Hankerson, Michal Jaegermann, Dr. - Richard J. LeBlanc, Michael Lijewski, Pat Rankin, Miriam Robbins, - Mary Sheehan, and Chuck Toporek. - - Robert J. Chassell provided much valuable advice on the use of - Texinfo. He also deserves special thanks for convincing me _not_ - to title this Info file 'How to Gawk Politely'. Karl Berry helped - significantly with the TeX part of Texinfo. - - I would like to thank Marshall and Elaine Hartholz of Seattle and - Dr. Bert and Rita Schreiber of Detroit for large amounts of quiet - vacation time in their homes, which allowed me to make significant - progress on this Info file and on 'gawk' itself. - - Phil Hughes of SSC contributed in a very important way by loaning - me his laptop GNU/Linux system, not once, but twice, which allowed - me to do a lot of work while away from home. - - David Trueman deserves special credit; he has done a yeoman job of - evolving 'gawk' so that it performs well and without bugs. - Although he is no longer involved with 'gawk', working with him on - this project was a significant pleasure. - - The intrepid members of the GNITS mailing list, and most notably - Ulrich Drepper, provided invaluable help and feedback for the - design of the internationalization features. - - Chuck Toporek, Mary Sheehan, and Claire Cloutier of O'Reilly & - Associates contributed significant editorial help for this Info - file for the 3.1 release of 'gawk'. - - Dr. Nelson Beebe, Andreas Buening, Dr. Manuel Collado, Antonio -Colombo, Stephen Davies, Scott Deifik, Akim Demaille, Daniel Richard G., -Darrel Hankerson, Michal Jaegermann, Ju"rgen Kahrs, Stepan Kasal, John -Malmberg, Dave Pitts, Chet Ramey, Pat Rankin, Andrew Schorr, Corinna -Vinschen, and Eli Zaretskii (in alphabetical order) make up the current -'gawk' "crack portability team." Without their hard work and help, -'gawk' would not be nearly the robust, portable program it is today. It -has been and continues to be a pleasure working with this team of fine -people. - - Notable code and documentation contributions were made by a number of -people. *Note Contributors:: for the full list. - - Thanks to Michael Brennan for the Forewords. - - Thanks to Patrice Dumas for the new 'makeinfo' program. Thanks to -Karl Berry, who continues to work to keep the Texinfo markup language -sane. - - Robert P.J. Day, Michael Brennan, and Brian Kernighan kindly acted as -reviewers for the 2015 edition of this Info file. Their feedback helped -improve the final work. - - I would also like to thank Brian Kernighan for his invaluable -assistance during the testing and debugging of 'gawk', and for his -ongoing help and advice in clarifying numerous points about the -language. We could not have done nearly as good a job on either 'gawk' -or its documentation without his help. - - Brian is in a class by himself as a programmer and technical author. -I have to thank him (yet again) for his ongoing friendship and for being -a role model to me for close to 30 years! Having him as a reviewer is -an exciting privilege. It has also been extremely humbling... - - I must thank my wonderful wife, Miriam, for her patience through the -many versions of this project, for her proofreading, and for sharing me -with the computer. I would like to thank my parents for their love, and -for the grace with which they raised and educated me. Finally, I also -must acknowledge my gratitude to G-d, for the many opportunities He has -sent my way, as well as for the gifts He has given me with which to take -advantage of those opportunities. - - -Arnold Robbins -Nof Ayalon -Israel -February 2015 - - -File: gawk.info, Node: Getting Started, Next: Invoking Gawk, Prev: Preface, Up: Top - -1 Getting Started with 'awk' -**************************** - -The basic function of 'awk' is to search files for lines (or other units -of text) that contain certain patterns. When a line matches one of the -patterns, 'awk' performs specified actions on that line. 'awk' -continues to process input lines in this way until it reaches the end of -the input files. - - Programs in 'awk' are different from programs in most other -languages, because 'awk' programs are "data driven" (i.e., you describe -the data you want to work with and then what to do when you find it). -Most other languages are "procedural"; you have to describe, in great -detail, every step the program should take. When working with -procedural languages, it is usually much harder to clearly describe the -data your program will process. For this reason, 'awk' programs are -often refreshingly easy to read and write. - - When you run 'awk', you specify an 'awk' "program" that tells 'awk' -what to do. The program consists of a series of "rules" (it may also -contain "function definitions", an advanced feature that we will ignore -for now; *note User-defined::). Each rule specifies one pattern to -search for and one action to perform upon finding the pattern. - - Syntactically, a rule consists of a "pattern" followed by an -"action". The action is enclosed in braces to separate it from the -pattern. Newlines usually separate rules. Therefore, an 'awk' program -looks like this: - - PATTERN { ACTION } - PATTERN { ACTION } - ... - -* Menu: - -* Running gawk:: How to run 'gawk' programs; includes - command-line syntax. -* Sample Data Files:: Sample data files for use in the 'awk' - programs illustrated in this Info file. -* Very Simple:: A very simple example. -* Two Rules:: A less simple one-line example using two - rules. -* More Complex:: A more complex example. -* Statements/Lines:: Subdividing or combining statements into - lines. -* Other Features:: Other Features of 'awk'. -* When:: When to use 'gawk' and when to use - other things. -* Intro Summary:: Summary of the introduction. - - -File: gawk.info, Node: Running gawk, Next: Sample Data Files, Up: Getting Started - -1.1 How to Run 'awk' Programs -============================= - -There are several ways to run an 'awk' program. If the program is -short, it is easiest to include it in the command that runs 'awk', like -this: - - awk 'PROGRAM' INPUT-FILE1 INPUT-FILE2 ... - - When the program is long, it is usually more convenient to put it in -a file and run it with a command like this: - - awk -f PROGRAM-FILE INPUT-FILE1 INPUT-FILE2 ... - - This minor node discusses both mechanisms, along with several -variations of each. - -* Menu: - -* One-shot:: Running a short throwaway 'awk' - program. -* Read Terminal:: Using no input files (input from the keyboard - instead). -* Long:: Putting permanent 'awk' programs in - files. -* Executable Scripts:: Making self-contained 'awk' programs. -* Comments:: Adding documentation to 'gawk' - programs. -* Quoting:: More discussion of shell quoting issues. - - -File: gawk.info, Node: One-shot, Next: Read Terminal, Up: Running gawk - -1.1.1 One-Shot Throwaway 'awk' Programs ---------------------------------------- - -Once you are familiar with 'awk', you will often type in simple programs -the moment you want to use them. Then you can write the program as the -first argument of the 'awk' command, like this: - - awk 'PROGRAM' INPUT-FILE1 INPUT-FILE2 ... - -where PROGRAM consists of a series of patterns and actions, as described -earlier. - - This command format instructs the "shell", or command interpreter, to -start 'awk' and use the PROGRAM to process records in the input file(s). -There are single quotes around PROGRAM so the shell won't interpret any -'awk' characters as special shell characters. The quotes also cause the -shell to treat all of PROGRAM as a single argument for 'awk', and allow -PROGRAM to be more than one line long. - - This format is also useful for running short or medium-sized 'awk' -programs from shell scripts, because it avoids the need for a separate -file for the 'awk' program. A self-contained shell script is more -reliable because there are no other files to misplace. - - Later in this chapter, in *note Very Simple::, we'll see examples of -several short, self-contained programs. - - -File: gawk.info, Node: Read Terminal, Next: Long, Prev: One-shot, Up: Running gawk - -1.1.2 Running 'awk' Without Input Files ---------------------------------------- - -You can also run 'awk' without any input files. If you type the -following command line: - - awk 'PROGRAM' - -'awk' applies the PROGRAM to the "standard input", which usually means -whatever you type on the keyboard. This continues until you indicate -end-of-file by typing 'Ctrl-d'. (On non-POSIX operating systems, the -end-of-file character may be different.) - - As an example, the following program prints a friendly piece of -advice (from Douglas Adams's 'The Hitchhiker's Guide to the Galaxy'), to -keep you from worrying about the complexities of computer programming: - - $ awk 'BEGIN { print "Don\47t Panic!" }' - -| Don't Panic! - - 'awk' executes statements associated with 'BEGIN' before reading any -input. If there are no other statements in your program, as is the case -here, 'awk' just stops, instead of trying to read input it doesn't know -how to process. The '\47' is a magic way (explained later) of getting a -single quote into the program, without having to engage in ugly shell -quoting tricks. - - NOTE: If you use Bash as your shell, you should execute the command - 'set +H' before running this program interactively, to disable the - C shell-style command history, which treats '!' as a special - character. We recommend putting this command into your personal - startup file. - - This next simple 'awk' program emulates the 'cat' utility; it copies -whatever you type on the keyboard to its standard output (why this works -is explained shortly): - - $ awk '{ print }' - Now is the time for all good men - -| Now is the time for all good men - to come to the aid of their country. - -| to come to the aid of their country. - Four score and seven years ago, ... - -| Four score and seven years ago, ... - What, me worry? - -| What, me worry? - Ctrl-d - - -File: gawk.info, Node: Long, Next: Executable Scripts, Prev: Read Terminal, Up: Running gawk - -1.1.3 Running Long Programs ---------------------------- - -Sometimes 'awk' programs are very long. In these cases, it is more -convenient to put the program into a separate file. In order to tell -'awk' to use that file for its program, you type: - - awk -f SOURCE-FILE INPUT-FILE1 INPUT-FILE2 ... - - The '-f' instructs the 'awk' utility to get the 'awk' program from -the file SOURCE-FILE (*note Options::). Any file name can be used for -SOURCE-FILE. For example, you could put the program: - - BEGIN { print "Don't Panic!" } - -into the file 'advice'. Then this command: - - awk -f advice - -does the same thing as this one: - - awk 'BEGIN { print "Don\47t Panic!" }' - -This was explained earlier (*note Read Terminal::). Note that you don't -usually need single quotes around the file name that you specify with -'-f', because most file names don't contain any of the shell's special -characters. Notice that in 'advice', the 'awk' program did not have -single quotes around it. The quotes are only needed for programs that -are provided on the 'awk' command line. (Also, placing the program in a -file allows us to use a literal single quote in the program text, -instead of the magic '\47'.) - - If you want to clearly identify an 'awk' program file as such, you -can add the extension '.awk' to the file name. This doesn't affect the -execution of the 'awk' program but it does make "housekeeping" easier. - - -File: gawk.info, Node: Executable Scripts, Next: Comments, Prev: Long, Up: Running gawk - -1.1.4 Executable 'awk' Programs -------------------------------- - -Once you have learned 'awk', you may want to write self-contained 'awk' -scripts, using the '#!' script mechanism. You can do this on many -systems.(1) For example, you could update the file 'advice' to look -like this: - - #! /bin/awk -f - - BEGIN { print "Don't Panic!" } - -After making this file executable (with the 'chmod' utility), simply -type 'advice' at the shell and the system arranges to run 'awk' as if -you had typed 'awk -f advice': - - $ chmod +x advice - $ advice - -| Don't Panic! - -(We assume you have the current directory in your shell's search path -variable [typically '$PATH']. If not, you may need to type './advice' -at the shell.) - - Self-contained 'awk' scripts are useful when you want to write a -program that users can invoke without their having to know that the -program is written in 'awk'. - - Understanding '#!' - - 'awk' is an "interpreted" language. This means that the 'awk' -utility reads your program and then processes your data according to the -instructions in your program. (This is different from a "compiled" -language such as C, where your program is first compiled into machine -code that is executed directly by your system's processor.) The 'awk' -utility is thus termed an "interpreter". Many modern languages are -interpreted. - - The line beginning with '#!' lists the full file name of an -interpreter to run and a single optional initial command-line argument -to pass to that interpreter. The operating system then runs the -interpreter with the given argument and the full argument list of the -executed program. The first argument in the list is the full file name -of the 'awk' program. The rest of the argument list contains either -options to 'awk', or data files, or both. (Note that on many systems -'awk' may be found in '/usr/bin' instead of in '/bin'.) - - Some systems limit the length of the interpreter name to 32 -characters. Often, this can be dealt with by using a symbolic link. - - You should not put more than one argument on the '#!' line after the -path to 'awk'. It does not work. The operating system treats the rest -of the line as a single argument and passes it to 'awk'. Doing this -leads to confusing behavior--most likely a usage diagnostic of some sort -from 'awk'. - - Finally, the value of 'ARGV[0]' (*note Built-in Variables::) varies -depending upon your operating system. Some systems put 'awk' there, -some put the full pathname of 'awk' (such as '/bin/awk'), and some put -the name of your script ('advice'). (d.c.) Don't rely on the value of -'ARGV[0]' to provide your script name. - - ---------- Footnotes ---------- - - (1) The '#!' mechanism works on GNU/Linux systems, BSD-based systems, -and commercial Unix systems. - - -File: gawk.info, Node: Comments, Next: Quoting, Prev: Executable Scripts, Up: Running gawk - -1.1.5 Comments in 'awk' Programs --------------------------------- - -A "comment" is some text that is included in a program for the sake of -human readers; it is not really an executable part of the program. -Comments can explain what the program does and how it works. Nearly all -programming languages have provisions for comments, as programs are -typically hard to understand without them. - - In the 'awk' language, a comment starts with the number sign -character ('#') and continues to the end of the line. The '#' does not -have to be the first character on the line. The 'awk' language ignores -the rest of a line following a number sign. For example, we could have -put the following into 'advice': - - # This program prints a nice, friendly message. It helps - # keep novice users from being afraid of the computer. - BEGIN { print "Don't Panic!" } - - You can put comment lines into keyboard-composed throwaway 'awk' -programs, but this usually isn't very useful; the purpose of a comment -is to help you or another person understand the program when reading it -at a later time. - - CAUTION: As mentioned in *note One-shot::, you can enclose short to - medium-sized programs in single quotes, in order to keep your shell - scripts self-contained. When doing so, _don't_ put an apostrophe - (i.e., a single quote) into a comment (or anywhere else in your - program). The shell interprets the quote as the closing quote for - the entire program. As a result, usually the shell prints a - message about mismatched quotes, and if 'awk' actually runs, it - will probably print strange messages about syntax errors. For - example, look at the following: - - $ awk 'BEGIN { print "hello" } # let's be cute' - > - - The shell sees that the first two quotes match, and that a new - quoted object begins at the end of the command line. It therefore - prompts with the secondary prompt, waiting for more input. With - Unix 'awk', closing the quoted string produces this result: - - $ awk '{ print "hello" } # let's be cute' - > ' - error-> awk: can't open file be - error-> source line number 1 - - Putting a backslash before the single quote in 'let's' wouldn't - help, because backslashes are not special inside single quotes. - The next node describes the shell's quoting rules. - - -File: gawk.info, Node: Quoting, Prev: Comments, Up: Running gawk - -1.1.6 Shell Quoting Issues --------------------------- - -* Menu: - -* DOS Quoting:: Quoting in Windows Batch Files. - -For short to medium-length 'awk' programs, it is most convenient to -enter the program on the 'awk' command line. This is best done by -enclosing the entire program in single quotes. This is true whether you -are entering the program interactively at the shell prompt, or writing -it as part of a larger shell script: - - awk 'PROGRAM TEXT' INPUT-FILE1 INPUT-FILE2 ... - - Once you are working with the shell, it is helpful to have a basic -knowledge of shell quoting rules. The following rules apply only to -POSIX-compliant, Bourne-style shells (such as Bash, the GNU Bourne-Again -Shell). If you use the C shell, you're on your own. - - Before diving into the rules, we introduce a concept that appears -throughout this Info file, which is that of the "null", or empty, -string. - - The null string is character data that has no value. In other words, -it is empty. It is written in 'awk' programs like this: '""'. In the -shell, it can be written using single or double quotes: '""' or ''''. -Although the null string has no characters in it, it does exist. For -example, consider this command: - - $ echo "" - -Here, the 'echo' utility receives a single argument, even though that -argument has no characters in it. In the rest of this Info file, we use -the terms "null string" and "empty string" interchangeably. Now, on to -the quoting rules: - - * Quoted items can be concatenated with nonquoted items as well as - with other quoted items. The shell turns everything into one - argument for the command. - - * Preceding any single character with a backslash ('\') quotes that - character. The shell removes the backslash and passes the quoted - character on to the command. - - * Single quotes protect everything between the opening and closing - quotes. The shell does no interpretation of the quoted text, - passing it on verbatim to the command. It is _impossible_ to embed - a single quote inside single-quoted text. Refer back to *note - Comments:: for an example of what happens if you try. - - * Double quotes protect most things between the opening and closing - quotes. The shell does at least variable and command substitution - on the quoted text. Different shells may do additional kinds of - processing on double-quoted text. - - Because certain characters within double-quoted text are processed - by the shell, they must be "escaped" within the text. Of note are - the characters '$', '`', '\', and '"', all of which must be - preceded by a backslash within double-quoted text if they are to be - passed on literally to the program. (The leading backslash is - stripped first.) Thus, the example seen in *note Read Terminal::: - - awk 'BEGIN { print "Don\47t Panic!" }' - - could instead be written this way: - - $ awk "BEGIN { print \"Don't Panic!\" }" - -| Don't Panic! - - Note that the single quote is not special within double quotes. - - * Null strings are removed when they occur as part of a non-null - command-line argument, while explicit null objects are kept. For - example, to specify that the field separator 'FS' should be set to - the null string, use: - - awk -F "" 'PROGRAM' FILES # correct - - Don't use this: - - awk -F"" 'PROGRAM' FILES # wrong! - - In the second case, 'awk' attempts to use the text of the program - as the value of 'FS', and the first file name as the text of the - program! This results in syntax errors at best, and confusing - behavior at worst. - - Mixing single and double quotes is difficult. You have to resort to -shell quoting tricks, like this: - - $ awk 'BEGIN { print "Here is a single quote <'"'"'>" }' - -| Here is a single quote <'> - -This program consists of three concatenated quoted strings. The first -and the third are single-quoted, and the second is double-quoted. - - This can be "simplified" to: - - $ awk 'BEGIN { print "Here is a single quote <'\''>" }' - -| Here is a single quote <'> - -Judge for yourself which of these two is the more readable. - - Another option is to use double quotes, escaping the embedded, -'awk'-level double quotes: - - $ awk "BEGIN { print \"Here is a single quote <'>\" }" - -| Here is a single quote <'> - -This option is also painful, because double quotes, backslashes, and -dollar signs are very common in more advanced 'awk' programs. - - A third option is to use the octal escape sequence equivalents (*note -Escape Sequences::) for the single- and double-quote characters, like -so: - - $ awk 'BEGIN { print "Here is a single quote <\47>" }' - -| Here is a single quote <'> - $ awk 'BEGIN { print "Here is a double quote <\42>" }' - -| Here is a double quote <"> - -This works nicely, but you should comment clearly what the escapes mean. - - A fourth option is to use command-line variable assignment, like -this: - - $ awk -v sq="'" 'BEGIN { print "Here is a single quote <" sq ">" }' - -| Here is a single quote <'> - - (Here, the two string constants and the value of 'sq' are -concatenated into a single string that is printed by 'print'.) - - If you really need both single and double quotes in your 'awk' -program, it is probably best to move it into a separate file, where the -shell won't be part of the picture and you can say what you mean. - - -File: gawk.info, Node: DOS Quoting, Up: Quoting - -1.1.6.1 Quoting in MS-Windows Batch Files -......................................... - -Although this Info file generally only worries about POSIX systems and -the POSIX shell, the following issue arises often enough for many users -that it is worth addressing. - - The "shells" on Microsoft Windows systems use the double-quote -character for quoting, and make it difficult or impossible to include an -escaped double-quote character in a command-line script. The following -example, courtesy of Jeroen Brink, shows how to print all lines in a -file surrounded by double quotes: - - gawk "{ print \"\042\" $0 \"\042\" }" FILE - - -File: gawk.info, Node: Sample Data Files, Next: Very Simple, Prev: Running gawk, Up: Getting Started - -1.2 Data files for the Examples -=============================== - -Many of the examples in this Info file take their input from two sample -data files. The first, 'mail-list', represents a list of peoples' names -together with their email addresses and information about those people. -The second data file, called 'inventory-shipped', contains information -about monthly shipments. In both files, each line is considered to be -one "record". - - In 'mail-list', each record contains the name of a person, his/her -phone number, his/her email address, and a code for his/her relationship -with the author of the list. The columns are aligned using spaces. An -'A' in the last column means that the person is an acquaintance. An 'F' -in the last column means that the person is a friend. An 'R' means that -the person is a relative: - - Amelia 555-5553 amelia.zodiacusque@gmail.com F - Anthony 555-3412 anthony.asserturo@hotmail.com A - Becky 555-7685 becky.algebrarum@gmail.com A - Bill 555-1675 bill.drowning@hotmail.com A - Broderick 555-0542 broderick.aliquotiens@yahoo.com R - Camilla 555-2912 camilla.infusarum@skynet.be R - Fabius 555-1234 fabius.undevicesimus@ucb.edu F - Julie 555-6699 julie.perscrutabor@skeeve.com F - Martin 555-6480 martin.codicibus@hotmail.com A - Samuel 555-3430 samuel.lanceolis@shu.edu A - Jean-Paul 555-2127 jeanpaul.campanorum@nyu.edu R - - The data file 'inventory-shipped' represents information about -shipments during the year. Each record contains the month, the number -of green crates shipped, the number of red boxes shipped, the number of -orange bags shipped, and the number of blue packages shipped, -respectively. There are 16 entries, covering the 12 months of last year -and the first four months of the current year. An empty line separates -the data for the two years: - - Jan 13 25 15 115 - Feb 15 32 24 226 - Mar 15 24 34 228 - Apr 31 52 63 420 - May 16 34 29 208 - Jun 31 42 75 492 - Jul 24 34 67 436 - Aug 15 34 47 316 - Sep 13 55 37 277 - Oct 29 54 68 525 - Nov 20 87 82 577 - Dec 17 35 61 401 - - Jan 21 36 64 620 - Feb 26 58 80 652 - Mar 24 75 70 495 - Apr 21 70 74 514 - - The sample files are included in the 'gawk' distribution, in the -directory 'awklib/eg/data'. - - -File: gawk.info, Node: Very Simple, Next: Two Rules, Prev: Sample Data Files, Up: Getting Started - -1.3 Some Simple Examples -======================== - -The following command runs a simple 'awk' program that searches the -input file 'mail-list' for the character string 'li' (a grouping of -characters is usually called a "string"; the term "string" is based on -similar usage in English, such as "a string of pearls" or "a string of -cars in a train"): - - awk '/li/ { print $0 }' mail-list - -When lines containing 'li' are found, they are printed because -'print $0' means print the current line. (Just 'print' by itself means -the same thing, so we could have written that instead.) - - You will notice that slashes ('/') surround the string 'li' in the -'awk' program. The slashes indicate that 'li' is the pattern to search -for. This type of pattern is called a "regular expression", which is -covered in more detail later (*note Regexp::). The pattern is allowed -to match parts of words. There are single quotes around the 'awk' -program so that the shell won't interpret any of it as special shell -characters. - - Here is what this program prints: - - $ awk '/li/ { print $0 }' mail-list - -| Amelia 555-5553 amelia.zodiacusque@gmail.com F - -| Broderick 555-0542 broderick.aliquotiens@yahoo.com R - -| Julie 555-6699 julie.perscrutabor@skeeve.com F - -| Samuel 555-3430 samuel.lanceolis@shu.edu A - - In an 'awk' rule, either the pattern or the action can be omitted, -but not both. If the pattern is omitted, then the action is performed -for _every_ input line. If the action is omitted, the default action is -to print all lines that match the pattern. - - Thus, we could leave out the action (the 'print' statement and the -braces) in the previous example and the result would be the same: 'awk' -prints all lines matching the pattern 'li'. By comparison, omitting the -'print' statement but retaining the braces makes an empty action that -does nothing (i.e., no lines are printed). - - Many practical 'awk' programs are just a line or two long. Following -is a collection of useful, short programs to get you started. Some of -these programs contain constructs that haven't been covered yet. (The -description of the program will give you a good idea of what is going -on, but you'll need to read the rest of the Info file to become an 'awk' -expert!) Most of the examples use a data file named 'data'. This is -just a placeholder; if you use these programs yourself, substitute your -own file names for 'data'. For future reference, note that there is -often more than one way to do things in 'awk'. At some point, you may -want to look back at these examples and see if you can come up with -different ways to do the same things shown here: - - * Print every line that is longer than 80 characters: - - awk 'length($0) > 80' data - - The sole rule has a relational expression as its pattern and has no - action--so it uses the default action, printing the record. - - * Print the length of the longest input line: - - awk '{ if (length($0) > max) max = length($0) } - END { print max }' data - - The code associated with 'END' executes after all input has been - read; it's the other side of the coin to 'BEGIN'. - - * Print the length of the longest line in 'data': - - expand data | awk '{ if (x < length($0)) x = length($0) } - END { print "maximum line length is " x }' - - This example differs slightly from the previous one: the input is - processed by the 'expand' utility to change TABs into spaces, so - the widths compared are actually the right-margin columns, as - opposed to the number of input characters on each line. - - * Print every line that has at least one field: - - awk 'NF > 0' data - - This is an easy way to delete blank lines from a file (or rather, - to create a new file similar to the old file but from which the - blank lines have been removed). - - * Print seven random numbers from 0 to 100, inclusive: - - awk 'BEGIN { for (i = 1; i <= 7; i++) - print int(101 * rand()) }' - - * Print the total number of bytes used by FILES: - - ls -l FILES | awk '{ x += $5 } - END { print "total bytes: " x }' - - * Print the total number of kilobytes used by FILES: - - ls -l FILES | awk '{ x += $5 } - END { print "total K-bytes:", x / 1024 }' - - * Print a sorted list of the login names of all users: - - awk -F: '{ print $1 }' /etc/passwd | sort - - * Count the lines in a file: - - awk 'END { print NR }' data - - * Print the even-numbered lines in the data file: - - awk 'NR % 2 == 0' data - - If you used the expression 'NR % 2 == 1' instead, the program would - print the odd-numbered lines. - - -File: gawk.info, Node: Two Rules, Next: More Complex, Prev: Very Simple, Up: Getting Started - -1.4 An Example with Two Rules -============================= - -The 'awk' utility reads the input files one line at a time. For each -line, 'awk' tries the patterns of each rule. If several patterns match, -then several actions execute in the order in which they appear in the -'awk' program. If no patterns match, then no actions run. - - After processing all the rules that match the line (and perhaps there -are none), 'awk' reads the next line. (However, *note Next Statement:: -and also *note Nextfile Statement::.) This continues until the program -reaches the end of the file. For example, the following 'awk' program -contains two rules: - - /12/ { print $0 } - /21/ { print $0 } - -The first rule has the string '12' as the pattern and 'print $0' as the -action. The second rule has the string '21' as the pattern and also has -'print $0' as the action. Each rule's action is enclosed in its own -pair of braces. - - This program prints every line that contains the string '12' _or_ the -string '21'. If a line contains both strings, it is printed twice, once -by each rule. - - This is what happens if we run this program on our two sample data -files, 'mail-list' and 'inventory-shipped': - - $ awk '/12/ { print $0 } - > /21/ { print $0 }' mail-list inventory-shipped - -| Anthony 555-3412 anthony.asserturo@hotmail.com A - -| Camilla 555-2912 camilla.infusarum@skynet.be R - -| Fabius 555-1234 fabius.undevicesimus@ucb.edu F - -| Jean-Paul 555-2127 jeanpaul.campanorum@nyu.edu R - -| Jean-Paul 555-2127 jeanpaul.campanorum@nyu.edu R - -| Jan 21 36 64 620 - -| Apr 21 70 74 514 - -Note how the line beginning with 'Jean-Paul' in 'mail-list' was printed -twice, once for each rule. - - -File: gawk.info, Node: More Complex, Next: Statements/Lines, Prev: Two Rules, Up: Getting Started - -1.5 A More Complex Example -========================== - -Now that we've mastered some simple tasks, let's look at what typical -'awk' programs do. This example shows how 'awk' can be used to -summarize, select, and rearrange the output of another utility. It uses -features that haven't been covered yet, so don't worry if you don't -understand all the details: - - ls -l | awk '$6 == "Nov" { sum += $5 } - END { print sum }' - - This command prints the total number of bytes in all the files in the -current directory that were last modified in November (of any year). -The 'ls -l' part of this example is a system command that gives you a -listing of the files in a directory, including each file's size and the -date the file was last modified. Its output looks like this: - - -rw-r--r-- 1 arnold user 1933 Nov 7 13:05 Makefile - -rw-r--r-- 1 arnold user 10809 Nov 7 13:03 awk.h - -rw-r--r-- 1 arnold user 983 Apr 13 12:14 awk.tab.h - -rw-r--r-- 1 arnold user 31869 Jun 15 12:20 awkgram.y - -rw-r--r-- 1 arnold user 22414 Nov 7 13:03 awk1.c - -rw-r--r-- 1 arnold user 37455 Nov 7 13:03 awk2.c - -rw-r--r-- 1 arnold user 27511 Dec 9 13:07 awk3.c - -rw-r--r-- 1 arnold user 7989 Nov 7 13:03 awk4.c - -The first field contains read-write permissions, the second field -contains the number of links to the file, and the third field identifies -the file's owner. The fourth field identifies the file's group. The -fifth field contains the file's size in bytes. The sixth, seventh, and -eighth fields contain the month, day, and time, respectively, that the -file was last modified. Finally, the ninth field contains the file -name. - - The '$6 == "Nov"' in our 'awk' program is an expression that tests -whether the sixth field of the output from 'ls -l' matches the string -'Nov'. Each time a line has the string 'Nov' for its sixth field, 'awk' -performs the action 'sum += $5'. This adds the fifth field (the file's -size) to the variable 'sum'. As a result, when 'awk' has finished -reading all the input lines, 'sum' is the total of the sizes of the -files whose lines matched the pattern. (This works because 'awk' -variables are automatically initialized to zero.) - - After the last line of output from 'ls' has been processed, the 'END' -rule executes and prints the value of 'sum'. In this example, the value -of 'sum' is 80600. - - These more advanced 'awk' techniques are covered in later minor nodes -(*note Action Overview::). Before you can move on to more advanced -'awk' programming, you have to know how 'awk' interprets your input and -displays your output. By manipulating fields and using 'print' -statements, you can produce some very useful and impressive-looking -reports. - - -File: gawk.info, Node: Statements/Lines, Next: Other Features, Prev: More Complex, Up: Getting Started - -1.6 'awk' Statements Versus Lines -================================= - -Most often, each line in an 'awk' program is a separate statement or -separate rule, like this: - - awk '/12/ { print $0 } - /21/ { print $0 }' mail-list inventory-shipped - - However, 'gawk' ignores newlines after any of the following symbols -and keywords: - - , { ? : || && do else - -A newline at any other point is considered the end of the statement.(1) - - If you would like to split a single statement into two lines at a -point where a newline would terminate it, you can "continue" it by -ending the first line with a backslash character ('\'). The backslash -must be the final character on the line in order to be recognized as a -continuation character. A backslash is allowed anywhere in the -statement, even in the middle of a string or regular expression. For -example: - - awk '/This regular expression is too long, so continue it\ - on the next line/ { print $1 }' - -We have generally not used backslash continuation in our sample -programs. 'gawk' places no limit on the length of a line, so backslash -continuation is never strictly necessary; it just makes programs more -readable. For this same reason, as well as for clarity, we have kept -most statements short in the programs presented throughout the Info -file. Backslash continuation is most useful when your 'awk' program is -in a separate source file instead of entered from the command line. You -should also note that many 'awk' implementations are more particular -about where you may use backslash continuation. For example, they may -not allow you to split a string constant using backslash continuation. -Thus, for maximum portability of your 'awk' programs, it is best not to -split your lines in the middle of a regular expression or a string. - - CAUTION: _Backslash continuation does not work as described with - the C shell._ It works for 'awk' programs in files and for - one-shot programs, _provided_ you are using a POSIX-compliant - shell, such as the Unix Bourne shell or Bash. But the C shell - behaves differently! There you must use two backslashes in a row, - followed by a newline. Note also that when using the C shell, - _every_ newline in your 'awk' program must be escaped with a - backslash. To illustrate: - - % awk 'BEGIN { \ - ? print \\ - ? "hello, world" \ - ? }' - -| hello, world - - Here, the '%' and '?' are the C shell's primary and secondary - prompts, analogous to the standard shell's '$' and '>'. - - Compare the previous example to how it is done with a - POSIX-compliant shell: - - $ awk 'BEGIN { - > print \ - > "hello, world" - > }' - -| hello, world - - 'awk' is a line-oriented language. Each rule's action has to begin -on the same line as the pattern. To have the pattern and action on -separate lines, you _must_ use backslash continuation; there is no other -option. - - Another thing to keep in mind is that backslash continuation and -comments do not mix. As soon as 'awk' sees the '#' that starts a -comment, it ignores _everything_ on the rest of the line. For example: - - $ gawk 'BEGIN { print "dont panic" # a friendly \ - > BEGIN rule - > }' - error-> gawk: cmd. line:2: BEGIN rule - error-> gawk: cmd. line:2: ^ syntax error - -In this case, it looks like the backslash would continue the comment -onto the next line. However, the backslash-newline combination is never -even noticed because it is "hidden" inside the comment. Thus, the -'BEGIN' is noted as a syntax error. - - When 'awk' statements within one rule are short, you might want to -put more than one of them on a line. This is accomplished by separating -the statements with a semicolon (';'). This also applies to the rules -themselves. Thus, the program shown at the start of this minor node -could also be written this way: - - /12/ { print $0 } ; /21/ { print $0 } - - NOTE: The requirement that states that rules on the same line must - be separated with a semicolon was not in the original 'awk' - language; it was added for consistency with the treatment of - statements within an action. - - ---------- Footnotes ---------- - - (1) The '?' and ':' referred to here is the three-operand conditional -expression described in *note Conditional Exp::. Splitting lines after -'?' and ':' is a minor 'gawk' extension; if '--posix' is specified -(*note Options::), then this extension is disabled. - - -File: gawk.info, Node: Other Features, Next: When, Prev: Statements/Lines, Up: Getting Started - -1.7 Other Features of 'awk' -=========================== - -The 'awk' language provides a number of predefined, or "built-in", -variables that your programs can use to get information from 'awk'. -There are other variables your program can set as well to control how -'awk' processes your data. - - In addition, 'awk' provides a number of built-in functions for doing -common computational and string-related operations. 'gawk' provides -built-in functions for working with timestamps, performing bit -manipulation, for runtime string translation (internationalization), -determining the type of a variable, and array sorting. - - As we develop our presentation of the 'awk' language, we will -introduce most of the variables and many of the functions. They are -described systematically in *note Built-in Variables:: and in *note -Built-in::. - - -File: gawk.info, Node: When, Next: Intro Summary, Prev: Other Features, Up: Getting Started - -1.8 When to Use 'awk' -===================== - -Now that you've seen some of what 'awk' can do, you might wonder how -'awk' could be useful for you. By using utility programs, advanced -patterns, field separators, arithmetic statements, and other selection -criteria, you can produce much more complex output. The 'awk' language -is very useful for producing reports from large amounts of raw data, -such as summarizing information from the output of other utility -programs like 'ls'. (*Note More Complex::.) - - Programs written with 'awk' are usually much smaller than they would -be in other languages. This makes 'awk' programs easy to compose and -use. Often, 'awk' programs can be quickly composed at your keyboard, -used once, and thrown away. Because 'awk' programs are interpreted, you -can avoid the (usually lengthy) compilation part of the typical -edit-compile-test-debug cycle of software development. - - Complex programs have been written in 'awk', including a complete -retargetable assembler for eight-bit microprocessors (*note Glossary::, -for more information), and a microcode assembler for a special-purpose -Prolog computer. The original 'awk''s capabilities were strained by -tasks of such complexity, but modern versions are more capable. - - If you find yourself writing 'awk' scripts of more than, say, a few -hundred lines, you might consider using a different programming -language. The shell is good at string and pattern matching; in -addition, it allows powerful use of the system utilities. Python offers -a nice balance between high-level ease of programming and access to -system facilities.(1) - - ---------- Footnotes ---------- - - (1) Other popular scripting languages include Ruby and Perl. - - -File: gawk.info, Node: Intro Summary, Prev: When, Up: Getting Started - -1.9 Summary -=========== - - * Programs in 'awk' consist of PATTERN-ACTION pairs. - - * An ACTION without a PATTERN always runs. The default ACTION for a - pattern without one is '{ print $0 }'. - - * Use either 'awk 'PROGRAM' FILES' or 'awk -f PROGRAM-FILE FILES' to - run 'awk'. - - * You may use the special '#!' header line to create 'awk' programs - that are directly executable. - - * Comments in 'awk' programs start with '#' and continue to the end - of the same line. - - * Be aware of quoting issues when writing 'awk' programs as part of a - larger shell script (or MS-Windows batch file). - - * You may use backslash continuation to continue a source line. - Lines are automatically continued after a comma, open brace, - question mark, colon, '||', '&&', 'do', and 'else'. - - -File: gawk.info, Node: Invoking Gawk, Next: Regexp, Prev: Getting Started, Up: Top - -2 Running 'awk' and 'gawk' -************************** - -This major node covers how to run 'awk', both POSIX-standard and -'gawk'-specific command-line options, and what 'awk' and 'gawk' do with -nonoption arguments. It then proceeds to cover how 'gawk' searches for -source files, reading standard input along with other files, 'gawk''s -environment variables, 'gawk''s exit status, using include files, and -obsolete and undocumented options and/or features. - - Many of the options and features described here are discussed in more -detail later in the Info file; feel free to skip over things in this -major node that don't interest you right now. - -* Menu: - -* Command Line:: How to run 'awk'. -* Options:: Command-line options and their meanings. -* Other Arguments:: Input file names and variable assignments. -* Naming Standard Input:: How to specify standard input with other - files. -* Environment Variables:: The environment variables 'gawk' uses. -* Exit Status:: 'gawk''s exit status. -* Include Files:: Including other files into your program. -* Loading Shared Libraries:: Loading shared libraries into your program. -* Obsolete:: Obsolete Options and/or features. -* Undocumented:: Undocumented Options and Features. -* Invoking Summary:: Invocation summary. - - -File: gawk.info, Node: Command Line, Next: Options, Up: Invoking Gawk - -2.1 Invoking 'awk' -================== - -There are two ways to run 'awk'--with an explicit program or with one or -more program files. Here are templates for both of them; items enclosed -in [...] in these templates are optional: - - 'awk' [OPTIONS] '-f' PROGFILE ['--'] FILE ... - 'awk' [OPTIONS] ['--'] ''PROGRAM'' FILE ... - - In addition to traditional one-letter POSIX-style options, 'gawk' -also supports GNU long options. - - It is possible to invoke 'awk' with an empty program: - - awk '' datafile1 datafile2 - -Doing so makes little sense, though; 'awk' exits silently when given an -empty program. (d.c.) If '--lint' has been specified on the command -line, 'gawk' issues a warning that the program is empty. - - -File: gawk.info, Node: Options, Next: Other Arguments, Prev: Command Line, Up: Invoking Gawk - -2.2 Command-Line Options -======================== - -Options begin with a dash and consist of a single character. GNU-style -long options consist of two dashes and a keyword. The keyword can be -abbreviated, as long as the abbreviation allows the option to be -uniquely identified. If the option takes an argument, either the -keyword is immediately followed by an equals sign ('=') and the -argument's value, or the keyword and the argument's value are separated -by whitespace. If a particular option with a value is given more than -once, it is the last value that counts. - - Each long option for 'gawk' has a corresponding POSIX-style short -option. The long and short options are interchangeable in all contexts. -The following list describes options mandated by the POSIX standard: - -'-F FS' -'--field-separator FS' - Set the 'FS' variable to FS (*note Field Separators::). - -'-f SOURCE-FILE' -'--file SOURCE-FILE' - Read the 'awk' program source from SOURCE-FILE instead of in the - first nonoption argument. This option may be given multiple times; - the 'awk' program consists of the concatenation of the contents of - each specified SOURCE-FILE. - -'-v VAR=VAL' -'--assign VAR=VAL' - Set the variable VAR to the value VAL _before_ execution of the - program begins. Such variable values are available inside the - 'BEGIN' rule (*note Other Arguments::). - - The '-v' option can only set one variable, but it can be used more - than once, setting another variable each time, like this: 'awk - -v foo=1 -v bar=2 ...'. - - CAUTION: Using '-v' to set the values of the built-in - variables may lead to surprising results. 'awk' will reset - the values of those variables as it needs to, possibly - ignoring any initial value you may have given. - -'-W GAWK-OPT' - Provide an implementation-specific option. This is the POSIX - convention for providing implementation-specific options. These - options also have corresponding GNU-style long options. Note that - the long options may be abbreviated, as long as the abbreviations - remain unique. The full list of 'gawk'-specific options is - provided next. - -'--' - Signal the end of the command-line options. The following - arguments are not treated as options even if they begin with '-'. - This interpretation of '--' follows the POSIX argument parsing - conventions. - - This is useful if you have file names that start with '-', or in - shell scripts, if you have file names that will be specified by the - user that could start with '-'. It is also useful for passing - options on to the 'awk' program; see *note Getopt Function::. - - The following list describes 'gawk'-specific options: - -'-b' -'--characters-as-bytes' - Cause 'gawk' to treat all input data as single-byte characters. In - addition, all output written with 'print' or 'printf' is treated as - single-byte characters. - - Normally, 'gawk' follows the POSIX standard and attempts to process - its input data according to the current locale (*note Locales::). - This can often involve converting multibyte characters into wide - characters (internally), and can lead to problems or confusion if - the input data does not contain valid multibyte characters. This - option is an easy way to tell 'gawk', "Hands off my data!" - -'-c' -'--traditional' - Specify "compatibility mode", in which the GNU extensions to the - 'awk' language are disabled, so that 'gawk' behaves just like BWK - 'awk'. *Note POSIX/GNU::, which summarizes the extensions. Also - see *note Compatibility Mode::. - -'-C' -'--copyright' - Print the short version of the General Public License and then - exit. - -'-d'[FILE] -'--dump-variables'['='FILE] - Print a sorted list of global variables, their types, and final - values to FILE. If no FILE is provided, print this list to a file - named 'awkvars.out' in the current directory. No space is allowed - between the '-d' and FILE, if FILE is supplied. - - Having a list of all global variables is a good way to look for - typographical errors in your programs. You would also use this - option if you have a large program with a lot of functions, and you - want to be sure that your functions don't inadvertently use global - variables that you meant to be local. (This is a particularly easy - mistake to make with simple variable names like 'i', 'j', etc.) - -'-D'[FILE] -'--debug'['='FILE] - Enable debugging of 'awk' programs (*note Debugging::). By - default, the debugger reads commands interactively from the - keyboard (standard input). The optional FILE argument allows you - to specify a file with a list of commands for the debugger to - execute noninteractively. No space is allowed between the '-D' and - FILE, if FILE is supplied. - -'-e' PROGRAM-TEXT -'--source' PROGRAM-TEXT - Provide program source code in the PROGRAM-TEXT. This option - allows you to mix source code in files with source code that you - enter on the command line. This is particularly useful when you - have library functions that you want to use from your command-line - programs (*note AWKPATH Variable::). - -'-E' FILE -'--exec' FILE - Similar to '-f', read 'awk' program text from FILE. There are two - differences from '-f': - - * This option terminates option processing; anything else on the - command line is passed on directly to the 'awk' program. - - * Command-line variable assignments of the form 'VAR=VALUE' are - disallowed. - - This option is particularly necessary for World Wide Web CGI - applications that pass arguments through the URL; using this option - prevents a malicious (or other) user from passing in options, - assignments, or 'awk' source code (via '-e') to the CGI - application.(1) This option should be used with '#!' scripts - (*note Executable Scripts::), like so: - - #! /usr/local/bin/gawk -E - - AWK PROGRAM HERE ... - -'-g' -'--gen-pot' - Analyze the source program and generate a GNU 'gettext' portable - object template file on standard output for all string constants - that have been marked for translation. *Note - Internationalization::, for information about this option. - -'-h' -'--help' - Print a "usage" message summarizing the short- and long-style - options that 'gawk' accepts and then exit. - -'-i' SOURCE-FILE -'--include' SOURCE-FILE - Read an 'awk' source library from SOURCE-FILE. This option is - completely equivalent to using the '@include' directive inside your - program. It is very similar to the '-f' option, but there are two - important differences. First, when '-i' is used, the program - source is not loaded if it has been previously loaded, whereas with - '-f', 'gawk' always loads the file. Second, because this option is - intended to be used with code libraries, 'gawk' does not recognize - such files as constituting main program input. Thus, after - processing an '-i' argument, 'gawk' still expects to find the main - source code via the '-f' option or on the command line. - -'-l' EXT -'--load' EXT - Load a dynamic extension named EXT. Extensions are stored as - system shared libraries. This option searches for the library - using the 'AWKLIBPATH' environment variable. The correct library - suffix for your platform will be supplied by default, so it need - not be specified in the extension name. The extension - initialization routine should be named 'dl_load()'. An alternative - is to use the '@load' keyword inside the program to load a shared - library. This advanced feature is described in detail in *note - Dynamic Extensions::. - -'-L'[VALUE] -'--lint'['='VALUE] - Warn about constructs that are dubious or nonportable to other - 'awk' implementations. No space is allowed between the '-L' and - VALUE, if VALUE is supplied. Some warnings are issued when 'gawk' - first reads your program. Others are issued at runtime, as your - program executes. With an optional argument of 'fatal', lint - warnings become fatal errors. This may be drastic, but its use - will certainly encourage the development of cleaner 'awk' programs. - With an optional argument of 'invalid', only warnings about things - that are actually invalid are issued. (This is not fully - implemented yet.) - - Some warnings are only printed once, even if the dubious constructs - they warn about occur multiple times in your 'awk' program. Thus, - when eliminating problems pointed out by '--lint', you should take - care to search for all occurrences of each inappropriate construct. - As 'awk' programs are usually short, doing so is not burdensome. - -'-M' -'--bignum' - Select arbitrary-precision arithmetic on numbers. This option has - no effect if 'gawk' is not compiled to use the GNU MPFR and MP - libraries (*note Arbitrary Precision Arithmetic::). - -'-n' -'--non-decimal-data' - Enable automatic interpretation of octal and hexadecimal values in - input data (*note Nondecimal Data::). - - CAUTION: This option can severely break old programs. Use - with care. Also note that this option may disappear in a - future version of 'gawk'. - -'-N' -'--use-lc-numeric' - Force the use of the locale's decimal point character when parsing - numeric input data (*note Locales::). - -'-o'[FILE] -'--pretty-print'['='FILE] - Enable pretty-printing of 'awk' programs. Implies '--no-optimize'. - By default, the output program is created in a file named - 'awkprof.out' (*note Profiling::). The optional FILE argument - allows you to specify a different file name for the output. No - space is allowed between the '-o' and FILE, if FILE is supplied. - - NOTE: In the past, this option would also execute your - program. This is no longer the case. - -'-O' -'--optimize' - Enable 'gawk''s default optimizations on the internal - representation of the program. At the moment, this includes simple - constant folding and tail recursion elimination in function calls. - - These optimizations are enabled by default. This option remains - primarily for backwards compatibility. However, it may be used to - cancel the effect of an earlier '-s' option (see later in this - list). - -'-p'[FILE] -'--profile'['='FILE] - Enable profiling of 'awk' programs (*note Profiling::). Implies - '--no-optimize'. By default, profiles are created in a file named - 'awkprof.out'. The optional FILE argument allows you to specify a - different file name for the profile file. No space is allowed - between the '-p' and FILE, if FILE is supplied. - - The profile contains execution counts for each statement in the - program in the left margin, and function call counts for each - function. - -'-P' -'--posix' - Operate in strict POSIX mode. This disables all 'gawk' extensions - (just like '--traditional') and disables all extensions not allowed - by POSIX. *Note Common Extensions:: for a summary of the extensions - in 'gawk' that are disabled by this option. Also, the following - additional restrictions apply: - - * Newlines are not allowed after '?' or ':' (*note Conditional - Exp::). - - * Specifying '-Ft' on the command line does not set the value of - 'FS' to be a single TAB character (*note Field Separators::). - - * The locale's decimal point character is used for parsing input - data (*note Locales::). - - If you supply both '--traditional' and '--posix' on the command - line, '--posix' takes precedence. 'gawk' issues a warning if both - options are supplied. - -'-r' -'--re-interval' - Allow interval expressions (*note Regexp Operators::) in regexps. - This is now 'gawk''s default behavior. Nevertheless, this option - remains (both for backward compatibility and for use in combination - with '--traditional'). - -'-s' -'--no-optimize' - Disable 'gawk''s default optimizations on the internal - representation of the program. - -'-S' -'--sandbox' - Disable the 'system()' function, input redirections with 'getline', - output redirections with 'print' and 'printf', and dynamic - extensions. This is particularly useful when you want to run 'awk' - scripts from questionable sources and need to make sure the scripts - can't access your system (other than the specified input data - file). - -'-t' -'--lint-old' - Warn about constructs that are not available in the original - version of 'awk' from Version 7 Unix (*note V7/SVR3.1::). - -'-V' -'--version' - Print version information for this particular copy of 'gawk'. This - allows you to determine if your copy of 'gawk' is up to date with - respect to whatever the Free Software Foundation is currently - distributing. It is also useful for bug reports (*note Bugs::). - - As long as program text has been supplied, any other options are -flagged as invalid with a warning message but are otherwise ignored. - - In compatibility mode, as a special case, if the value of FS supplied -to the '-F' option is 't', then 'FS' is set to the TAB character -('"\t"'). This is true only for '--traditional' and not for '--posix' -(*note Field Separators::). - - The '-f' option may be used more than once on the command line. If -it is, 'awk' reads its program source from all of the named files, as if -they had been concatenated together into one big file. This is useful -for creating libraries of 'awk' functions. These functions can be -written once and then retrieved from a standard place, instead of having -to be included in each individual program. The '-i' option is similar -in this regard. (As mentioned in *note Definition Syntax::, function -names must be unique.) - - With standard 'awk', library functions can still be used, even if the -program is entered at the keyboard, by specifying '-f /dev/tty'. After -typing your program, type 'Ctrl-d' (the end-of-file character) to -terminate it. (You may also use '-f -' to read program source from the -standard input, but then you will not be able to also use the standard -input as a source of data.) - - Because it is clumsy using the standard 'awk' mechanisms to mix -source file and command-line 'awk' programs, 'gawk' provides the '-e' -option. This does not require you to preempt the standard input for -your source code; it allows you to easily mix command-line and library -source code (*note AWKPATH Variable::). As with '-f', the '-e' and '-i' -options may also be used multiple times on the command line. - - If no '-f' or '-e' option is specified, then 'gawk' uses the first -nonoption command-line argument as the text of the program source code. - - If the environment variable 'POSIXLY_CORRECT' exists, then 'gawk' -behaves in strict POSIX mode, exactly as if you had supplied '--posix'. -Many GNU programs look for this environment variable to suppress -extensions that conflict with POSIX, but 'gawk' behaves differently: it -suppresses all extensions, even those that do not conflict with POSIX, -and behaves in strict POSIX mode. If '--lint' is supplied on the -command line and 'gawk' turns on POSIX mode because of -'POSIXLY_CORRECT', then it issues a warning message indicating that -POSIX mode is in effect. You would typically set this variable in your -shell's startup file. For a Bourne-compatible shell (such as Bash), you -would add these lines to the '.profile' file in your home directory: - - POSIXLY_CORRECT=true - export POSIXLY_CORRECT - - For a C shell-compatible shell,(2) you would add this line to the -'.login' file in your home directory: - - setenv POSIXLY_CORRECT true - - Having 'POSIXLY_CORRECT' set is not recommended for daily use, but it -is good for testing the portability of your programs to other -environments. - - ---------- Footnotes ---------- - - (1) For more detail, please see Section 4.4 of RFC 3875 -(http://www.ietf.org/rfc/rfc3875). Also see the explanatory note sent -to the 'gawk' bug mailing list -(http://lists.gnu.org/archive/html/bug-gawk/2014-11/msg00022.html). - - (2) Not recommended. - - -File: gawk.info, Node: Other Arguments, Next: Naming Standard Input, Prev: Options, Up: Invoking Gawk - -2.3 Other Command-Line Arguments -================================ - -Any additional arguments on the command line are normally treated as -input files to be processed in the order specified. However, an -argument that has the form 'VAR=VALUE', assigns the value VALUE to the -variable VAR--it does not specify a file at all. (See *note Assignment -Options::.) In the following example, COUNT=1 is a variable assignment, -not a file name: - - awk -f program.awk file1 count=1 file2 - - All the command-line arguments are made available to your 'awk' -program in the 'ARGV' array (*note Built-in Variables::). Command-line -options and the program text (if present) are omitted from 'ARGV'. All -other arguments, including variable assignments, are included. As each -element of 'ARGV' is processed, 'gawk' sets 'ARGIND' to the index in -'ARGV' of the current element. - - Changing 'ARGC' and 'ARGV' in your 'awk' program lets you control how -'awk' processes the input files; this is described in more detail in -*note ARGC and ARGV::. - - The distinction between file name arguments and variable-assignment -arguments is made when 'awk' is about to open the next input file. At -that point in execution, it checks the file name to see whether it is -really a variable assignment; if so, 'awk' sets the variable instead of -reading a file. - - Therefore, the variables actually receive the given values after all -previously specified files have been read. In particular, the values of -variables assigned in this fashion are _not_ available inside a 'BEGIN' -rule (*note BEGIN/END::), because such rules are run before 'awk' begins -scanning the argument list. - - The variable values given on the command line are processed for -escape sequences (*note Escape Sequences::). (d.c.) - - In some very early implementations of 'awk', when a variable -assignment occurred before any file names, the assignment would happen -_before_ the 'BEGIN' rule was executed. 'awk''s behavior was thus -inconsistent; some command-line assignments were available inside the -'BEGIN' rule, while others were not. Unfortunately, some applications -came to depend upon this "feature." When 'awk' was changed to be more -consistent, the '-v' option was added to accommodate applications that -depended upon the old behavior. - - The variable assignment feature is most useful for assigning to -variables such as 'RS', 'OFS', and 'ORS', which control input and output -formats, before scanning the data files. It is also useful for -controlling state if multiple passes are needed over a data file. For -example: - - awk 'pass == 1 { PASS 1 STUFF } - pass == 2 { PASS 2 STUFF }' pass=1 mydata pass=2 mydata - - Given the variable assignment feature, the '-F' option for setting -the value of 'FS' is not strictly necessary. It remains for historical -compatibility. - - -File: gawk.info, Node: Naming Standard Input, Next: Environment Variables, Prev: Other Arguments, Up: Invoking Gawk - -2.4 Naming Standard Input -========================= - -Often, you may wish to read standard input together with other files. -For example, you may wish to read one file, read standard input coming -from a pipe, and then read another file. - - The way to name the standard input, with all versions of 'awk', is to -use a single, standalone minus sign or dash, '-'. For example: - - SOME_COMMAND | awk -f myprog.awk file1 - file2 - -Here, 'awk' first reads 'file1', then it reads the output of -SOME_COMMAND, and finally it reads 'file2'. - - You may also use '"-"' to name standard input when reading files with -'getline' (*note Getline/File::). - - In addition, 'gawk' allows you to specify the special file name -'/dev/stdin', both on the command line and with 'getline'. Some other -versions of 'awk' also support this, but it is not standard. (Some -operating systems provide a '/dev/stdin' file in the filesystem; -however, 'gawk' always processes this file name itself.) - - -File: gawk.info, Node: Environment Variables, Next: Exit Status, Prev: Naming Standard Input, Up: Invoking Gawk - -2.5 The Environment Variables 'gawk' Uses -========================================= - -A number of environment variables influence how 'gawk' behaves. - -* Menu: - -* AWKPATH Variable:: Searching directories for 'awk' - programs. -* AWKLIBPATH Variable:: Searching directories for 'awk' shared - libraries. -* Other Environment Variables:: The environment variables. - - -File: gawk.info, Node: AWKPATH Variable, Next: AWKLIBPATH Variable, Up: Environment Variables - -2.5.1 The 'AWKPATH' Environment Variable ----------------------------------------- - -The previous minor node described how 'awk' program files can be named -on the command line with the '-f' option. In most 'awk' -implementations, you must supply a precise pathname for each program -file, unless the file is in the current directory. But with 'gawk', if -the file name supplied to the '-f' or '-i' options does not contain a -directory separator '/', then 'gawk' searches a list of directories -(called the "search path") one by one, looking for a file with the -specified name. - - The search path is a string consisting of directory names separated -by colons.(1) 'gawk' gets its search path from the 'AWKPATH' -environment variable. If that variable does not exist, or if it has an -empty value, 'gawk' uses a default path (described shortly). - - The search path feature is particularly helpful for building -libraries of useful 'awk' functions. The library files can be placed in -a standard directory in the default path and then specified on the -command line with a short file name. Otherwise, you would have to type -the full file name for each file. - - By using the '-i' or '-f' options, your command-line 'awk' programs -can use facilities in 'awk' library files (*note Library Functions::). -Path searching is not done if 'gawk' is in compatibility mode. This is -true for both '--traditional' and '--posix'. *Note Options::. - - If the source code file is not found after the initial search, the -path is searched again after adding the suffix '.awk' to the file name. - - 'gawk''s path search mechanism is similar to the shell's. (See 'The -Bourne-Again SHell manual' (http://www.gnu.org/software/bash/manual/).) -It treats a null entry in the path as indicating the current directory. -(A null entry is indicated by starting or ending the path with a colon -or by placing two colons next to each other ['::'].) - - NOTE: To include the current directory in the path, either place - '.' as an entry in the path or write a null entry in the path. - - Different past versions of 'gawk' would also look explicitly in the - current directory, either before or after the path search. As of - version 4.1.2, this no longer happens; if you wish to look in the - current directory, you must include '.' either as a separate entry - or as a null entry in the search path. - - The default value for 'AWKPATH' is '.:/usr/local/share/awk'.(2) -Since '.' is included at the beginning, 'gawk' searches first in the -current directory and then in '/usr/local/share/awk'. In practice, this -means that you will rarely need to change the value of 'AWKPATH'. - - *Note Shell Startup Files::, for information on functions that help -to manipulate the 'AWKPATH' variable. - - 'gawk' places the value of the search path that it used into -'ENVIRON["AWKPATH"]'. This provides access to the actual search path -value from within an 'awk' program. - - Although you can change 'ENVIRON["AWKPATH"]' within your 'awk' -program, this has no effect on the running program's behavior. This -makes sense: the 'AWKPATH' environment variable is used to find the -program source files. Once your program is running, all the files have -been found, and 'gawk' no longer needs to use 'AWKPATH'. - - ---------- Footnotes ---------- - - (1) Semicolons on MS-Windows. - - (2) Your version of 'gawk' may use a different directory; it will -depend upon how 'gawk' was built and installed. The actual directory is -the value of '$(datadir)' generated when 'gawk' was configured. You -probably don't need to worry about this, though. - - -File: gawk.info, Node: AWKLIBPATH Variable, Next: Other Environment Variables, Prev: AWKPATH Variable, Up: Environment Variables - -2.5.2 The 'AWKLIBPATH' Environment Variable -------------------------------------------- - -The 'AWKLIBPATH' environment variable is similar to the 'AWKPATH' -variable, but it is used to search for loadable extensions (stored as -system shared libraries) specified with the '-l' option rather than for -source files. If the extension is not found, the path is searched again -after adding the appropriate shared library suffix for the platform. -For example, on GNU/Linux systems, the suffix '.so' is used. The search -path specified is also used for extensions loaded via the '@load' -keyword (*note Loading Shared Libraries::). - - If 'AWKLIBPATH' does not exist in the environment, or if it has an -empty value, 'gawk' uses a default path; this is typically -'/usr/local/lib/gawk', although it can vary depending upon how 'gawk' -was built. - - *Note Shell Startup Files::, for information on functions that help -to manipulate the 'AWKLIBPATH' variable. - - 'gawk' places the value of the search path that it used into -'ENVIRON["AWKLIBPATH"]'. This provides access to the actual search path -value from within an 'awk' program. - - -File: gawk.info, Node: Other Environment Variables, Prev: AWKLIBPATH Variable, Up: Environment Variables - -2.5.3 Other Environment Variables ---------------------------------- - -A number of other environment variables affect 'gawk''s behavior, but -they are more specialized. Those in the following list are meant to be -used by regular users: - -'GAWK_MSEC_SLEEP' - Specifies the interval between connection retries, in milliseconds. - On systems that do not support the 'usleep()' system call, the - value is rounded up to an integral number of seconds. - -'GAWK_READ_TIMEOUT' - Specifies the time, in milliseconds, for 'gawk' to wait for input - before returning with an error. *Note Read Timeout::. - -'GAWK_SOCK_RETRIES' - Controls the number of times 'gawk' attempts to retry a two-way - TCP/IP (socket) connection before giving up. *Note TCP/IP - Networking::. Note that when nonfatal I/O is enabled (*note - Nonfatal::), 'gawk' only tries to open a TCP/IP socket once. - -'POSIXLY_CORRECT' - Causes 'gawk' to switch to POSIX-compatibility mode, disabling all - traditional and GNU extensions. *Note Options::. - - The environment variables in the following list are meant for use by -the 'gawk' developers for testing and tuning. They are subject to -change. The variables are: - -'AWKBUFSIZE' - This variable only affects 'gawk' on POSIX-compliant systems. With - a value of 'exact', 'gawk' uses the size of each input file as the - size of the memory buffer to allocate for I/O. Otherwise, the value - should be a number, and 'gawk' uses that number as the size of the - buffer to allocate. (When this variable is not set, 'gawk' uses - the smaller of the file's size and the "default" blocksize, which - is usually the filesystem's I/O blocksize.) - -'AWK_HASH' - If this variable exists with a value of 'gst', 'gawk' switches to - using the hash function from GNU Smalltalk for managing arrays. - This function may be marginally faster than the standard function. - -'AWKREADFUNC' - If this variable exists, 'gawk' switches to reading source files - one line at a time, instead of reading in blocks. This exists for - debugging problems on filesystems on non-POSIX operating systems - where I/O is performed in records, not in blocks. - -'GAWK_MSG_SRC' - If this variable exists, 'gawk' includes the file name and line - number within the 'gawk' source code from which warning and/or - fatal messages are generated. Its purpose is to help isolate the - source of a message, as there are multiple places that produce the - same warning or error message. - -'GAWK_LOCALE_DIR' - Specifies the location of compiled message object files for 'gawk' - itself. This is passed to the 'bindtextdomain()' function when - 'gawk' starts up. - -'GAWK_NO_DFA' - If this variable exists, 'gawk' does not use the DFA regexp matcher - for "does it match" kinds of tests. This can cause 'gawk' to be - slower. Its purpose is to help isolate differences between the two - regexp matchers that 'gawk' uses internally. (There aren't - supposed to be differences, but occasionally theory and practice - don't coordinate with each other.) - -'GAWK_STACKSIZE' - This specifies the amount by which 'gawk' should grow its internal - evaluation stack, when needed. - -'INT_CHAIN_MAX' - This specifies intended maximum number of items 'gawk' will - maintain on a hash chain for managing arrays indexed by integers. - -'STR_CHAIN_MAX' - This specifies intended maximum number of items 'gawk' will - maintain on a hash chain for managing arrays indexed by strings. - -'TIDYMEM' - If this variable exists, 'gawk' uses the 'mtrace()' library calls - from the GNU C library to help track down possible memory leaks. - - -File: gawk.info, Node: Exit Status, Next: Include Files, Prev: Environment Variables, Up: Invoking Gawk - -2.6 'gawk''s Exit Status -======================== - -If the 'exit' statement is used with a value (*note Exit Statement::), -then 'gawk' exits with the numeric value given to it. - - Otherwise, if there were no problems during execution, 'gawk' exits -with the value of the C constant 'EXIT_SUCCESS'. This is usually zero. - - If an error occurs, 'gawk' exits with the value of the C constant -'EXIT_FAILURE'. This is usually one. - - If 'gawk' exits because of a fatal error, the exit status is two. On -non-POSIX systems, this value may be mapped to 'EXIT_FAILURE'. - - -File: gawk.info, Node: Include Files, Next: Loading Shared Libraries, Prev: Exit Status, Up: Invoking Gawk - -2.7 Including Other Files into Your Program -=========================================== - -This minor node describes a feature that is specific to 'gawk'. - - The '@include' keyword can be used to read external 'awk' source -files. This gives you the ability to split large 'awk' source files -into smaller, more manageable pieces, and also lets you reuse common -'awk' code from various 'awk' scripts. In other words, you can group -together 'awk' functions used to carry out specific tasks into external -files. These files can be used just like function libraries, using the -'@include' keyword in conjunction with the 'AWKPATH' environment -variable. Note that source files may also be included using the '-i' -option. - - Let's see an example. We'll start with two (trivial) 'awk' scripts, -namely 'test1' and 'test2'. Here is the 'test1' script: - - BEGIN { - print "This is script test1." - } - -and here is 'test2': - - @include "test1" - BEGIN { - print "This is script test2." - } - - Running 'gawk' with 'test2' produces the following result: - - $ gawk -f test2 - -| This is script test1. - -| This is script test2. - - 'gawk' runs the 'test2' script, which includes 'test1' using the -'@include' keyword. So, to include external 'awk' source files, you -just use '@include' followed by the name of the file to be included, -enclosed in double quotes. - - NOTE: Keep in mind that this is a language construct and the file - name cannot be a string variable, but rather just a literal string - constant in double quotes. - - The files to be included may be nested; e.g., given a third script, -namely 'test3': - - @include "test2" - BEGIN { - print "This is script test3." - } - -Running 'gawk' with the 'test3' script produces the following results: - - $ gawk -f test3 - -| This is script test1. - -| This is script test2. - -| This is script test3. - - The file name can, of course, be a pathname. For example: - - @include "../io_funcs" - -and: - - @include "/usr/awklib/network" - -are both valid. The 'AWKPATH' environment variable can be of great -value when using '@include'. The same rules for the use of the -'AWKPATH' variable in command-line file searches (*note AWKPATH -Variable::) apply to '@include' also. - - This is very helpful in constructing 'gawk' function libraries. If -you have a large script with useful, general-purpose 'awk' functions, -you can break it down into library files and put those files in a -special directory. You can then include those "libraries," either by -using the full pathnames of the files, or by setting the 'AWKPATH' -environment variable accordingly and then using '@include' with just the -file part of the full pathname. Of course, you can keep library files -in more than one directory; the more complex the working environment is, -the more directories you may need to organize the files to be included. - - Given the ability to specify multiple '-f' options, the '@include' -mechanism is not strictly necessary. However, the '@include' keyword -can help you in constructing self-contained 'gawk' programs, thus -reducing the need for writing complex and tedious command lines. In -particular, '@include' is very useful for writing CGI scripts to be run -from web pages. - - As mentioned in *note AWKPATH Variable::, the current directory is -always searched first for source files, before searching in 'AWKPATH'; -this also applies to files named with '@include'. - - -File: gawk.info, Node: Loading Shared Libraries, Next: Obsolete, Prev: Include Files, Up: Invoking Gawk - -2.8 Loading Dynamic Extensions into Your Program -================================================ - -This minor node describes a feature that is specific to 'gawk'. - - The '@load' keyword can be used to read external 'awk' extensions -(stored as system shared libraries). This allows you to link in -compiled code that may offer superior performance and/or give you access -to extended capabilities not supported by the 'awk' language. The -'AWKLIBPATH' variable is used to search for the extension. Using -'@load' is completely equivalent to using the '-l' command-line option. - - If the extension is not initially found in 'AWKLIBPATH', another -search is conducted after appending the platform's default shared -library suffix to the file name. For example, on GNU/Linux systems, the -suffix '.so' is used: - - $ gawk '@load "ordchr"; BEGIN {print chr(65)}' - -| A - -This is equivalent to the following example: - - $ gawk -lordchr 'BEGIN {print chr(65)}' - -| A - -For command-line usage, the '-l' option is more convenient, but '@load' -is useful for embedding inside an 'awk' source file that requires access -to an extension. - - *note Dynamic Extensions::, describes how to write extensions (in C -or C++) that can be loaded with either '@load' or the '-l' option. It -also describes the 'ordchr' extension. - - -File: gawk.info, Node: Obsolete, Next: Undocumented, Prev: Loading Shared Libraries, Up: Invoking Gawk - -2.9 Obsolete Options and/or Features -==================================== - -This minor node describes features and/or command-line options from -previous releases of 'gawk' that either are not available in the current -version or are still supported but deprecated (meaning that they will -_not_ be in the next release). - - The process-related special files '/dev/pid', '/dev/ppid', -'/dev/pgrpid', and '/dev/user' were deprecated in 'gawk' 3.1, but still -worked. As of version 4.0, they are no longer interpreted specially by -'gawk'. (Use 'PROCINFO' instead; see *note Auto-set::.) - - -File: gawk.info, Node: Undocumented, Next: Invoking Summary, Prev: Obsolete, Up: Invoking Gawk - -2.10 Undocumented Options and Features -====================================== - - Use the Source, Luke! - -- _Obi-Wan_ - - This minor node intentionally left blank. - - -File: gawk.info, Node: Invoking Summary, Prev: Undocumented, Up: Invoking Gawk - -2.11 Summary -============ - - * Use either 'awk 'PROGRAM' FILES' or 'awk -f PROGRAM-FILE FILES' to - run 'awk'. - - * The three standard options for all versions of 'awk' are '-f', - '-F', and '-v'. 'gawk' supplies these and many others, as well as - corresponding GNU-style long options. - - * Nonoption command-line arguments are usually treated as file names, - unless they have the form 'VAR=VALUE', in which case they are taken - as variable assignments to be performed at that point in processing - the input. - - * All nonoption command-line arguments, excluding the program text, - are placed in the 'ARGV' array. Adjusting 'ARGC' and 'ARGV' - affects how 'awk' processes input. - - * You can use a single minus sign ('-') to refer to standard input on - the command line. 'gawk' also lets you use the special file name - '/dev/stdin'. - - * 'gawk' pays attention to a number of environment variables. - 'AWKPATH', 'AWKLIBPATH', and 'POSIXLY_CORRECT' are the most - important ones. - - * 'gawk''s exit status conveys information to the program that - invoked it. Use the 'exit' statement from within an 'awk' program - to set the exit status. - - * 'gawk' allows you to include other 'awk' source files into your - program using the '@include' statement and/or the '-i' and '-f' - command-line options. - - * 'gawk' allows you to load additional functions written in C or C++ - using the '@load' statement and/or the '-l' option. (This advanced - feature is described later, in *note Dynamic Extensions::.) - - -File: gawk.info, Node: Regexp, Next: Reading Files, Prev: Invoking Gawk, Up: Top - -3 Regular Expressions -********************* - -A "regular expression", or "regexp", is a way of describing a set of -strings. Because regular expressions are such a fundamental part of -'awk' programming, their format and use deserve a separate major node. - - A regular expression enclosed in slashes ('/') is an 'awk' pattern -that matches every input record whose text belongs to that set. The -simplest regular expression is a sequence of letters, numbers, or both. -Such a regexp matches any string that contains that sequence. Thus, the -regexp 'foo' matches any string containing 'foo'. Thus, the pattern -'/foo/' matches any input record containing the three adjacent -characters 'foo' _anywhere_ in the record. Other kinds of regexps let -you specify more complicated classes of strings. - -* Menu: - -* Regexp Usage:: How to Use Regular Expressions. -* Escape Sequences:: How to write nonprinting characters. -* Regexp Operators:: Regular Expression Operators. -* Bracket Expressions:: What can go between '[...]'. -* Leftmost Longest:: How much text matches. -* Computed Regexps:: Using Dynamic Regexps. -* GNU Regexp Operators:: Operators specific to GNU software. -* Case-sensitivity:: How to do case-insensitive matching. -* Strong Regexp Constants:: Strongly typed regexp constants. -* Regexp Summary:: Regular expressions summary. - - -File: gawk.info, Node: Regexp Usage, Next: Escape Sequences, Up: Regexp - -3.1 How to Use Regular Expressions -================================== - -A regular expression can be used as a pattern by enclosing it in -slashes. Then the regular expression is tested against the entire text -of each record. (Normally, it only needs to match some part of the text -in order to succeed.) For example, the following prints the second -field of each record where the string 'li' appears anywhere in the -record: - - $ awk '/li/ { print $2 }' mail-list - -| 555-5553 - -| 555-0542 - -| 555-6699 - -| 555-3430 - - Regular expressions can also be used in matching expressions. These -expressions allow you to specify the string to match against; it need -not be the entire current input record. The two operators '~' and '!~' -perform regular expression comparisons. Expressions using these -operators can be used as patterns, or in 'if', 'while', 'for', and 'do' -statements. (*Note Statements::.) For example, the following is true -if the expression EXP (taken as a string) matches REGEXP: - - EXP ~ /REGEXP/ - -This example matches, or selects, all input records with the uppercase -letter 'J' somewhere in the first field: - - $ awk '$1 ~ /J/' inventory-shipped - -| Jan 13 25 15 115 - -| Jun 31 42 75 492 - -| Jul 24 34 67 436 - -| Jan 21 36 64 620 - - So does this: - - awk '{ if ($1 ~ /J/) print }' inventory-shipped - - This next example is true if the expression EXP (taken as a character -string) does _not_ match REGEXP: - - EXP !~ /REGEXP/ - - The following example matches, or selects, all input records whose -first field _does not_ contain the uppercase letter 'J': - - $ awk '$1 !~ /J/' inventory-shipped - -| Feb 15 32 24 226 - -| Mar 15 24 34 228 - -| Apr 31 52 63 420 - -| May 16 34 29 208 - ... - - When a regexp is enclosed in slashes, such as '/foo/', we call it a -"regexp constant", much like '5.27' is a numeric constant and '"foo"' is -a string constant. - - -File: gawk.info, Node: Escape Sequences, Next: Regexp Operators, Prev: Regexp Usage, Up: Regexp - -3.2 Escape Sequences -==================== - -Some characters cannot be included literally in string constants -('"foo"') or regexp constants ('/foo/'). Instead, they should be -represented with "escape sequences", which are character sequences -beginning with a backslash ('\'). One use of an escape sequence is to -include a double-quote character in a string constant. Because a plain -double quote ends the string, you must use '\"' to represent an actual -double-quote character as a part of the string. For example: - - $ awk 'BEGIN { print "He said \"hi!\" to her." }' - -| He said "hi!" to her. - - The backslash character itself is another character that cannot be -included normally; you must write '\\' to put one backslash in the -string or regexp. Thus, the string whose contents are the two -characters '"' and '\' must be written '"\"\\"'. - - Other escape sequences represent unprintable characters such as TAB -or newline. There is nothing to stop you from entering most unprintable -characters directly in a string constant or regexp constant, but they -may look ugly. - - The following list presents all the escape sequences used in 'awk' -and what they represent. Unless noted otherwise, all these escape -sequences apply to both string constants and regexp constants: - -'\\' - A literal backslash, '\'. - -'\a' - The "alert" character, 'Ctrl-g', ASCII code 7 (BEL). (This often - makes some sort of audible noise.) - -'\b' - Backspace, 'Ctrl-h', ASCII code 8 (BS). - -'\f' - Formfeed, 'Ctrl-l', ASCII code 12 (FF). - -'\n' - Newline, 'Ctrl-j', ASCII code 10 (LF). - -'\r' - Carriage return, 'Ctrl-m', ASCII code 13 (CR). - -'\t' - Horizontal TAB, 'Ctrl-i', ASCII code 9 (HT). - -'\v' - Vertical TAB, 'Ctrl-k', ASCII code 11 (VT). - -'\NNN' - The octal value NNN, where NNN stands for 1 to 3 digits between '0' - and '7'. For example, the code for the ASCII ESC (escape) - character is '\033'. - -'\xHH...' - The hexadecimal value HH, where HH stands for a sequence of - hexadecimal digits ('0'-'9', and either 'A'-'F' or 'a'-'f'). A - maximum of two digts are allowed after the '\x'. Any further - hexadecimal digits are treated as simple letters or numbers. - (c.e.) (The '\x' escape sequence is not allowed in POSIX awk.) - - CAUTION: In ISO C, the escape sequence continues until the - first nonhexadecimal digit is seen. For many years, 'gawk' - would continue incorporating hexadecimal digits into the value - until a non-hexadecimal digit or the end of the string was - encountered. However, using more than two hexadecimal digits - produced undefined results. As of version 4.2, only two - digits are processed. - -'\/' - A literal slash (necessary for regexp constants only). This - sequence is used when you want to write a regexp constant that - contains a slash (such as '/.*:\/home\/[[:alnum:]]+:.*/'; the - '[[:alnum:]]' notation is discussed in *note Bracket - Expressions::). Because the regexp is delimited by slashes, you - need to escape any slash that is part of the pattern, in order to - tell 'awk' to keep processing the rest of the regexp. - -'\"' - A literal double quote (necessary for string constants only). This - sequence is used when you want to write a string constant that - contains a double quote (such as '"He said \"hi!\" to her."'). - Because the string is delimited by double quotes, you need to - escape any quote that is part of the string, in order to tell 'awk' - to keep processing the rest of the string. - - In 'gawk', a number of additional two-character sequences that begin -with a backslash have special meaning in regexps. *Note GNU Regexp -Operators::. - - In a regexp, a backslash before any character that is not in the -previous list and not listed in *note GNU Regexp Operators:: means that -the next character should be taken literally, even if it would normally -be a regexp operator. For example, '/a\+b/' matches the three -characters 'a+b'. - - For complete portability, do not use a backslash before any character -not shown in the previous list or that is not an operator. - - Backslash Before Regular Characters - - If you place a backslash in a string constant before something that -is not one of the characters previously listed, POSIX 'awk' purposely -leaves what happens as undefined. There are two choices: - -Strip the backslash out - This is what BWK 'awk' and 'gawk' both do. For example, '"a\qc"' - is the same as '"aqc"'. (Because this is such an easy bug both to - introduce and to miss, 'gawk' warns you about it.) Consider 'FS = - "[ \t]+\|[ \t]+"' to use vertical bars surrounded by whitespace as - the field separator. There should be two backslashes in the - string: 'FS = "[ \t]+\\|[ \t]+"'.) - -Leave the backslash alone - Some other 'awk' implementations do this. In such implementations, - typing '"a\qc"' is the same as typing '"a\\qc"'. - - To summarize: - - * The escape sequences in the preceding list are always processed - first, for both string constants and regexp constants. This - happens very early, as soon as 'awk' reads your program. - - * 'gawk' processes both regexp constants and dynamic regexps (*note - Computed Regexps::), for the special operators listed in *note GNU - Regexp Operators::. - - * A backslash before any other character means to treat that - character literally. - - Escape Sequences for Metacharacters - - Suppose you use an octal or hexadecimal escape to represent a regexp -metacharacter. (See *note Regexp Operators::.) Does 'awk' treat the -character as a literal character or as a regexp operator? - - Historically, such characters were taken literally. (d.c.) However, -the POSIX standard indicates that they should be treated as real -metacharacters, which is what 'gawk' does. In compatibility mode (*note -Options::), 'gawk' treats the characters represented by octal and -hexadecimal escape sequences literally when used in regexp constants. -Thus, '/a\52b/' is equivalent to '/a\*b/'. - - -File: gawk.info, Node: Regexp Operators, Next: Bracket Expressions, Prev: Escape Sequences, Up: Regexp - -3.3 Regular Expression Operators -================================ - -You can combine regular expressions with special characters, called -"regular expression operators" or "metacharacters", to increase the -power and versatility of regular expressions. - - The escape sequences described in *note Escape Sequences:: are valid -inside a regexp. They are introduced by a '\' and are recognized and -converted into corresponding real characters as the very first step in -processing regexps. - - Here is a list of metacharacters. All characters that are not escape -sequences and that are not listed here stand for themselves: - -'\' - This suppresses the special meaning of a character when matching. - For example, '\$' matches the character '$'. - -'^' - This matches the beginning of a string. '^@chapter' matches - '@chapter' at the beginning of a string, for example, and can be - used to identify chapter beginnings in Texinfo source files. The - '^' is known as an "anchor", because it anchors the pattern to - match only at the beginning of the string. - - It is important to realize that '^' does not match the beginning of - a line (the point right after a '\n' newline character) embedded in - a string. The condition is not true in the following example: - - if ("line1\nLINE 2" ~ /^L/) ... - -'$' - This is similar to '^', but it matches only at the end of a string. - For example, 'p$' matches a record that ends with a 'p'. The '$' - is an anchor and does not match the end of a line (the point right - before a '\n' newline character) embedded in a string. The - condition in the following example is not true: - - if ("line1\nLINE 2" ~ /1$/) ... - -'.' (period) - This matches any single character, _including_ the newline - character. For example, '.P' matches any single character followed - by a 'P' in a string. Using concatenation, we can make a regular - expression such as 'U.A', which matches any three-character - sequence that begins with 'U' and ends with 'A'. - - In strict POSIX mode (*note Options::), '.' does not match the NUL - character, which is a character with all bits equal to zero. - Otherwise, NUL is just another character. Other versions of 'awk' - may not be able to match the NUL character. - -'['...']' - This is called a "bracket expression".(1) It matches any _one_ of - the characters that are enclosed in the square brackets. For - example, '[MVX]' matches any one of the characters 'M', 'V', or 'X' - in a string. A full discussion of what can be inside the square - brackets of a bracket expression is given in *note Bracket - Expressions::. - -'[^'...']' - This is a "complemented bracket expression". The first character - after the '[' _must_ be a '^'. It matches any characters _except_ - those in the square brackets. For example, '[^awk]' matches any - character that is not an 'a', 'w', or 'k'. - -'|' - This is the "alternation operator" and it is used to specify - alternatives. The '|' has the lowest precedence of all the regular - expression operators. For example, '^P|[aeiouy]' matches any - string that matches either '^P' or '[aeiouy]'. This means it - matches any string that starts with 'P' or contains (anywhere - within it) a lowercase English vowel. - - The alternation applies to the largest possible regexps on either - side. - -'('...')' - Parentheses are used for grouping in regular expressions, as in - arithmetic. They can be used to concatenate regular expressions - containing the alternation operator, '|'. For example, - '@(samp|code)\{[^}]+\}' matches both '@code{foo}' and '@samp{bar}'. - (These are Texinfo formatting control sequences. The '+' is - explained further on in this list.) - -'*' - This symbol means that the preceding regular expression should be - repeated as many times as necessary to find a match. For example, - 'ph*' applies the '*' symbol to the preceding 'h' and looks for - matches of one 'p' followed by any number of 'h's. This also - matches just 'p' if no 'h's are present. - - There are two subtle points to understand about how '*' works. - First, the '*' applies only to the single preceding regular - expression component (e.g., in 'ph*', it applies just to the 'h'). - To cause '*' to apply to a larger subexpression, use parentheses: - '(ph)*' matches 'ph', 'phph', 'phphph', and so on. - - Second, '*' finds as many repetitions as possible. If the text to - be matched is 'phhhhhhhhhhhhhhooey', 'ph*' matches all of the 'h's. - -'+' - This symbol is similar to '*', except that the preceding expression - must be matched at least once. This means that 'wh+y' would match - 'why' and 'whhy', but not 'wy', whereas 'wh*y' would match all - three. - -'?' - This symbol is similar to '*', except that the preceding expression - can be matched either once or not at all. For example, 'fe?d' - matches 'fed' and 'fd', but nothing else. - -'{'N'}' -'{'N',}' -'{'N','M'}' - One or two numbers inside braces denote an "interval expression". - If there is one number in the braces, the preceding regexp is - repeated N times. If there are two numbers separated by a comma, - the preceding regexp is repeated N to M times. If there is one - number followed by a comma, then the preceding regexp is repeated - at least N times: - - 'wh{3}y' - Matches 'whhhy', but not 'why' or 'whhhhy'. - - 'wh{3,5}y' - Matches 'whhhy', 'whhhhy', or 'whhhhhy' only. - - 'wh{2,}y' - Matches 'whhy', 'whhhy', and so on. - - Interval expressions were not traditionally available in 'awk'. - They were added as part of the POSIX standard to make 'awk' and - 'egrep' consistent with each other. - - Initially, because old programs may use '{' and '}' in regexp - constants, 'gawk' did _not_ match interval expressions in regexps. - - However, beginning with version 4.0, 'gawk' does match interval - expressions by default. This is because compatibility with POSIX - has become more important to most 'gawk' users than compatibility - with old programs. - - For programs that use '{' and '}' in regexp constants, it is good - practice to always escape them with a backslash. Then the regexp - constants are valid and work the way you want them to, using any - version of 'awk'.(2) - - Finally, when '{' and '}' appear in regexp constants in a way that - cannot be interpreted as an interval expression (such as '/q{a}/'), - then they stand for themselves. - - In regular expressions, the '*', '+', and '?' operators, as well as -the braces '{' and '}', have the highest precedence, followed by -concatenation, and finally by '|'. As in arithmetic, parentheses can -change how operators are grouped. - - In POSIX 'awk' and 'gawk', the '*', '+', and '?' operators stand for -themselves when there is nothing in the regexp that precedes them. For -example, '/+/' matches a literal plus sign. However, many other -versions of 'awk' treat such a usage as a syntax error. - - If 'gawk' is in compatibility mode (*note Options::), interval -expressions are not available in regular expressions. - - ---------- Footnotes ---------- - - (1) In other literature, you may see a bracket expression referred to -as either a "character set", a "character class", or a "character list". - - (2) Use two backslashes if you're using a string constant with a -regexp operator or function. - - -File: gawk.info, Node: Bracket Expressions, Next: Leftmost Longest, Prev: Regexp Operators, Up: Regexp - -3.4 Using Bracket Expressions -============================= - -As mentioned earlier, a bracket expression matches any character among -those listed between the opening and closing square brackets. - - Within a bracket expression, a "range expression" consists of two -characters separated by a hyphen. It matches any single character that -sorts between the two characters, based upon the system's native -character set. For example, '[0-9]' is equivalent to '[0123456789]'. -(See *note Ranges and Locales:: for an explanation of how the POSIX -standard and 'gawk' have changed over time. This is mainly of -historical interest.) - - With the increasing popularity of the Unicode character standard -(http://www.unicode.org), there is an additional wrinkle to consider. -Octal and hexadecimal escape sequences inside bracket expressions are -taken to represent only single-byte characters (characters whose values -fit within the range 0-256). To match a range of characters where the -endpoints of the range are larger than 256, enter the multibyte -encodings of the characters directly. - - To include one of the characters '\', ']', '-', or '^' in a bracket -expression, put a '\' in front of it. For example: - - [d\]] - -matches either 'd' or ']'. Additionally, if you place ']' right after -the opening '[', the closing bracket is treated as one of the characters -to be matched. - - The treatment of '\' in bracket expressions is compatible with other -'awk' implementations and is also mandated by POSIX. The regular -expressions in 'awk' are a superset of the POSIX specification for -Extended Regular Expressions (EREs). POSIX EREs are based on the -regular expressions accepted by the traditional 'egrep' utility. - - "Character classes" are a feature introduced in the POSIX standard. -A character class is a special notation for describing lists of -characters that have a specific attribute, but the actual characters can -vary from country to country and/or from character set to character set. -For example, the notion of what is an alphabetic character differs -between the United States and France. - - A character class is only valid in a regexp _inside_ the brackets of -a bracket expression. Character classes consist of '[:', a keyword -denoting the class, and ':]'. *note Table 3.1: table-char-classes. -lists the character classes defined by the POSIX standard. - -Class Meaning --------------------------------------------------------------------------- -'[:alnum:]' Alphanumeric characters -'[:alpha:]' Alphabetic characters -'[:blank:]' Space and TAB characters -'[:cntrl:]' Control characters -'[:digit:]' Numeric characters -'[:graph:]' Characters that are both printable and visible (a space is - printable but not visible, whereas an 'a' is both) -'[:lower:]' Lowercase alphabetic characters -'[:print:]' Printable characters (characters that are not control - characters) -'[:punct:]' Punctuation characters (characters that are not letters, - digits, control characters, or space characters) -'[:space:]' Space characters (such as space, TAB, and formfeed, to name - a few) -'[:upper:]' Uppercase alphabetic characters -'[:xdigit:]'Characters that are hexadecimal digits - -Table 3.1: POSIX character classes - - For example, before the POSIX standard, you had to write -'/[A-Za-z0-9]/' to match alphanumeric characters. If your character set -had other alphabetic characters in it, this would not match them. With -the POSIX character classes, you can write '/[[:alnum:]]/' to match the -alphabetic and numeric characters in your character set. - - Some utilities that match regular expressions provide a nonstandard -'[:ascii:]' character class; 'awk' does not. However, you can simulate -such a construct using '[\x00-\x7F]'. This matches all values -numerically between zero and 127, which is the defined range of the -ASCII character set. Use a complemented character list ('[^\x00-\x7F]') -to match any single-byte characters that are not in the ASCII range. - - Two additional special sequences can appear in bracket expressions. -These apply to non-ASCII character sets, which can have single symbols -(called "collating elements") that are represented with more than one -character. They can also have several characters that are equivalent -for "collating", or sorting, purposes. (For example, in French, a plain -"e" and a grave-accented "e`" are equivalent.) These sequences are: - -Collating symbols - Multicharacter collating elements enclosed between '[.' and '.]'. - For example, if 'ch' is a collating element, then '[[.ch.]]' is a - regexp that matches this collating element, whereas '[ch]' is a - regexp that matches either 'c' or 'h'. - -Equivalence classes - Locale-specific names for a list of characters that are equal. The - name is enclosed between '[=' and '=]'. For example, the name 'e' - might be used to represent all of "e," "e^," "e`," and "e'." In - this case, '[[=e=]]' is a regexp that matches any of 'e', 'e^', - 'e'', or 'e`'. - - These features are very valuable in non-English-speaking locales. - - CAUTION: The library functions that 'gawk' uses for regular - expression matching currently recognize only POSIX character - classes; they do not recognize collating symbols or equivalence - classes. - - Inside a bracket expression, an opening bracket ('[') that does not -start a character class, collating element or equivalence class is taken -literally. This is also true of '.' and '*'. - - -File: gawk.info, Node: Leftmost Longest, Next: Computed Regexps, Prev: Bracket Expressions, Up: Regexp - -3.5 How Much Text Matches? -========================== - -Consider the following: - - echo aaaabcd | awk '{ sub(/a+/, "<A>"); print }' - - This example uses the 'sub()' function to make a change to the input -record. ('sub()' replaces the first instance of any text matched by the -first argument with the string provided as the second argument; *note -String Functions::.) Here, the regexp '/a+/' indicates "one or more 'a' -characters," and the replacement text is '<A>'. - - The input contains four 'a' characters. 'awk' (and POSIX) regular -expressions always match the leftmost, _longest_ sequence of input -characters that can match. Thus, all four 'a' characters are replaced -with '<A>' in this example: - - $ echo aaaabcd | awk '{ sub(/a+/, "<A>"); print }' - -| <A>bcd - - For simple match/no-match tests, this is not so important. But when -doing text matching and substitutions with the 'match()', 'sub()', -'gsub()', and 'gensub()' functions, it is very important. *Note String -Functions::, for more information on these functions. Understanding -this principle is also important for regexp-based record and field -splitting (*note Records::, and also *note Field Separators::). - - -File: gawk.info, Node: Computed Regexps, Next: GNU Regexp Operators, Prev: Leftmost Longest, Up: Regexp - -3.6 Using Dynamic Regexps -========================= - -The righthand side of a '~' or '!~' operator need not be a regexp -constant (i.e., a string of characters between slashes). It may be any -expression. The expression is evaluated and converted to a string if -necessary; the contents of the string are then used as the regexp. A -regexp computed in this way is called a "dynamic regexp" or a "computed -regexp": - - BEGIN { digits_regexp = "[[:digit:]]+" } - $0 ~ digits_regexp { print } - -This sets 'digits_regexp' to a regexp that describes one or more digits, -and tests whether the input record matches this regexp. - - NOTE: When using the '~' and '!~' operators, be aware that there is - a difference between a regexp constant enclosed in slashes and a - string constant enclosed in double quotes. If you are going to use - a string constant, you have to understand that the string is, in - essence, scanned _twice_: the first time when 'awk' reads your - program, and the second time when it goes to match the string on - the lefthand side of the operator with the pattern on the right. - This is true of any string-valued expression (such as - 'digits_regexp', shown in the previous example), not just string - constants. - - What difference does it make if the string is scanned twice? The -answer has to do with escape sequences, and particularly with -backslashes. To get a backslash into a regular expression inside a -string, you have to type two backslashes. - - For example, '/\*/' is a regexp constant for a literal '*'. Only one -backslash is needed. To do the same thing with a string, you have to -type '"\\*"'. The first backslash escapes the second one so that the -string actually contains the two characters '\' and '*'. - - Given that you can use both regexp and string constants to describe -regular expressions, which should you use? The answer is "regexp -constants," for several reasons: - - * String constants are more complicated to write and more difficult - to read. Using regexp constants makes your programs less - error-prone. Not understanding the difference between the two - kinds of constants is a common source of errors. - - * It is more efficient to use regexp constants. 'awk' can note that - you have supplied a regexp and store it internally in a form that - makes pattern matching more efficient. When using a string - constant, 'awk' must first convert the string into this internal - form and then perform the pattern matching. - - * Using regexp constants is better form; it shows clearly that you - intend a regexp match. - - Using '\n' in Bracket Expressions of Dynamic Regexps - - Some older versions of 'awk' do not allow the newline character to be -used inside a bracket expression for a dynamic regexp: - - $ awk '$0 ~ "[ \t\n]"' - error-> awk: newline in character class [ - error-> ]... - error-> source line number 1 - error-> context is - error-> $0 ~ "[ >>> \t\n]" <<< - - But a newline in a regexp constant works with no problem: - - $ awk '$0 ~ /[ \t\n]/' - here is a sample line - -| here is a sample line - Ctrl-d - - 'gawk' does not have this problem, and it isn't likely to occur often -in practice, but it's worth noting for future reference. - - -File: gawk.info, Node: GNU Regexp Operators, Next: Case-sensitivity, Prev: Computed Regexps, Up: Regexp - -3.7 'gawk'-Specific Regexp Operators -==================================== - -GNU software that deals with regular expressions provides a number of -additional regexp operators. These operators are described in this -minor node and are specific to 'gawk'; they are not available in other -'awk' implementations. Most of the additional operators deal with word -matching. For our purposes, a "word" is a sequence of one or more -letters, digits, or underscores ('_'): - -'\s' - Matches any whitespace character. Think of it as shorthand for - '[[:space:]]'. - -'\S' - Matches any character that is not whitespace. Think of it as - shorthand for '[^[:space:]]'. - -'\w' - Matches any word-constituent character--that is, it matches any - letter, digit, or underscore. Think of it as shorthand for - '[[:alnum:]_]'. - -'\W' - Matches any character that is not word-constituent. Think of it as - shorthand for '[^[:alnum:]_]'. - -'\<' - Matches the empty string at the beginning of a word. For example, - '/\<away/' matches 'away' but not 'stowaway'. - -'\>' - Matches the empty string at the end of a word. For example, - '/stow\>/' matches 'stow' but not 'stowaway'. - -'\y' - Matches the empty string at either the beginning or the end of a - word (i.e., the word boundar*y*). For example, '\yballs?\y' - matches either 'ball' or 'balls', as a separate word. - -'\B' - Matches the empty string that occurs between two word-constituent - characters. For example, '/\Brat\B/' matches 'crate', but it does - not match 'dirty rat'. '\B' is essentially the opposite of '\y'. - - There are two other operators that work on buffers. In Emacs, a -"buffer" is, naturally, an Emacs buffer. Other GNU programs, including -'gawk', consider the entire string to match as the buffer. The -operators are: - -'\`' - Matches the empty string at the beginning of a buffer (string) - -'\'' - Matches the empty string at the end of a buffer (string) - - Because '^' and '$' always work in terms of the beginning and end of -strings, these operators don't add any new capabilities for 'awk'. They -are provided for compatibility with other GNU software. - - In other GNU software, the word-boundary operator is '\b'. However, -that conflicts with the 'awk' language's definition of '\b' as -backspace, so 'gawk' uses a different letter. An alternative method -would have been to require two backslashes in the GNU operators, but -this was deemed too confusing. The current method of using '\y' for the -GNU '\b' appears to be the lesser of two evils. - - The various command-line options (*note Options::) control how 'gawk' -interprets characters in regexps: - -No options - In the default case, 'gawk' provides all the facilities of POSIX - regexps and the GNU regexp operators described in *note Regexp - Operators::. - -'--posix' - Match only POSIX regexps; the GNU operators are not special (e.g., - '\w' matches a literal 'w'). Interval expressions are allowed. - -'--traditional' - Match traditional Unix 'awk' regexps. The GNU operators are not - special, and interval expressions are not available. Because BWK - 'awk' supports them, the POSIX character classes ('[[:alnum:]]', - etc.) are available. Characters described by octal and - hexadecimal escape sequences are treated literally, even if they - represent regexp metacharacters. - -'--re-interval' - Allow interval expressions in regexps, if '--traditional' has been - provided. Otherwise, interval expressions are available by - default. - - -File: gawk.info, Node: Case-sensitivity, Next: Strong Regexp Constants, Prev: GNU Regexp Operators, Up: Regexp - -3.8 Case Sensitivity in Matching -================================ - -Case is normally significant in regular expressions, both when matching -ordinary characters (i.e., not metacharacters) and inside bracket -expressions. Thus, a 'w' in a regular expression matches only a -lowercase 'w' and not an uppercase 'W'. - - The simplest way to do a case-independent match is to use a bracket -expression--for example, '[Ww]'. However, this can be cumbersome if you -need to use it often, and it can make the regular expressions harder to -read. There are two alternatives that you might prefer. - - One way to perform a case-insensitive match at a particular point in -the program is to convert the data to a single case, using the -'tolower()' or 'toupper()' built-in string functions (which we haven't -discussed yet; *note String Functions::). For example: - - tolower($1) ~ /foo/ { ... } - -converts the first field to lowercase before matching against it. This -works in any POSIX-compliant 'awk'. - - Another method, specific to 'gawk', is to set the variable -'IGNORECASE' to a nonzero value (*note Built-in Variables::). When -'IGNORECASE' is not zero, _all_ regexp and string operations ignore -case. - - Changing the value of 'IGNORECASE' dynamically controls the case -sensitivity of the program as it runs. Case is significant by default -because 'IGNORECASE' (like most variables) is initialized to zero: - - x = "aB" - if (x ~ /ab/) ... # this test will fail - - IGNORECASE = 1 - if (x ~ /ab/) ... # now it will succeed - - In general, you cannot use 'IGNORECASE' to make certain rules case -insensitive and other rules case sensitive, as there is no -straightforward way to set 'IGNORECASE' just for the pattern of a -particular rule.(1) To do this, use either bracket expressions or -'tolower()'. However, one thing you can do with 'IGNORECASE' only is -dynamically turn case sensitivity on or off for all the rules at once. - - 'IGNORECASE' can be set on the command line or in a 'BEGIN' rule -(*note Other Arguments::; also *note Using BEGIN/END::). Setting -'IGNORECASE' from the command line is a way to make a program case -insensitive without having to edit it. - - In multibyte locales, the equivalences between upper- and lowercase -characters are tested based on the wide-character values of the locale's -character set. Otherwise, the characters are tested based on the -ISO-8859-1 (ISO Latin-1) character set. This character set is a -superset of the traditional 128 ASCII characters, which also provides a -number of characters suitable for use with European languages.(2) - - The value of 'IGNORECASE' has no effect if 'gawk' is in compatibility -mode (*note Options::). Case is always significant in compatibility -mode. - - ---------- Footnotes ---------- - - (1) Experienced C and C++ programmers will note that it is possible, -using something like 'IGNORECASE = 1 && /foObAr/ { ... }' and -'IGNORECASE = 0 || /foobar/ { ... }'. However, this is somewhat obscure -and we don't recommend it. - - (2) If you don't understand this, don't worry about it; it just means -that 'gawk' does the right thing. - - -File: gawk.info, Node: Strong Regexp Constants, Next: Regexp Summary, Prev: Case-sensitivity, Up: Regexp - -3.9 Strongly Typed Regexp Constants -=================================== - -This minor node describes a 'gawk'-specific feature. - - Regexp constants ('/.../') hold a strange position in the 'awk' -language. In most contexts, they act like an expression: '$0 ~ /.../'. -In other contexts, they denote only a regexp to be matched. In no case -are they really a "first class citizen" of the language. That is, you -cannot define a scalar variable whose type is "regexp" in the same sense -that you can define a variable to be a number or a string: - - num = 42 Numeric variable - str = "hi" String variable - re = /foo/ Wrong! re is the result of $0 ~ /foo/ - - -File: gawk.info, Node: Regexp Summary, Prev: Strong Regexp Constants, Up: Regexp - -3.10 Summary -============ - - * Regular expressions describe sets of strings to be matched. In - 'awk', regular expression constants are written enclosed between - slashes: '/'...'/'. - - * Regexp constants may be used standalone in patterns and in - conditional expressions, or as part of matching expressions using - the '~' and '!~' operators. - - * Escape sequences let you represent nonprintable characters and also - let you represent regexp metacharacters as literal characters to be - matched. - - * Regexp operators provide grouping, alternation, and repetition. - - * Bracket expressions give you a shorthand for specifying sets of - characters that can match at a particular point in a regexp. - Within bracket expressions, POSIX character classes let you specify - certain groups of characters in a locale-independent fashion. - - * Regular expressions match the leftmost longest text in the string - being matched. This matters for cases where you need to know the - extent of the match, such as for text substitution and when the - record separator is a regexp. - - * Matching expressions may use dynamic regexps (i.e., string values - treated as regular expressions). - - * 'gawk''s 'IGNORECASE' variable lets you control the case - sensitivity of regexp matching. In other 'awk' versions, use - 'tolower()' or 'toupper()'. - - -File: gawk.info, Node: Reading Files, Next: Printing, Prev: Regexp, Up: Top - -4 Reading Input Files -********************* - -In the typical 'awk' program, 'awk' reads all input either from the -standard input (by default, this is the keyboard, but often it is a pipe -from another command) or from files whose names you specify on the 'awk' -command line. If you specify input files, 'awk' reads them in order, -processing all the data from one before going on to the next. The name -of the current input file can be found in the predefined variable -'FILENAME' (*note Built-in Variables::). - - The input is read in units called "records", and is processed by the -rules of your program one record at a time. By default, each record is -one line. Each record is automatically split into chunks called -"fields". This makes it more convenient for programs to work on the -parts of a record. - - On rare occasions, you may need to use the 'getline' command. The -'getline' command is valuable both because it can do explicit input from -any number of files, and because the files used with it do not have to -be named on the 'awk' command line (*note Getline::). - -* Menu: - -* Records:: Controlling how data is split into records. -* Fields:: An introduction to fields. -* Nonconstant Fields:: Nonconstant Field Numbers. -* Changing Fields:: Changing the Contents of a Field. -* Field Separators:: The field separator and how to change it. -* Constant Size:: Reading constant width data. -* Splitting By Content:: Defining Fields By Content -* Multiple Line:: Reading multiline records. -* Getline:: Reading files under explicit program control - using the 'getline' function. -* Read Timeout:: Reading input with a timeout. -* Retrying Input:: Retrying input after certain errors. -* Command-line directories:: What happens if you put a directory on the - command line. -* Input Summary:: Input summary. -* Input Exercises:: Exercises. - - -File: gawk.info, Node: Records, Next: Fields, Up: Reading Files - -4.1 How Input Is Split into Records -=================================== - -'awk' divides the input for your program into records and fields. It -keeps track of the number of records that have been read so far from the -current input file. This value is stored in a predefined variable -called 'FNR', which is reset to zero every time a new file is started. -Another predefined variable, 'NR', records the total number of input -records read so far from all data files. It starts at zero, but is -never automatically reset to zero. - -* Menu: - -* awk split records:: How standard 'awk' splits records. -* gawk split records:: How 'gawk' splits records. - - -File: gawk.info, Node: awk split records, Next: gawk split records, Up: Records - -4.1.1 Record Splitting with Standard 'awk' ------------------------------------------- - -Records are separated by a character called the "record separator". By -default, the record separator is the newline character. This is why -records are, by default, single lines. To use a different character for -the record separator, simply assign that character to the predefined -variable 'RS'. - - Like any other variable, the value of 'RS' can be changed in the -'awk' program with the assignment operator, '=' (*note Assignment -Ops::). The new record-separator character should be enclosed in -quotation marks, which indicate a string constant. Often, the right -time to do this is at the beginning of execution, before any input is -processed, so that the very first record is read with the proper -separator. To do this, use the special 'BEGIN' pattern (*note -BEGIN/END::). For example: - - awk 'BEGIN { RS = "u" } - { print $0 }' mail-list - -changes the value of 'RS' to 'u', before reading any input. The new -value is a string whose first character is the letter "u"; as a result, -records are separated by the letter "u". Then the input file is read, -and the second rule in the 'awk' program (the action with no pattern) -prints each record. Because each 'print' statement adds a newline at -the end of its output, this 'awk' program copies the input with each 'u' -changed to a newline. Here are the results of running the program on -'mail-list': - - $ awk 'BEGIN { RS = "u" } - > { print $0 }' mail-list - -| Amelia 555-5553 amelia.zodiac - -| sq - -| e@gmail.com F - -| Anthony 555-3412 anthony.assert - -| ro@hotmail.com A - -| Becky 555-7685 becky.algebrar - -| m@gmail.com A - -| Bill 555-1675 bill.drowning@hotmail.com A - -| Broderick 555-0542 broderick.aliq - -| otiens@yahoo.com R - -| Camilla 555-2912 camilla.inf - -| sar - -| m@skynet.be R - -| Fabi - -| s 555-1234 fabi - -| s. - -| ndevicesim - -| s@ - -| cb.ed - -| F - -| J - -| lie 555-6699 j - -| lie.perscr - -| tabor@skeeve.com F - -| Martin 555-6480 martin.codicib - -| s@hotmail.com A - -| Sam - -| el 555-3430 sam - -| el.lanceolis@sh - -| .ed - -| A - -| Jean-Pa - -| l 555-2127 jeanpa - -| l.campanor - -| m@ny - -| .ed - -| R - -| - -Note that the entry for the name 'Bill' is not split. In the original -data file (*note Sample Data Files::), the line looks like this: - - Bill 555-1675 bill.drowning@hotmail.com A - -It contains no 'u', so there is no reason to split the record, unlike -the others, which each have one or more occurrences of the 'u'. In -fact, this record is treated as part of the previous record; the newline -separating them in the output is the original newline in the data file, -not the one added by 'awk' when it printed the record! - - Another way to change the record separator is on the command line, -using the variable-assignment feature (*note Other Arguments::): - - awk '{ print $0 }' RS="u" mail-list - -This sets 'RS' to 'u' before processing 'mail-list'. - - Using an alphabetic character such as 'u' for the record separator is -highly likely to produce strange results. Using an unusual character -such as '/' is more likely to produce correct behavior in the majority -of cases, but there are no guarantees. The moral is: Know Your Data. - - When using regular characters as the record separator, there is one -unusual case that occurs when 'gawk' is being fully POSIX-compliant -(*note Options::). Then, the following (extreme) pipeline prints a -surprising '1': - - $ echo | gawk --posix 'BEGIN { RS = "a" } ; { print NF }' - -| 1 - - There is one field, consisting of a newline. The value of the -built-in variable 'NF' is the number of fields in the current record. -(In the normal case, 'gawk' treats the newline as whitespace, printing -'0' as the result. Most other versions of 'awk' also act this way.) - - Reaching the end of an input file terminates the current input -record, even if the last character in the file is not the character in -'RS'. (d.c.) - - The empty string '""' (a string without any characters) has a special -meaning as the value of 'RS'. It means that records are separated by -one or more blank lines and nothing else. *Note Multiple Line:: for -more details. - - If you change the value of 'RS' in the middle of an 'awk' run, the -new value is used to delimit subsequent records, but the record -currently being processed, as well as records already processed, are not -affected. - - After the end of the record has been determined, 'gawk' sets the -variable 'RT' to the text in the input that matched 'RS'. - - -File: gawk.info, Node: gawk split records, Prev: awk split records, Up: Records - -4.1.2 Record Splitting with 'gawk' ----------------------------------- - -When using 'gawk', the value of 'RS' is not limited to a one-character -string. It can be any regular expression (*note Regexp::). (c.e.) In -general, each record ends at the next string that matches the regular -expression; the next record starts at the end of the matching string. -This general rule is actually at work in the usual case, where 'RS' -contains just a newline: a record ends at the beginning of the next -matching string (the next newline in the input), and the following -record starts just after the end of this string (at the first character -of the following line). The newline, because it matches 'RS', is not -part of either record. - - When 'RS' is a single character, 'RT' contains the same single -character. However, when 'RS' is a regular expression, 'RT' contains -the actual input text that matched the regular expression. - - If the input file ends without any text matching 'RS', 'gawk' sets -'RT' to the null string. - - The following example illustrates both of these features. It sets -'RS' equal to a regular expression that matches either a newline or a -series of one or more uppercase letters with optional leading and/or -trailing whitespace: - - $ echo record 1 AAAA record 2 BBBB record 3 | - > gawk 'BEGIN { RS = "\n|( *[[:upper:]]+ *)" } - > { print "Record =", $0,"and RT = [" RT "]" }' - -| Record = record 1 and RT = [ AAAA ] - -| Record = record 2 and RT = [ BBBB ] - -| Record = record 3 and RT = [ - -| ] - -The square brackets delineate the contents of 'RT', letting you see the -leading and trailing whitespace. The final value of 'RT' is a newline. -*Note Simple Sed:: for a more useful example of 'RS' as a regexp and -'RT'. - - If you set 'RS' to a regular expression that allows optional trailing -text, such as 'RS = "abc(XYZ)?"', it is possible, due to implementation -constraints, that 'gawk' may match the leading part of the regular -expression, but not the trailing part, particularly if the input text -that could match the trailing part is fairly long. 'gawk' attempts to -avoid this problem, but currently, there's no guarantee that this will -never happen. - - NOTE: Remember that in 'awk', the '^' and '$' anchor metacharacters - match the beginning and end of a _string_, and not the beginning - and end of a _line_. As a result, something like 'RS = - "^[[:upper:]]"' can only match at the beginning of a file. This is - because 'gawk' views the input file as one long string that happens - to contain newline characters. It is thus best to avoid anchor - metacharacters in the value of 'RS'. - - The use of 'RS' as a regular expression and the 'RT' variable are -'gawk' extensions; they are not available in compatibility mode (*note -Options::). In compatibility mode, only the first character of the -value of 'RS' determines the end of the record. - - 'RS = "\0"' Is Not Portable - - There are times when you might want to treat an entire data file as a -single record. The only way to make this happen is to give 'RS' a value -that you know doesn't occur in the input file. This is hard to do in a -general way, such that a program always works for arbitrary input files. - - You might think that for text files, the NUL character, which -consists of a character with all bits equal to zero, is a good value to -use for 'RS' in this case: - - BEGIN { RS = "\0" } # whole file becomes one record? - - 'gawk' in fact accepts this, and uses the NUL character for the -record separator. This works for certain special files, such as -'/proc/environ' on GNU/Linux systems, where the NUL character is in fact -the record separator. However, this usage is _not_ portable to most -other 'awk' implementations. - - Almost all other 'awk' implementations(1) store strings internally as -C-style strings. C strings use the NUL character as the string -terminator. In effect, this means that 'RS = "\0"' is the same as 'RS = -""'. (d.c.) - - It happens that recent versions of 'mawk' can use the NUL character -as a record separator. However, this is a special case: 'mawk' does not -allow embedded NUL characters in strings. (This may change in a future -version of 'mawk'.) - - *Note Readfile Function:: for an interesting way to read whole files. -If you are using 'gawk', see *note Extension Sample Readfile:: for -another option. - - ---------- Footnotes ---------- - - (1) At least that we know about. - - -File: gawk.info, Node: Fields, Next: Nonconstant Fields, Prev: Records, Up: Reading Files - -4.2 Examining Fields -==================== - -When 'awk' reads an input record, the record is automatically "parsed" -or separated by the 'awk' utility into chunks called "fields". By -default, fields are separated by "whitespace", like words in a line. -Whitespace in 'awk' means any string of one or more spaces, TABs, or -newlines; other characters that are considered whitespace by other -languages (such as formfeed, vertical tab, etc.) are _not_ considered -whitespace by 'awk'. - - The purpose of fields is to make it more convenient for you to refer -to these pieces of the record. You don't have to use them--you can -operate on the whole record if you want--but fields are what make simple -'awk' programs so powerful. - - You use a dollar sign ('$') to refer to a field in an 'awk' program, -followed by the number of the field you want. Thus, '$1' refers to the -first field, '$2' to the second, and so on. (Unlike in the Unix shells, -the field numbers are not limited to single digits. '$127' is the 127th -field in the record.) For example, suppose the following is a line of -input: - - This seems like a pretty nice example. - -Here the first field, or '$1', is 'This', the second field, or '$2', is -'seems', and so on. Note that the last field, '$7', is 'example.'. -Because there is no space between the 'e' and the '.', the period is -considered part of the seventh field. - - 'NF' is a predefined variable whose value is the number of fields in -the current record. 'awk' automatically updates the value of 'NF' each -time it reads a record. No matter how many fields there are, the last -field in a record can be represented by '$NF'. So, '$NF' is the same as -'$7', which is 'example.'. If you try to reference a field beyond the -last one (such as '$8' when the record has only seven fields), you get -the empty string. (If used in a numeric operation, you get zero.) - - The use of '$0', which looks like a reference to the "zeroth" field, -is a special case: it represents the whole input record. Use it when -you are not interested in specific fields. Here are some more examples: - - $ awk '$1 ~ /li/ { print $0 }' mail-list - -| Amelia 555-5553 amelia.zodiacusque@gmail.com F - -| Julie 555-6699 julie.perscrutabor@skeeve.com F - -This example prints each record in the file 'mail-list' whose first -field contains the string 'li'. - - By contrast, the following example looks for 'li' in _the entire -record_ and prints the first and last fields for each matching input -record: - - $ awk '/li/ { print $1, $NF }' mail-list - -| Amelia F - -| Broderick R - -| Julie F - -| Samuel A - - -File: gawk.info, Node: Nonconstant Fields, Next: Changing Fields, Prev: Fields, Up: Reading Files - -4.3 Nonconstant Field Numbers -============================= - -A field number need not be a constant. Any expression in the 'awk' -language can be used after a '$' to refer to a field. The value of the -expression specifies the field number. If the value is a string, rather -than a number, it is converted to a number. Consider this example: - - awk '{ print $NR }' - -Recall that 'NR' is the number of records read so far: one in the first -record, two in the second, and so on. So this example prints the first -field of the first record, the second field of the second record, and so -on. For the twentieth record, field number 20 is printed; most likely, -the record has fewer than 20 fields, so this prints a blank line. Here -is another example of using expressions as field numbers: - - awk '{ print $(2*2) }' mail-list - - 'awk' evaluates the expression '(2*2)' and uses its value as the -number of the field to print. The '*' represents multiplication, so the -expression '2*2' evaluates to four. The parentheses are used so that -the multiplication is done before the '$' operation; they are necessary -whenever there is a binary operator(1) in the field-number expression. -This example, then, prints the type of relationship (the fourth field) -for every line of the file 'mail-list'. (All of the 'awk' operators are -listed, in order of decreasing precedence, in *note Precedence::.) - - If the field number you compute is zero, you get the entire record. -Thus, '$(2-2)' has the same value as '$0'. Negative field numbers are -not allowed; trying to reference one usually terminates the program. -(The POSIX standard does not define what happens when you reference a -negative field number. 'gawk' notices this and terminates your program. -Other 'awk' implementations may behave differently.) - - As mentioned in *note Fields::, 'awk' stores the current record's -number of fields in the built-in variable 'NF' (also *note Built-in -Variables::). Thus, the expression '$NF' is not a special feature--it -is the direct consequence of evaluating 'NF' and using its value as a -field number. - - ---------- Footnotes ---------- - - (1) A "binary operator", such as '*' for multiplication, is one that -takes two operands. The distinction is required because 'awk' also has -unary (one-operand) and ternary (three-operand) operators. - - -File: gawk.info, Node: Changing Fields, Next: Field Separators, Prev: Nonconstant Fields, Up: Reading Files - -4.4 Changing the Contents of a Field -==================================== - -The contents of a field, as seen by 'awk', can be changed within an -'awk' program; this changes what 'awk' perceives as the current input -record. (The actual input is untouched; 'awk' _never_ modifies the -input file.) Consider the following example and its output: - - $ awk '{ nboxes = $3 ; $3 = $3 - 10 - > print nboxes, $3 }' inventory-shipped - -| 25 15 - -| 32 22 - -| 24 14 - ... - -The program first saves the original value of field three in the -variable 'nboxes'. The '-' sign represents subtraction, so this program -reassigns field three, '$3', as the original value of field three minus -ten: '$3 - 10'. (*Note Arithmetic Ops::.) Then it prints the original -and new values for field three. (Someone in the warehouse made a -consistent mistake while inventorying the red boxes.) - - For this to work, the text in '$3' must make sense as a number; the -string of characters must be converted to a number for the computer to -do arithmetic on it. The number resulting from the subtraction is -converted back to a string of characters that then becomes field three. -*Note Conversion::. - - When the value of a field is changed (as perceived by 'awk'), the -text of the input record is recalculated to contain the new field where -the old one was. In other words, '$0' changes to reflect the altered -field. Thus, this program prints a copy of the input file, with 10 -subtracted from the second field of each line: - - $ awk '{ $2 = $2 - 10; print $0 }' inventory-shipped - -| Jan 3 25 15 115 - -| Feb 5 32 24 226 - -| Mar 5 24 34 228 - ... - - It is also possible to assign contents to fields that are out of -range. For example: - - $ awk '{ $6 = ($5 + $4 + $3 + $2) - > print $6 }' inventory-shipped - -| 168 - -| 297 - -| 301 - ... - -We've just created '$6', whose value is the sum of fields '$2', '$3', -'$4', and '$5'. The '+' sign represents addition. For the file -'inventory-shipped', '$6' represents the total number of parcels shipped -for a particular month. - - Creating a new field changes 'awk''s internal copy of the current -input record, which is the value of '$0'. Thus, if you do 'print $0' -after adding a field, the record printed includes the new field, with -the appropriate number of field separators between it and the previously -existing fields. - - This recomputation affects and is affected by 'NF' (the number of -fields; *note Fields::). For example, the value of 'NF' is set to the -number of the highest field you create. The exact format of '$0' is -also affected by a feature that has not been discussed yet: the "output -field separator", 'OFS', used to separate the fields (*note Output -Separators::). - - Note, however, that merely _referencing_ an out-of-range field does -_not_ change the value of either '$0' or 'NF'. Referencing an -out-of-range field only produces an empty string. For example: - - if ($(NF+1) != "") - print "can't happen" - else - print "everything is normal" - -should print 'everything is normal', because 'NF+1' is certain to be out -of range. (*Note If Statement:: for more information about 'awk''s -'if-else' statements. *Note Typing and Comparison:: for more -information about the '!=' operator.) - - It is important to note that making an assignment to an existing -field changes the value of '$0' but does not change the value of 'NF', -even when you assign the empty string to a field. For example: - - $ echo a b c d | awk '{ OFS = ":"; $2 = "" - > print $0; print NF }' - -| a::c:d - -| 4 - -The field is still there; it just has an empty value, delimited by the -two colons between 'a' and 'c'. This example shows what happens if you -create a new field: - - $ echo a b c d | awk '{ OFS = ":"; $2 = ""; $6 = "new" - > print $0; print NF }' - -| a::c:d::new - -| 6 - -The intervening field, '$5', is created with an empty value (indicated -by the second pair of adjacent colons), and 'NF' is updated with the -value six. - - Decrementing 'NF' throws away the values of the fields after the new -value of 'NF' and recomputes '$0'. (d.c.) Here is an example: - - $ echo a b c d e f | awk '{ print "NF =", NF; - > NF = 3; print $0 }' - -| NF = 6 - -| a b c - - CAUTION: Some versions of 'awk' don't rebuild '$0' when 'NF' is - decremented. - - Finally, there are times when it is convenient to force 'awk' to -rebuild the entire record, using the current values of the fields and -'OFS'. To do this, use the seemingly innocuous assignment: - - $1 = $1 # force record to be reconstituted - print $0 # or whatever else with $0 - -This forces 'awk' to rebuild the record. It does help to add a comment, -as we've shown here. - - There is a flip side to the relationship between '$0' and the fields. -Any assignment to '$0' causes the record to be reparsed into fields -using the _current_ value of 'FS'. This also applies to any built-in -function that updates '$0', such as 'sub()' and 'gsub()' (*note String -Functions::). - - Understanding '$0' - - It is important to remember that '$0' is the _full_ record, exactly -as it was read from the input. This includes any leading or trailing -whitespace, and the exact whitespace (or other characters) that -separates the fields. - - It is a common error to try to change the field separators in a -record simply by setting 'FS' and 'OFS', and then expecting a plain -'print' or 'print $0' to print the modified record. - - But this does not work, because nothing was done to change the record -itself. Instead, you must force the record to be rebuilt, typically -with a statement such as '$1 = $1', as described earlier. - - -File: gawk.info, Node: Field Separators, Next: Constant Size, Prev: Changing Fields, Up: Reading Files - -4.5 Specifying How Fields Are Separated -======================================= - -* Menu: - -* Default Field Splitting:: How fields are normally separated. -* Regexp Field Splitting:: Using regexps as the field separator. -* Single Character Fields:: Making each character a separate field. -* Command Line Field Separator:: Setting 'FS' from the command line. -* Full Line Fields:: Making the full line be a single field. -* Field Splitting Summary:: Some final points and a summary table. - -The "field separator", which is either a single character or a regular -expression, controls the way 'awk' splits an input record into fields. -'awk' scans the input record for character sequences that match the -separator; the fields themselves are the text between the matches. - - In the examples that follow, we use the bullet symbol (*) to -represent spaces in the output. If the field separator is 'oo', then -the following line: - - moo goo gai pan - -is split into three fields: 'm', '*g', and '*gai*pan'. Note the leading -spaces in the values of the second and third fields. - - The field separator is represented by the predefined variable 'FS'. -Shell programmers take note: 'awk' does _not_ use the name 'IFS' that is -used by the POSIX-compliant shells (such as the Unix Bourne shell, 'sh', -or Bash). - - The value of 'FS' can be changed in the 'awk' program with the -assignment operator, '=' (*note Assignment Ops::). Often, the right -time to do this is at the beginning of execution before any input has -been processed, so that the very first record is read with the proper -separator. To do this, use the special 'BEGIN' pattern (*note -BEGIN/END::). For example, here we set the value of 'FS' to the string -'","': - - awk 'BEGIN { FS = "," } ; { print $2 }' - -Given the input line: - - John Q. Smith, 29 Oak St., Walamazoo, MI 42139 - -this 'awk' program extracts and prints the string '*29*Oak*St.'. - - Sometimes the input data contains separator characters that don't -separate fields the way you thought they would. For instance, the -person's name in the example we just used might have a title or suffix -attached, such as: - - John Q. Smith, LXIX, 29 Oak St., Walamazoo, MI 42139 - -The same program would extract '*LXIX' instead of '*29*Oak*St.'. If you -were expecting the program to print the address, you would be surprised. -The moral is to choose your data layout and separator characters -carefully to prevent such problems. (If the data is not in a form that -is easy to process, perhaps you can massage it first with a separate -'awk' program.) - - -File: gawk.info, Node: Default Field Splitting, Next: Regexp Field Splitting, Up: Field Separators - -4.5.1 Whitespace Normally Separates Fields ------------------------------------------- - -Fields are normally separated by whitespace sequences (spaces, TABs, and -newlines), not by single spaces. Two spaces in a row do not delimit an -empty field. The default value of the field separator 'FS' is a string -containing a single space, '" "'. If 'awk' interpreted this value in -the usual way, each space character would separate fields, so two spaces -in a row would make an empty field between them. The reason this does -not happen is that a single space as the value of 'FS' is a special -case--it is taken to specify the default manner of delimiting fields. - - If 'FS' is any other single character, such as '","', then each -occurrence of that character separates two fields. Two consecutive -occurrences delimit an empty field. If the character occurs at the -beginning or the end of the line, that too delimits an empty field. The -space character is the only single character that does not follow these -rules. - - -File: gawk.info, Node: Regexp Field Splitting, Next: Single Character Fields, Prev: Default Field Splitting, Up: Field Separators - -4.5.2 Using Regular Expressions to Separate Fields --------------------------------------------------- - -The previous node discussed the use of single characters or simple -strings as the value of 'FS'. More generally, the value of 'FS' may be -a string containing any regular expression. In this case, each match in -the record for the regular expression separates fields. For example, -the assignment: - - FS = ", \t" - -makes every area of an input line that consists of a comma followed by a -space and a TAB into a field separator. ('\t' is an "escape sequence" -that stands for a TAB; *note Escape Sequences::, for the complete list -of similar escape sequences.) - - For a less trivial example of a regular expression, try using single -spaces to separate fields the way single commas are used. 'FS' can be -set to '"[ ]"' (left bracket, space, right bracket). This regular -expression matches a single space and nothing else (*note Regexp::). - - There is an important difference between the two cases of 'FS = " "' -(a single space) and 'FS = "[ \t\n]+"' (a regular expression matching -one or more spaces, TABs, or newlines). For both values of 'FS', fields -are separated by "runs" (multiple adjacent occurrences) of spaces, TABs, -and/or newlines. However, when the value of 'FS' is '" "', 'awk' first -strips leading and trailing whitespace from the record and then decides -where the fields are. For example, the following pipeline prints 'b': - - $ echo ' a b c d ' | awk '{ print $2 }' - -| b - -However, this pipeline prints 'a' (note the extra spaces around each -letter): - - $ echo ' a b c d ' | awk 'BEGIN { FS = "[ \t\n]+" } - > { print $2 }' - -| a - -In this case, the first field is null, or empty. - - The stripping of leading and trailing whitespace also comes into play -whenever '$0' is recomputed. For instance, study this pipeline: - - $ echo ' a b c d' | awk '{ print; $2 = $2; print }' - -| a b c d - -| a b c d - -The first 'print' statement prints the record as it was read, with -leading whitespace intact. The assignment to '$2' rebuilds '$0' by -concatenating '$1' through '$NF' together, separated by the value of -'OFS' (which is a space by default). Because the leading whitespace was -ignored when finding '$1', it is not part of the new '$0'. Finally, the -last 'print' statement prints the new '$0'. - - There is an additional subtlety to be aware of when using regular -expressions for field splitting. It is not well specified in the POSIX -standard, or anywhere else, what '^' means when splitting fields. Does -the '^' match only at the beginning of the entire record? Or is each -field separator a new string? It turns out that different 'awk' -versions answer this question differently, and you should not rely on -any specific behavior in your programs. (d.c.) - - As a point of information, BWK 'awk' allows '^' to match only at the -beginning of the record. 'gawk' also works this way. For example: - - $ echo 'xxAA xxBxx C' | - > gawk -F '(^x+)|( +)' '{ for (i = 1; i <= NF; i++) - > printf "-->%s<--\n", $i }' - -| --><-- - -| -->AA<-- - -| -->xxBxx<-- - -| -->C<-- - - -File: gawk.info, Node: Single Character Fields, Next: Command Line Field Separator, Prev: Regexp Field Splitting, Up: Field Separators - -4.5.3 Making Each Character a Separate Field --------------------------------------------- - -There are times when you may want to examine each character of a record -separately. This can be done in 'gawk' by simply assigning the null -string ('""') to 'FS'. (c.e.) In this case, each individual character -in the record becomes a separate field. For example: - - $ echo a b | gawk 'BEGIN { FS = "" } - > { - > for (i = 1; i <= NF; i = i + 1) - > print "Field", i, "is", $i - > }' - -| Field 1 is a - -| Field 2 is - -| Field 3 is b - - Traditionally, the behavior of 'FS' equal to '""' was not defined. -In this case, most versions of Unix 'awk' simply treat the entire record -as only having one field. (d.c.) In compatibility mode (*note -Options::), if 'FS' is the null string, then 'gawk' also behaves this -way. - - -File: gawk.info, Node: Command Line Field Separator, Next: Full Line Fields, Prev: Single Character Fields, Up: Field Separators - -4.5.4 Setting 'FS' from the Command Line ----------------------------------------- - -'FS' can be set on the command line. Use the '-F' option to do so. For -example: - - awk -F, 'PROGRAM' INPUT-FILES - -sets 'FS' to the ',' character. Notice that the option uses an -uppercase 'F' instead of a lowercase 'f'. The latter option ('-f') -specifies a file containing an 'awk' program. - - The value used for the argument to '-F' is processed in exactly the -same way as assignments to the predefined variable 'FS'. Any special -characters in the field separator must be escaped appropriately. For -example, to use a '\' as the field separator on the command line, you -would have to type: - - # same as FS = "\\" - awk -F\\\\ '...' files ... - -Because '\' is used for quoting in the shell, 'awk' sees '-F\\'. Then -'awk' processes the '\\' for escape characters (*note Escape -Sequences::), finally yielding a single '\' to use for the field -separator. - - As a special case, in compatibility mode (*note Options::), if the -argument to '-F' is 't', then 'FS' is set to the TAB character. If you -type '-F\t' at the shell, without any quotes, the '\' gets deleted, so -'awk' figures that you really want your fields to be separated with TABs -and not 't's. Use '-v FS="t"' or '-F"[t]"' on the command line if you -really do want to separate your fields with 't's. Use '-F '\t'' when -not in compatibility mode to specify that TABs separate fields. - - As an example, let's use an 'awk' program file called 'edu.awk' that -contains the pattern '/edu/' and the action 'print $1': - - /edu/ { print $1 } - - Let's also set 'FS' to be the '-' character and run the program on -the file 'mail-list'. The following command prints a list of the names -of the people that work at or attend a university, and the first three -digits of their phone numbers: - - $ awk -F- -f edu.awk mail-list - -| Fabius 555 - -| Samuel 555 - -| Jean - -Note the third line of output. The third line in the original file -looked like this: - - Jean-Paul 555-2127 jeanpaul.campanorum@nyu.edu R - - The '-' as part of the person's name was used as the field separator, -instead of the '-' in the phone number that was originally intended. -This demonstrates why you have to be careful in choosing your field and -record separators. - - Perhaps the most common use of a single character as the field -separator occurs when processing the Unix system password file. On many -Unix systems, each user has a separate entry in the system password -file, with one line per user. The information in these lines is -separated by colons. The first field is the user's login name and the -second is the user's encrypted or shadow password. (A shadow password -is indicated by the presence of a single 'x' in the second field.) A -password file entry might look like this: - - arnold:x:2076:10:Arnold Robbins:/home/arnold:/bin/bash - - The following program searches the system password file and prints -the entries for users whose full name is not indicated: - - awk -F: '$5 == ""' /etc/passwd - - -File: gawk.info, Node: Full Line Fields, Next: Field Splitting Summary, Prev: Command Line Field Separator, Up: Field Separators - -4.5.5 Making the Full Line Be a Single Field --------------------------------------------- - -Occasionally, it's useful to treat the whole input line as a single -field. This can be done easily and portably simply by setting 'FS' to -'"\n"' (a newline):(1) - - awk -F'\n' 'PROGRAM' FILES ... - -When you do this, '$1' is the same as '$0'. - - Changing 'FS' Does Not Affect the Fields - - According to the POSIX standard, 'awk' is supposed to behave as if -each record is split into fields at the time it is read. In particular, -this means that if you change the value of 'FS' after a record is read, -the values of the fields (i.e., how they were split) should reflect the -old value of 'FS', not the new one. - - However, many older implementations of 'awk' do not work this way. -Instead, they defer splitting the fields until a field is actually -referenced. The fields are split using the _current_ value of 'FS'! -(d.c.) This behavior can be difficult to diagnose. The following -example illustrates the difference between the two methods: - - sed 1q /etc/passwd | awk '{ FS = ":" ; print $1 }' - -which usually prints: - - root - -on an incorrect implementation of 'awk', while 'gawk' prints the full -first line of the file, something like: - - root:x:0:0:Root:/: - - (The 'sed'(2) command prints just the first line of '/etc/passwd'.) - - ---------- Footnotes ---------- - - (1) Thanks to Andrew Schorr for this tip. - - (2) The 'sed' utility is a "stream editor." Its behavior is also -defined by the POSIX standard. - - -File: gawk.info, Node: Field Splitting Summary, Prev: Full Line Fields, Up: Field Separators - -4.5.6 Field-Splitting Summary ------------------------------ - -It is important to remember that when you assign a string constant as -the value of 'FS', it undergoes normal 'awk' string processing. For -example, with Unix 'awk' and 'gawk', the assignment 'FS = "\.."' assigns -the character string '".."' to 'FS' (the backslash is stripped). This -creates a regexp meaning "fields are separated by occurrences of any two -characters." If instead you want fields to be separated by a literal -period followed by any single character, use 'FS = "\\.."'. - - The following list summarizes how fields are split, based on the -value of 'FS' ('==' means "is equal to"): - -'FS == " "' - Fields are separated by runs of whitespace. Leading and trailing - whitespace are ignored. This is the default. - -'FS == ANY OTHER SINGLE CHARACTER' - Fields are separated by each occurrence of the character. Multiple - successive occurrences delimit empty fields, as do leading and - trailing occurrences. The character can even be a regexp - metacharacter; it does not need to be escaped. - -'FS == REGEXP' - Fields are separated by occurrences of characters that match - REGEXP. Leading and trailing matches of REGEXP delimit empty - fields. - -'FS == ""' - Each individual character in the record becomes a separate field. - (This is a common extension; it is not specified by the POSIX - standard.) - - 'FS' and 'IGNORECASE' - - The 'IGNORECASE' variable (*note User-modified::) affects field -splitting _only_ when the value of 'FS' is a regexp. It has no effect -when 'FS' is a single character, even if that character is a letter. -Thus, in the following code: - - FS = "c" - IGNORECASE = 1 - $0 = "aCa" - print $1 - -The output is 'aCa'. If you really want to split fields on an -alphabetic character while ignoring case, use a regexp that will do it -for you (e.g., 'FS = "[c]"'). In this case, 'IGNORECASE' will take -effect. - - -File: gawk.info, Node: Constant Size, Next: Splitting By Content, Prev: Field Separators, Up: Reading Files - -4.6 Reading Fixed-Width Data -============================ - -This minor node discusses an advanced feature of 'gawk'. If you are a -novice 'awk' user, you might want to skip it on the first reading. - - 'gawk' provides a facility for dealing with fixed-width fields with -no distinctive field separator. For example, data of this nature arises -in the input for old Fortran programs where numbers are run together, or -in the output of programs that did not anticipate the use of their -output as input for other programs. - - An example of the latter is a table where all the columns are lined -up by the use of a variable number of spaces and _empty fields are just -spaces_. Clearly, 'awk''s normal field splitting based on 'FS' does not -work well in this case. Although a portable 'awk' program can use a -series of 'substr()' calls on '$0' (*note String Functions::), this is -awkward and inefficient for a large number of fields. - - The splitting of an input record into fixed-width fields is specified -by assigning a string containing space-separated numbers to the built-in -variable 'FIELDWIDTHS'. Each number specifies the width of the field, -_including_ columns between fields. If you want to ignore the columns -between fields, you can specify the width as a separate field that is -subsequently ignored. It is a fatal error to supply a field width that -has a negative value. The following data is the output of the Unix 'w' -utility. It is useful to illustrate the use of 'FIELDWIDTHS': - - 10:06pm up 21 days, 14:04, 23 users - User tty login idle JCPU PCPU what - hzuo ttyV0 8:58pm 9 5 vi p24.tex - hzang ttyV3 6:37pm 50 -csh - eklye ttyV5 9:53pm 7 1 em thes.tex - dportein ttyV6 8:17pm 1:47 -csh - gierd ttyD3 10:00pm 1 elm - dave ttyD4 9:47pm 4 4 w - brent ttyp0 26Jun91 4:46 26:46 4:41 bash - dave ttyq4 26Jun9115days 46 46 wnewmail - - The following program takes this input, converts the idle time to -number of seconds, and prints out the first two fields and the -calculated idle time: - - BEGIN { FIELDWIDTHS = "9 6 10 6 7 7 35" } - NR > 2 { - idle = $4 - sub(/^ +/, "", idle) # strip leading spaces - if (idle == "") - idle = 0 - if (idle ~ /:/) { - split(idle, t, ":") - idle = t[1] * 60 + t[2] - } - if (idle ~ /days/) - idle *= 24 * 60 * 60 - - print $1, $2, idle - } - - NOTE: The preceding program uses a number of 'awk' features that - haven't been introduced yet. - - Running the program on the data produces the following results: - - hzuo ttyV0 0 - hzang ttyV3 50 - eklye ttyV5 0 - dportein ttyV6 107 - gierd ttyD3 1 - dave ttyD4 0 - brent ttyp0 286 - dave ttyq4 1296000 - - Another (possibly more practical) example of fixed-width input data -is the input from a deck of balloting cards. In some parts of the -United States, voters mark their choices by punching holes in computer -cards. These cards are then processed to count the votes for any -particular candidate or on any particular issue. Because a voter may -choose not to vote on some issue, any column on the card may be empty. -An 'awk' program for processing such data could use the 'FIELDWIDTHS' -feature to simplify reading the data. (Of course, getting 'gawk' to run -on a system with card readers is another story!) - - Assigning a value to 'FS' causes 'gawk' to use 'FS' for field -splitting again. Use 'FS = FS' to make this happen, without having to -know the current value of 'FS'. In order to tell which kind of field -splitting is in effect, use 'PROCINFO["FS"]' (*note Auto-set::). The -value is '"FS"' if regular field splitting is being used, or -'"FIELDWIDTHS"' if fixed-width field splitting is being used: - - if (PROCINFO["FS"] == "FS") - REGULAR FIELD SPLITTING ... - else if (PROCINFO["FS"] == "FIELDWIDTHS") - FIXED-WIDTH FIELD SPLITTING ... - else - CONTENT-BASED FIELD SPLITTING ... (see next minor node) - - This information is useful when writing a function that needs to -temporarily change 'FS' or 'FIELDWIDTHS', read some records, and then -restore the original settings (*note Passwd Functions:: for an example -of such a function). - - -File: gawk.info, Node: Splitting By Content, Next: Multiple Line, Prev: Constant Size, Up: Reading Files - -4.7 Defining Fields by Content -============================== - -This minor node discusses an advanced feature of 'gawk'. If you are a -novice 'awk' user, you might want to skip it on the first reading. - - Normally, when using 'FS', 'gawk' defines the fields as the parts of -the record that occur in between each field separator. In other words, -'FS' defines what a field _is not_, instead of what a field _is_. -However, there are times when you really want to define the fields by -what they are, and not by what they are not. - - The most notorious such case is so-called "comma-separated values" -(CSV) data. Many spreadsheet programs, for example, can export their -data into text files, where each record is terminated with a newline, -and fields are separated by commas. If commas only separated the data, -there wouldn't be an issue. The problem comes when one of the fields -contains an _embedded_ comma. In such cases, most programs embed the -field in double quotes.(1) So, we might have data like this: - - Robbins,Arnold,"1234 A Pretty Street, NE",MyTown,MyState,12345-6789,USA - - The 'FPAT' variable offers a solution for cases like this. The value -of 'FPAT' should be a string that provides a regular expression. This -regular expression describes the contents of each field. - - In the case of CSV data as presented here, each field is either -"anything that is not a comma," or "a double quote, anything that is not -a double quote, and a closing double quote." If written as a regular -expression constant (*note Regexp::), we would have -'/([^,]+)|("[^"]+")/'. Writing this as a string requires us to escape -the double quotes, leading to: - - FPAT = "([^,]+)|(\"[^\"]+\")" - - Putting this to use, here is a simple program to parse the data: - - BEGIN { - FPAT = "([^,]+)|(\"[^\"]+\")" - } - - { - print "NF = ", NF - for (i = 1; i <= NF; i++) { - printf("$%d = <%s>\n", i, $i) - } - } - - When run, we get the following: - - $ gawk -f simple-csv.awk addresses.csv - NF = 7 - $1 = <Robbins> - $2 = <Arnold> - $3 = <"1234 A Pretty Street, NE"> - $4 = <MyTown> - $5 = <MyState> - $6 = <12345-6789> - $7 = <USA> - - Note the embedded comma in the value of '$3'. - - A straightforward improvement when processing CSV data of this sort -would be to remove the quotes when they occur, with something like this: - - if (substr($i, 1, 1) == "\"") { - len = length($i) - $i = substr($i, 2, len - 2) # Get text within the two quotes - } - - As with 'FS', the 'IGNORECASE' variable (*note User-modified::) -affects field splitting with 'FPAT'. - - Assigning a value to 'FPAT' overrides field splitting with 'FS' and -with 'FIELDWIDTHS'. Similar to 'FIELDWIDTHS', the value of -'PROCINFO["FS"]' will be '"FPAT"' if content-based field splitting is -being used. - - NOTE: Some programs export CSV data that contains embedded newlines - between the double quotes. 'gawk' provides no way to deal with - this. Even though a formal specification for CSV data exists, - there isn't much more to be done; the 'FPAT' mechanism provides an - elegant solution for the majority of cases, and the 'gawk' - developers are satisfied with that. - - As written, the regexp used for 'FPAT' requires that each field -contain at least one character. A straightforward modification -(changing the first '+' to '*') allows fields to be empty: - - FPAT = "([^,]*)|(\"[^\"]+\")" - - Finally, the 'patsplit()' function makes the same functionality -available for splitting regular strings (*note String Functions::). - - To recap, 'gawk' provides three independent methods to split input -records into fields. The mechanism used is based on which of the three -variables--'FS', 'FIELDWIDTHS', or 'FPAT'--was last assigned to. - - ---------- Footnotes ---------- - - (1) The CSV format lacked a formal standard definition for many -years. RFC 4180 (http://www.ietf.org/rfc/rfc4180.txt) standardizes the -most common practices. - - -File: gawk.info, Node: Multiple Line, Next: Getline, Prev: Splitting By Content, Up: Reading Files - -4.8 Multiple-Line Records -========================= - -In some databases, a single line cannot conveniently hold all the -information in one entry. In such cases, you can use multiline records. -The first step in doing this is to choose your data format. - - One technique is to use an unusual character or string to separate -records. For example, you could use the formfeed character (written -'\f' in 'awk', as in C) to separate them, making each record a page of -the file. To do this, just set the variable 'RS' to '"\f"' (a string -containing the formfeed character). Any other character could equally -well be used, as long as it won't be part of the data in a record. - - Another technique is to have blank lines separate records. By a -special dispensation, an empty string as the value of 'RS' indicates -that records are separated by one or more blank lines. When 'RS' is set -to the empty string, each record always ends at the first blank line -encountered. The next record doesn't start until the first nonblank -line that follows. No matter how many blank lines appear in a row, they -all act as one record separator. (Blank lines must be completely empty; -lines that contain only whitespace do not count.) - - You can achieve the same effect as 'RS = ""' by assigning the string -'"\n\n+"' to 'RS'. This regexp matches the newline at the end of the -record and one or more blank lines after the record. In addition, a -regular expression always matches the longest possible sequence when -there is a choice (*note Leftmost Longest::). So, the next record -doesn't start until the first nonblank line that follows--no matter how -many blank lines appear in a row, they are considered one record -separator. - - However, there is an important difference between 'RS = ""' and 'RS = -"\n\n+"'. In the first case, leading newlines in the input data file -are ignored, and if a file ends without extra blank lines after the last -record, the final newline is removed from the record. In the second -case, this special processing is not done. (d.c.) - - Now that the input is separated into records, the second step is to -separate the fields in the records. One way to do this is to divide -each of the lines into fields in the normal manner. This happens by -default as the result of a special feature. When 'RS' is set to the -empty string _and_ 'FS' is set to a single character, the newline -character _always_ acts as a field separator. This is in addition to -whatever field separations result from 'FS'.(1) - - The original motivation for this special exception was probably to -provide useful behavior in the default case (i.e., 'FS' is equal to -'" "'). This feature can be a problem if you really don't want the -newline character to separate fields, because there is no way to prevent -it. However, you can work around this by using the 'split()' function -to break up the record manually (*note String Functions::). If you have -a single-character field separator, you can work around the special -feature in a different way, by making 'FS' into a regexp for that single -character. For example, if the field separator is a percent character, -instead of 'FS = "%"', use 'FS = "[%]"'. - - Another way to separate fields is to put each field on a separate -line: to do this, just set the variable 'FS' to the string '"\n"'. -(This single-character separator matches a single newline.) A practical -example of a data file organized this way might be a mailing list, where -blank lines separate the entries. Consider a mailing list in a file -named 'addresses', which looks like this: - - Jane Doe - 123 Main Street - Anywhere, SE 12345-6789 - - John Smith - 456 Tree-lined Avenue - Smallville, MW 98765-4321 - ... - -A simple program to process this file is as follows: - - # addrs.awk --- simple mailing list program - - # Records are separated by blank lines. - # Each line is one field. - BEGIN { RS = "" ; FS = "\n" } - - { - print "Name is:", $1 - print "Address is:", $2 - print "City and State are:", $3 - print "" - } - - Running the program produces the following output: - - $ awk -f addrs.awk addresses - -| Name is: Jane Doe - -| Address is: 123 Main Street - -| City and State are: Anywhere, SE 12345-6789 - -| - -| Name is: John Smith - -| Address is: 456 Tree-lined Avenue - -| City and State are: Smallville, MW 98765-4321 - -| - ... - - *Note Labels Program:: for a more realistic program dealing with -address lists. The following list summarizes how records are split, -based on the value of 'RS'. ('==' means "is equal to.") - -'RS == "\n"' - Records are separated by the newline character ('\n'). In effect, - every line in the data file is a separate record, including blank - lines. This is the default. - -'RS == ANY SINGLE CHARACTER' - Records are separated by each occurrence of the character. - Multiple successive occurrences delimit empty records. - -'RS == ""' - Records are separated by runs of blank lines. When 'FS' is a - single character, then the newline character always serves as a - field separator, in addition to whatever value 'FS' may have. - Leading and trailing newlines in a file are ignored. - -'RS == REGEXP' - Records are separated by occurrences of characters that match - REGEXP. Leading and trailing matches of REGEXP delimit empty - records. (This is a 'gawk' extension; it is not specified by the - POSIX standard.) - - If not in compatibility mode (*note Options::), 'gawk' sets 'RT' to -the input text that matched the value specified by 'RS'. But if the -input file ended without any text that matches 'RS', then 'gawk' sets -'RT' to the null string. - - ---------- Footnotes ---------- - - (1) When 'FS' is the null string ('""') or a regexp, this special -feature of 'RS' does not apply. It does apply to the default field -separator of a single space: 'FS = " "'. - - -File: gawk.info, Node: Getline, Next: Read Timeout, Prev: Multiple Line, Up: Reading Files - -4.9 Explicit Input with 'getline' -================================= - -So far we have been getting our input data from 'awk''s main input -stream--either the standard input (usually your keyboard, sometimes the -output from another program) or the files specified on the command line. -The 'awk' language has a special built-in command called 'getline' that -can be used to read input under your explicit control. - - The 'getline' command is used in several different ways and should -_not_ be used by beginners. The examples that follow the explanation of -the 'getline' command include material that has not been covered yet. -Therefore, come back and study the 'getline' command _after_ you have -reviewed the rest of this Info file and have a good knowledge of how -'awk' works. - - The 'getline' command returns 1 if it finds a record and 0 if it -encounters the end of the file. If there is some error in getting a -record, such as a file that cannot be opened, then 'getline' returns -1. -In this case, 'gawk' sets the variable 'ERRNO' to a string describing -the error that occurred. - - If 'ERRNO' indicates that the I/O operation may be retried, and -'PROCINFO["INPUT", "RETRY"]' is set, then 'getline' returns -2 instead -of -1, and further calls to 'getline' may be attempted. *Note Retrying -Input:: for further information about this feature. - - In the following examples, COMMAND stands for a string value that -represents a shell command. - - NOTE: When '--sandbox' is specified (*note Options::), reading - lines from files, pipes, and coprocesses is disabled. - -* Menu: - -* Plain Getline:: Using 'getline' with no arguments. -* Getline/Variable:: Using 'getline' into a variable. -* Getline/File:: Using 'getline' from a file. -* Getline/Variable/File:: Using 'getline' into a variable from a - file. -* Getline/Pipe:: Using 'getline' from a pipe. -* Getline/Variable/Pipe:: Using 'getline' into a variable from a - pipe. -* Getline/Coprocess:: Using 'getline' from a coprocess. -* Getline/Variable/Coprocess:: Using 'getline' into a variable from a - coprocess. -* Getline Notes:: Important things to know about 'getline'. -* Getline Summary:: Summary of 'getline' Variants. - - -File: gawk.info, Node: Plain Getline, Next: Getline/Variable, Up: Getline - -4.9.1 Using 'getline' with No Arguments ---------------------------------------- - -The 'getline' command can be used without arguments to read input from -the current input file. All it does in this case is read the next input -record and split it up into fields. This is useful if you've finished -processing the current record, but want to do some special processing on -the next record _right now_. For example: - - # Remove text between /* and */, inclusive - { - if ((i = index($0, "/*")) != 0) { - out = substr($0, 1, i - 1) # leading part of the string - rest = substr($0, i + 2) # ... */ ... - j = index(rest, "*/") # is */ in trailing part? - if (j > 0) { - rest = substr(rest, j + 2) # remove comment - } else { - while (j == 0) { - # get more text - if (getline <= 0) { - print("unexpected EOF or error:", ERRNO) > "/dev/stderr" - exit - } - # build up the line using string concatenation - rest = rest $0 - j = index(rest, "*/") # is */ in trailing part? - if (j != 0) { - rest = substr(rest, j + 2) - break - } - } - } - # build up the output line using string concatenation - $0 = out rest - } - print $0 - } - - This 'awk' program deletes C-style comments ('/* ... */') from the -input. It uses a number of features we haven't covered yet, including -string concatenation (*note Concatenation::) and the 'index()' and -'substr()' built-in functions (*note String Functions::). By replacing -the 'print $0' with other statements, you could perform more complicated -processing on the decommented input, such as searching for matches of a -regular expression. (This program has a subtle problem--it does not -work if one comment ends and another begins on the same line.) - - This form of the 'getline' command sets 'NF', 'NR', 'FNR', 'RT', and -the value of '$0'. - - NOTE: The new value of '$0' is used to test the patterns of any - subsequent rules. The original value of '$0' that triggered the - rule that executed 'getline' is lost. By contrast, the 'next' - statement reads a new record but immediately begins processing it - normally, starting with the first rule in the program. *Note Next - Statement::. - - -File: gawk.info, Node: Getline/Variable, Next: Getline/File, Prev: Plain Getline, Up: Getline - -4.9.2 Using 'getline' into a Variable -------------------------------------- - -You can use 'getline VAR' to read the next record from 'awk''s input -into the variable VAR. No other processing is done. For example, -suppose the next line is a comment or a special string, and you want to -read it without triggering any rules. This form of 'getline' allows you -to read that line and store it in a variable so that the main -read-a-line-and-check-each-rule loop of 'awk' never sees it. The -following example swaps every two lines of input: - - { - if ((getline tmp) > 0) { - print tmp - print $0 - } else - print $0 - } - -It takes the following list: - - wan - tew - free - phore - -and produces these results: - - tew - wan - phore - free - - The 'getline' command used in this way sets only the variables 'NR', -'FNR', and 'RT' (and, of course, VAR). The record is not split into -fields, so the values of the fields (including '$0') and the value of -'NF' do not change. - - -File: gawk.info, Node: Getline/File, Next: Getline/Variable/File, Prev: Getline/Variable, Up: Getline - -4.9.3 Using 'getline' from a File ---------------------------------- - -Use 'getline < FILE' to read the next record from FILE. Here, FILE is a -string-valued expression that specifies the file name. '< FILE' is -called a "redirection" because it directs input to come from a different -place. For example, the following program reads its input record from -the file 'secondary.input' when it encounters a first field with a value -equal to 10 in the current input file: - - { - if ($1 == 10) { - getline < "secondary.input" - print - } else - print - } - - Because the main input stream is not used, the values of 'NR' and -'FNR' are not changed. However, the record it reads is split into -fields in the normal manner, so the values of '$0' and the other fields -are changed, resulting in a new value of 'NF'. 'RT' is also set. - - According to POSIX, 'getline < EXPRESSION' is ambiguous if EXPRESSION -contains unparenthesized operators other than '$'; for example, 'getline -< dir "/" file' is ambiguous because the concatenation operator (not -discussed yet; *note Concatenation::) is not parenthesized. You should -write it as 'getline < (dir "/" file)' if you want your program to be -portable to all 'awk' implementations. - - -File: gawk.info, Node: Getline/Variable/File, Next: Getline/Pipe, Prev: Getline/File, Up: Getline - -4.9.4 Using 'getline' into a Variable from a File -------------------------------------------------- - -Use 'getline VAR < FILE' to read input from the file FILE, and put it in -the variable VAR. As earlier, FILE is a string-valued expression that -specifies the file from which to read. - - In this version of 'getline', none of the predefined variables are -changed and the record is not split into fields. The only variable -changed is VAR.(1) For example, the following program copies all the -input files to the output, except for records that say -'@include FILENAME'. Such a record is replaced by the contents of the -file FILENAME: - - { - if (NF == 2 && $1 == "@include") { - while ((getline line < $2) > 0) - print line - close($2) - } else - print - } - - Note here how the name of the extra input file is not built into the -program; it is taken directly from the data, specifically from the -second field on the '@include' line. - - The 'close()' function is called to ensure that if two identical -'@include' lines appear in the input, the entire specified file is -included twice. *Note Close Files And Pipes::. - - One deficiency of this program is that it does not process nested -'@include' statements (i.e., '@include' statements in included files) -the way a true macro preprocessor would. *Note Igawk Program:: for a -program that does handle nested '@include' statements. - - ---------- Footnotes ---------- - - (1) This is not quite true. 'RT' could be changed if 'RS' is a -regular expression. - - -File: gawk.info, Node: Getline/Pipe, Next: Getline/Variable/Pipe, Prev: Getline/Variable/File, Up: Getline - -4.9.5 Using 'getline' from a Pipe ---------------------------------- - - Omniscience has much to recommend it. Failing that, attention to - details would be useful. - -- _Brian Kernighan_ - - The output of a command can also be piped into 'getline', using -'COMMAND | getline'. In this case, the string COMMAND is run as a shell -command and its output is piped into 'awk' to be used as input. This -form of 'getline' reads one record at a time from the pipe. For -example, the following program copies its input to its output, except -for lines that begin with '@execute', which are replaced by the output -produced by running the rest of the line as a shell command: - - { - if ($1 == "@execute") { - tmp = substr($0, 10) # Remove "@execute" - while ((tmp | getline) > 0) - print - close(tmp) - } else - print - } - -The 'close()' function is called to ensure that if two identical -'@execute' lines appear in the input, the command is run for each one. -*Note Close Files And Pipes::. Given the input: - - foo - bar - baz - @execute who - bletch - -the program might produce: - - foo - bar - baz - arnold ttyv0 Jul 13 14:22 - miriam ttyp0 Jul 13 14:23 (murphy:0) - bill ttyp1 Jul 13 14:23 (murphy:0) - bletch - -Notice that this program ran the command 'who' and printed the result. -(If you try this program yourself, you will of course get different -results, depending upon who is logged in on your system.) - - This variation of 'getline' splits the record into fields, sets the -value of 'NF', and recomputes the value of '$0'. The values of 'NR' and -'FNR' are not changed. 'RT' is set. - - According to POSIX, 'EXPRESSION | getline' is ambiguous if EXPRESSION -contains unparenthesized operators other than '$'--for example, '"echo " -"date" | getline' is ambiguous because the concatenation operator is not -parenthesized. You should write it as '("echo " "date") | getline' if -you want your program to be portable to all 'awk' implementations. - - NOTE: Unfortunately, 'gawk' has not been consistent in its - treatment of a construct like '"echo " "date" | getline'. Most - versions, including the current version, treat it at as '("echo " - "date") | getline'. (This is also how BWK 'awk' behaves.) Some - versions instead treat it as '"echo " ("date" | getline)'. (This - is how 'mawk' behaves.) In short, _always_ use explicit - parentheses, and then you won't have to worry. - - -File: gawk.info, Node: Getline/Variable/Pipe, Next: Getline/Coprocess, Prev: Getline/Pipe, Up: Getline - -4.9.6 Using 'getline' into a Variable from a Pipe -------------------------------------------------- - -When you use 'COMMAND | getline VAR', the output of COMMAND is sent -through a pipe to 'getline' and into the variable VAR. For example, the -following program reads the current date and time into the variable -'current_time', using the 'date' utility, and then prints it: - - BEGIN { - "date" | getline current_time - close("date") - print "Report printed on " current_time - } - - In this version of 'getline', none of the predefined variables are -changed and the record is not split into fields. However, 'RT' is set. - - According to POSIX, 'EXPRESSION | getline VAR' is ambiguous if -EXPRESSION contains unparenthesized operators other than '$'; for -example, '"echo " "date" | getline VAR' is ambiguous because the -concatenation operator is not parenthesized. You should write it as -'("echo " "date") | getline VAR' if you want your program to be portable -to other 'awk' implementations. - - -File: gawk.info, Node: Getline/Coprocess, Next: Getline/Variable/Coprocess, Prev: Getline/Variable/Pipe, Up: Getline - -4.9.7 Using 'getline' from a Coprocess --------------------------------------- - -Reading input into 'getline' from a pipe is a one-way operation. The -command that is started with 'COMMAND | getline' only sends data _to_ -your 'awk' program. - - On occasion, you might want to send data to another program for -processing and then read the results back. 'gawk' allows you to start a -"coprocess", with which two-way communications are possible. This is -done with the '|&' operator. Typically, you write data to the coprocess -first and then read the results back, as shown in the following: - - print "SOME QUERY" |& "db_server" - "db_server" |& getline - -which sends a query to 'db_server' and then reads the results. - - The values of 'NR' and 'FNR' are not changed, because the main input -stream is not used. However, the record is split into fields in the -normal manner, thus changing the values of '$0', of the other fields, -and of 'NF' and 'RT'. - - Coprocesses are an advanced feature. They are discussed here only -because this is the minor node on 'getline'. *Note Two-way I/O::, where -coprocesses are discussed in more detail. - - -File: gawk.info, Node: Getline/Variable/Coprocess, Next: Getline Notes, Prev: Getline/Coprocess, Up: Getline - -4.9.8 Using 'getline' into a Variable from a Coprocess ------------------------------------------------------- - -When you use 'COMMAND |& getline VAR', the output from the coprocess -COMMAND is sent through a two-way pipe to 'getline' and into the -variable VAR. - - In this version of 'getline', none of the predefined variables are -changed and the record is not split into fields. The only variable -changed is VAR. However, 'RT' is set. - - Coprocesses are an advanced feature. They are discussed here only -because this is the minor node on 'getline'. *Note Two-way I/O::, where -coprocesses are discussed in more detail. - - -File: gawk.info, Node: Getline Notes, Next: Getline Summary, Prev: Getline/Variable/Coprocess, Up: Getline - -4.9.9 Points to Remember About 'getline' ----------------------------------------- - -Here are some miscellaneous points about 'getline' that you should bear -in mind: - - * When 'getline' changes the value of '$0' and 'NF', 'awk' does _not_ - automatically jump to the start of the program and start testing - the new record against every pattern. However, the new record is - tested against any subsequent rules. - - * Some very old 'awk' implementations limit the number of pipelines - that an 'awk' program may have open to just one. In 'gawk', there - is no such limit. You can open as many pipelines (and coprocesses) - as the underlying operating system permits. - - * An interesting side effect occurs if you use 'getline' without a - redirection inside a 'BEGIN' rule. Because an unredirected - 'getline' reads from the command-line data files, the first - 'getline' command causes 'awk' to set the value of 'FILENAME'. - Normally, 'FILENAME' does not have a value inside 'BEGIN' rules, - because you have not yet started to process the command-line data - files. (d.c.) (See *note BEGIN/END::; also *note Auto-set::.) - - * Using 'FILENAME' with 'getline' ('getline < FILENAME') is likely to - be a source of confusion. 'awk' opens a separate input stream from - the current input file. However, by not using a variable, '$0' and - 'NF' are still updated. If you're doing this, it's probably by - accident, and you should reconsider what it is you're trying to - accomplish. - - * *note Getline Summary::, presents a table summarizing the 'getline' - variants and which variables they can affect. It is worth noting - that those variants that do not use redirection can cause - 'FILENAME' to be updated if they cause 'awk' to start reading a new - input file. - - * If the variable being assigned is an expression with side effects, - different versions of 'awk' behave differently upon encountering - end-of-file. Some versions don't evaluate the expression; many - versions (including 'gawk') do. Here is an example, courtesy of - Duncan Moore: - - BEGIN { - system("echo 1 > f") - while ((getline a[++c] < "f") > 0) { } - print c - } - - Here, the side effect is the '++c'. Is 'c' incremented if - end-of-file is encountered before the element in 'a' is assigned? - - 'gawk' treats 'getline' like a function call, and evaluates the - expression 'a[++c]' before attempting to read from 'f'. However, - some versions of 'awk' only evaluate the expression once they know - that there is a string value to be assigned. - - -File: gawk.info, Node: Getline Summary, Prev: Getline Notes, Up: Getline - -4.9.10 Summary of 'getline' Variants ------------------------------------- - -*note Table 4.1: table-getline-variants. summarizes the eight variants -of 'getline', listing which predefined variables are set by each one, -and whether the variant is standard or a 'gawk' extension. Note: for -each variant, 'gawk' sets the 'RT' predefined variable. - -Variant Effect 'awk' / 'gawk' -------------------------------------------------------------------------- -'getline' Sets '$0', 'NF', 'FNR', 'awk' - 'NR', and 'RT' -'getline' VAR Sets VAR, 'FNR', 'NR', 'awk' - and 'RT' -'getline <' FILE Sets '$0', 'NF', and 'RT' 'awk' -'getline VAR < FILE' Sets VAR and 'RT' 'awk' -COMMAND '| getline' Sets '$0', 'NF', and 'RT' 'awk' -COMMAND '| getline' Sets VAR and 'RT' 'awk' -VAR -COMMAND '|& getline' Sets '$0', 'NF', and 'RT' 'gawk' -COMMAND '|& getline' Sets VAR and 'RT' 'gawk' -VAR - -Table 4.1: 'getline' variants and what they set - - -File: gawk.info, Node: Read Timeout, Next: Retrying Input, Prev: Getline, Up: Reading Files - -4.10 Reading Input with a Timeout -================================= - -This minor node describes a feature that is specific to 'gawk'. - - You may specify a timeout in milliseconds for reading input from the -keyboard, a pipe, or two-way communication, including TCP/IP sockets. -This can be done on a per-input, per-command, or per-connection basis, -by setting a special element in the 'PROCINFO' array (*note Auto-set::): - - PROCINFO["input_name", "READ_TIMEOUT"] = TIMEOUT IN MILLISECONDS - - When set, this causes 'gawk' to time out and return failure if no -data is available to read within the specified timeout period. For -example, a TCP client can decide to give up on receiving any response -from the server after a certain amount of time: - - Service = "/inet/tcp/0/localhost/daytime" - PROCINFO[Service, "READ_TIMEOUT"] = 100 - if ((Service |& getline) > 0) - print $0 - else if (ERRNO != "") - print ERRNO - - Here is how to read interactively from the user(1) without waiting -for more than five seconds: - - PROCINFO["/dev/stdin", "READ_TIMEOUT"] = 5000 - while ((getline < "/dev/stdin") > 0) - print $0 - - 'gawk' terminates the read operation if input does not arrive after -waiting for the timeout period, returns failure, and sets 'ERRNO' to an -appropriate string value. A negative or zero value for the timeout is -the same as specifying no timeout at all. - - A timeout can also be set for reading from the keyboard in the -implicit loop that reads input records and matches them against -patterns, like so: - - $ gawk 'BEGIN { PROCINFO["-", "READ_TIMEOUT"] = 5000 } - > { print "You entered: " $0 }' - gawk - -| You entered: gawk - - In this case, failure to respond within five seconds results in the -following error message: - - error-> gawk: cmd. line:2: (FILENAME=- FNR=1) fatal: error reading input file `-': Connection timed out - - The timeout can be set or changed at any time, and will take effect -on the next attempt to read from the input device. In the following -example, we start with a timeout value of one second, and progressively -reduce it by one-tenth of a second until we wait indefinitely for the -input to arrive: - - PROCINFO[Service, "READ_TIMEOUT"] = 1000 - while ((Service |& getline) > 0) { - print $0 - PROCINFO[Service, "READ_TIMEOUT"] -= 100 - } - - NOTE: You should not assume that the read operation will block - exactly after the tenth record has been printed. It is possible - that 'gawk' will read and buffer more than one record's worth of - data the first time. Because of this, changing the value of - timeout like in the preceding example is not very useful. - - If the 'PROCINFO' element is not present and the 'GAWK_READ_TIMEOUT' -environment variable exists, 'gawk' uses its value to initialize the -timeout value. The exclusive use of the environment variable to specify -timeout has the disadvantage of not being able to control it on a -per-command or per-connection basis. - - 'gawk' considers a timeout event to be an error even though the -attempt to read from the underlying device may succeed in a later -attempt. This is a limitation, and it also means that you cannot use -this to multiplex input from two or more sources. *Note Retrying -Input:: for a way to enable later I/O attempts to succeed. - - Assigning a timeout value prevents read operations from blocking -indefinitely. But bear in mind that there are other ways 'gawk' can -stall waiting for an input device to be ready. A network client can -sometimes take a long time to establish a connection before it can start -reading any data, or the attempt to open a FIFO special file for reading -can block indefinitely until some other process opens it for writing. - - ---------- Footnotes ---------- - - (1) This assumes that standard input is the keyboard. - - -File: gawk.info, Node: Retrying Input, Next: Command-line directories, Prev: Read Timeout, Up: Reading Files - -4.11 Retrying Reads After Certain Input Errors -============================================== - -This minor node describes a feature that is specific to 'gawk'. - - When 'gawk' encounters an error while reading input, by default -'getline' returns -1, and subsequent attempts to read from that file -result in an end-of-file indication. However, you may optionally -instruct 'gawk' to allow I/O to be retried when certain errors are -encountered by setting a special element in the 'PROCINFO' array (*note -Auto-set::): - - PROCINFO["INPUT_NAME", "RETRY"] = 1 - - When this element exists, 'gawk' checks the value of the system (C -language) 'errno' variable when an I/O error occurs. If 'errno' -indicates a subsequent I/O attempt may succeed, 'getline' instead -returns -2 and further calls to 'getline' may succeed. This applies to -the 'errno' values 'EAGAIN', 'EWOULDBLOCK', 'EINTR', or 'ETIMEDOUT'. - - This feature is useful in conjunction with 'PROCINFO["INPUT_NAME", -"READ_TIMEOUT"]' or situations where a file descriptor has been -configured to behave in a non-blocking fashion. - - -File: gawk.info, Node: Command-line directories, Next: Input Summary, Prev: Retrying Input, Up: Reading Files - -4.12 Directories on the Command Line -==================================== - -According to the POSIX standard, files named on the 'awk' command line -must be text files; it is a fatal error if they are not. Most versions -of 'awk' treat a directory on the command line as a fatal error. - - By default, 'gawk' produces a warning for a directory on the command -line, but otherwise ignores it. This makes it easier to use shell -wildcards with your 'awk' program: - - $ gawk -f whizprog.awk * Directories could kill this program - - If either of the '--posix' or '--traditional' options is given, then -'gawk' reverts to treating a directory on the command line as a fatal -error. - - *Note Extension Sample Readdir:: for a way to treat directories as -usable data from an 'awk' program. - - -File: gawk.info, Node: Input Summary, Next: Input Exercises, Prev: Command-line directories, Up: Reading Files - -4.13 Summary -============ - - * Input is split into records based on the value of 'RS'. The - possibilities are as follows: - - Value of 'RS' Records are split on 'awk' / 'gawk' - ... - --------------------------------------------------------------------------- - Any single That character 'awk' - character - The empty string Runs of two or more 'awk' - ('""') newlines - A regexp Text that matches the 'gawk' - regexp - - * 'FNR' indicates how many records have been read from the current - input file; 'NR' indicates how many records have been read in - total. - - * 'gawk' sets 'RT' to the text matched by 'RS'. - - * After splitting the input into records, 'awk' further splits the - records into individual fields, named '$1', '$2', and so on. '$0' - is the whole record, and 'NF' indicates how many fields there are. - The default way to split fields is between whitespace characters. - - * Fields may be referenced using a variable, as in '$NF'. Fields may - also be assigned values, which causes the value of '$0' to be - recomputed when it is later referenced. Assigning to a field with - a number greater than 'NF' creates the field and rebuilds the - record, using 'OFS' to separate the fields. Incrementing 'NF' does - the same thing. Decrementing 'NF' throws away fields and rebuilds - the record. - - * Field splitting is more complicated than record splitting: - - Field separator value Fields are split ... 'awk' / - 'gawk' - --------------------------------------------------------------------------- - 'FS == " "' On runs of whitespace 'awk' - 'FS == ANY SINGLE On that character 'awk' - CHARACTER' - 'FS == REGEXP' On text matching the regexp 'awk' - 'FS == ""' Such that each individual 'gawk' - character is a separate - field - 'FIELDWIDTHS == LIST OF Based on character position 'gawk' - COLUMNS' - 'FPAT == REGEXP' On the text surrounding 'gawk' - text matching the regexp - - * Using 'FS = "\n"' causes the entire record to be a single field - (assuming that newlines separate records). - - * 'FS' may be set from the command line using the '-F' option. This - can also be done using command-line variable assignment. - - * Use 'PROCINFO["FS"]' to see how fields are being split. - - * Use 'getline' in its various forms to read additional records from - the default input stream, from a file, or from a pipe or coprocess. - - * Use 'PROCINFO[FILE, "READ_TIMEOUT"]' to cause reads to time out for - FILE. - - * Directories on the command line are fatal for standard 'awk'; - 'gawk' ignores them if not in POSIX mode. - - -File: gawk.info, Node: Input Exercises, Prev: Input Summary, Up: Reading Files - -4.14 Exercises -============== - - 1. Using the 'FIELDWIDTHS' variable (*note Constant Size::), write a - program to read election data, where each record represents one - voter's votes. Come up with a way to define which columns are - associated with each ballot item, and print the total votes, - including abstentions, for each item. - - 2. *note Plain Getline::, presented a program to remove C-style - comments ('/* ... */') from the input. That program does not work - if one comment ends on one line and another one starts later on the - same line. That can be fixed by making one simple change. What is - it? - - -File: gawk.info, Node: Printing, Next: Expressions, Prev: Reading Files, Up: Top - -5 Printing Output -***************** - -One of the most common programming actions is to "print", or output, -some or all of the input. Use the 'print' statement for simple output, -and the 'printf' statement for fancier formatting. The 'print' -statement is not limited when computing _which_ values to print. -However, with two exceptions, you cannot specify _how_ to print -them--how many columns, whether to use exponential notation or not, and -so on. (For the exceptions, *note Output Separators:: and *note -OFMT::.) For printing with specifications, you need the 'printf' -statement (*note Printf::). - - Besides basic and formatted printing, this major node also covers I/O -redirections to files and pipes, introduces the special file names that -'gawk' processes internally, and discusses the 'close()' built-in -function. - -* Menu: - -* Print:: The 'print' statement. -* Print Examples:: Simple examples of 'print' statements. -* Output Separators:: The output separators and how to change them. -* OFMT:: Controlling Numeric Output With 'print'. -* Printf:: The 'printf' statement. -* Redirection:: How to redirect output to multiple files and - pipes. -* Special FD:: Special files for I/O. -* Special Files:: File name interpretation in 'gawk'. - 'gawk' allows access to inherited file - descriptors. -* Close Files And Pipes:: Closing Input and Output Files and Pipes. -* Nonfatal:: Enabling Nonfatal Output. -* Output Summary:: Output summary. -* Output Exercises:: Exercises. - - -File: gawk.info, Node: Print, Next: Print Examples, Up: Printing - -5.1 The 'print' Statement -========================= - -Use the 'print' statement to produce output with simple, standardized -formatting. You specify only the strings or numbers to print, in a list -separated by commas. They are output, separated by single spaces, -followed by a newline. The statement looks like this: - - print ITEM1, ITEM2, ... - -The entire list of items may be optionally enclosed in parentheses. The -parentheses are necessary if any of the item expressions uses the '>' -relational operator; otherwise it could be confused with an output -redirection (*note Redirection::). - - The items to print can be constant strings or numbers, fields of the -current record (such as '$1'), variables, or any 'awk' expression. -Numeric values are converted to strings and then printed. - - The simple statement 'print' with no items is equivalent to 'print -$0': it prints the entire current record. To print a blank line, use -'print ""'. To print a fixed piece of text, use a string constant, such -as '"Don't Panic"', as one item. If you forget to use the double-quote -characters, your text is taken as an 'awk' expression, and you will -probably get an error. Keep in mind that a space is printed between any -two items. - - Note that the 'print' statement is a statement and not an -expression--you can't use it in the pattern part of a pattern-action -statement, for example. - - -File: gawk.info, Node: Print Examples, Next: Output Separators, Prev: Print, Up: Printing - -5.2 'print' Statement Examples -============================== - -Each 'print' statement makes at least one line of output. However, it -isn't limited to only one line. If an item value is a string containing -a newline, the newline is output along with the rest of the string. A -single 'print' statement can make any number of lines this way. - - The following is an example of printing a string that contains -embedded newlines (the '\n' is an escape sequence, used to represent the -newline character; *note Escape Sequences::): - - $ awk 'BEGIN { print "line one\nline two\nline three" }' - -| line one - -| line two - -| line three - - The next example, which is run on the 'inventory-shipped' file, -prints the first two fields of each input record, with a space between -them: - - $ awk '{ print $1, $2 }' inventory-shipped - -| Jan 13 - -| Feb 15 - -| Mar 15 - ... - - A common mistake in using the 'print' statement is to omit the comma -between two items. This often has the effect of making the items run -together in the output, with no space. The reason for this is that -juxtaposing two string expressions in 'awk' means to concatenate them. -Here is the same program, without the comma: - - $ awk '{ print $1 $2 }' inventory-shipped - -| Jan13 - -| Feb15 - -| Mar15 - ... - - To someone unfamiliar with the 'inventory-shipped' file, neither -example's output makes much sense. A heading line at the beginning -would make it clearer. Let's add some headings to our table of months -('$1') and green crates shipped ('$2'). We do this using a 'BEGIN' rule -(*note BEGIN/END::) so that the headings are only printed once: - - awk 'BEGIN { print "Month Crates" - print "----- ------" } - { print $1, $2 }' inventory-shipped - -When run, the program prints the following: - - Month Crates - ----- ------ - Jan 13 - Feb 15 - Mar 15 - ... - -The only problem, however, is that the headings and the table data don't -line up! We can fix this by printing some spaces between the two -fields: - - awk 'BEGIN { print "Month Crates" - print "----- ------" } - { print $1, " ", $2 }' inventory-shipped - - Lining up columns this way can get pretty complicated when there are -many columns to fix. Counting spaces for two or three columns is -simple, but any more than this can take up a lot of time. This is why -the 'printf' statement was created (*note Printf::); one of its -specialties is lining up columns of data. - - NOTE: You can continue either a 'print' or 'printf' statement - simply by putting a newline after any comma (*note - Statements/Lines::). - - -File: gawk.info, Node: Output Separators, Next: OFMT, Prev: Print Examples, Up: Printing - -5.3 Output Separators -===================== - -As mentioned previously, a 'print' statement contains a list of items -separated by commas. In the output, the items are normally separated by -single spaces. However, this doesn't need to be the case; a single -space is simply the default. Any string of characters may be used as -the "output field separator" by setting the predefined variable 'OFS'. -The initial value of this variable is the string '" "' (i.e., a single -space). - - The output from an entire 'print' statement is called an "output -record". Each 'print' statement outputs one output record, and then -outputs a string called the "output record separator" (or 'ORS'). The -initial value of 'ORS' is the string '"\n"' (i.e., a newline character). -Thus, each 'print' statement normally makes a separate line. - - In order to change how output fields and records are separated, -assign new values to the variables 'OFS' and 'ORS'. The usual place to -do this is in the 'BEGIN' rule (*note BEGIN/END::), so that it happens -before any input is processed. It can also be done with assignments on -the command line, before the names of the input files, or using the '-v' -command-line option (*note Options::). The following example prints the -first and second fields of each input record, separated by a semicolon, -with a blank line added after each newline: - - $ awk 'BEGIN { OFS = ";"; ORS = "\n\n" } - > { print $1, $2 }' mail-list - -| Amelia;555-5553 - -| - -| Anthony;555-3412 - -| - -| Becky;555-7685 - -| - -| Bill;555-1675 - -| - -| Broderick;555-0542 - -| - -| Camilla;555-2912 - -| - -| Fabius;555-1234 - -| - -| Julie;555-6699 - -| - -| Martin;555-6480 - -| - -| Samuel;555-3430 - -| - -| Jean-Paul;555-2127 - -| - - If the value of 'ORS' does not contain a newline, the program's -output runs together on a single line. - - -File: gawk.info, Node: OFMT, Next: Printf, Prev: Output Separators, Up: Printing - -5.4 Controlling Numeric Output with 'print' -=========================================== - -When printing numeric values with the 'print' statement, 'awk' -internally converts each number to a string of characters and prints -that string. 'awk' uses the 'sprintf()' function to do this conversion -(*note String Functions::). For now, it suffices to say that the -'sprintf()' function accepts a "format specification" that tells it how -to format numbers (or strings), and that there are a number of different -ways in which numbers can be formatted. The different format -specifications are discussed more fully in *note Control Letters::. - - The predefined variable 'OFMT' contains the format specification that -'print' uses with 'sprintf()' when it wants to convert a number to a -string for printing. The default value of 'OFMT' is '"%.6g"'. The way -'print' prints numbers can be changed by supplying a different format -specification for the value of 'OFMT', as shown in the following -example: - - $ awk 'BEGIN { - > OFMT = "%.0f" # print numbers as integers (rounds) - > print 17.23, 17.54 }' - -| 17 18 - -According to the POSIX standard, 'awk''s behavior is undefined if 'OFMT' -contains anything but a floating-point conversion specification. (d.c.) - - -File: gawk.info, Node: Printf, Next: Redirection, Prev: OFMT, Up: Printing - -5.5 Using 'printf' Statements for Fancier Printing -================================================== - -For more precise control over the output format than what is provided by -'print', use 'printf'. With 'printf' you can specify the width to use -for each item, as well as various formatting choices for numbers (such -as what output base to use, whether to print an exponent, whether to -print a sign, and how many digits to print after the decimal point). - -* Menu: - -* Basic Printf:: Syntax of the 'printf' statement. -* Control Letters:: Format-control letters. -* Format Modifiers:: Format-specification modifiers. -* Printf Examples:: Several examples. - - -File: gawk.info, Node: Basic Printf, Next: Control Letters, Up: Printf - -5.5.1 Introduction to the 'printf' Statement --------------------------------------------- - -A simple 'printf' statement looks like this: - - printf FORMAT, ITEM1, ITEM2, ... - -As for 'print', the entire list of arguments may optionally be enclosed -in parentheses. Here too, the parentheses are necessary if any of the -item expressions uses the '>' relational operator; otherwise, it can be -confused with an output redirection (*note Redirection::). - - The difference between 'printf' and 'print' is the FORMAT argument. -This is an expression whose value is taken as a string; it specifies how -to output each of the other arguments. It is called the "format -string". - - The format string is very similar to that in the ISO C library -function 'printf()'. Most of FORMAT is text to output verbatim. -Scattered among this text are "format specifiers"--one per item. Each -format specifier says to output the next item in the argument list at -that place in the format. - - The 'printf' statement does not automatically append a newline to its -output. It outputs only what the format string specifies. So if a -newline is needed, you must include one in the format string. The -output separator variables 'OFS' and 'ORS' have no effect on 'printf' -statements. For example: - - $ awk 'BEGIN { - > ORS = "\nOUCH!\n"; OFS = "+" - > msg = "Don\47t Panic!" - > printf "%s\n", msg - > }' - -| Don't Panic! - -Here, neither the '+' nor the 'OUCH!' appears in the output message. - - -File: gawk.info, Node: Control Letters, Next: Format Modifiers, Prev: Basic Printf, Up: Printf - -5.5.2 Format-Control Letters ----------------------------- - -A format specifier starts with the character '%' and ends with a -"format-control letter"--it tells the 'printf' statement how to output -one item. The format-control letter specifies what _kind_ of value to -print. The rest of the format specifier is made up of optional -"modifiers" that control _how_ to print the value, such as the field -width. Here is a list of the format-control letters: - -'%c' - Print a number as a character; thus, 'printf "%c", 65' outputs the - letter 'A'. The output for a string value is the first character - of the string. - - NOTE: The POSIX standard says the first character of a string - is printed. In locales with multibyte characters, 'gawk' - attempts to convert the leading bytes of the string into a - valid wide character and then to print the multibyte encoding - of that character. Similarly, when printing a numeric value, - 'gawk' allows the value to be within the numeric range of - values that can be held in a wide character. If the - conversion to multibyte encoding fails, 'gawk' uses the low - eight bits of the value as the character to print. - - Other 'awk' versions generally restrict themselves to printing - the first byte of a string or to numeric values within the - range of a single byte (0-255). - -'%d', '%i' - Print a decimal integer. The two control letters are equivalent. - (The '%i' specification is for compatibility with ISO C.) - -'%e', '%E' - Print a number in scientific (exponential) notation. For example: - - printf "%4.3e\n", 1950 - - prints '1.950e+03', with a total of four significant figures, three - of which follow the decimal point. (The '4.3' represents two - modifiers, discussed in the next node.) '%E' uses 'E' instead of - 'e' in the output. - -'%f' - Print a number in floating-point notation. For example: - - printf "%4.3f", 1950 - - prints '1950.000', with a total of four significant figures, three - of which follow the decimal point. (The '4.3' represents two - modifiers, discussed in the next node.) - - On systems supporting IEEE 754 floating-point format, values - representing negative infinity are formatted as '-inf' or - '-infinity', and positive infinity as 'inf' or 'infinity'. The - special "not a number" value formats as '-nan' or 'nan' (*note Math - Definitions::). - -'%F' - Like '%f', but the infinity and "not a number" values are spelled - using uppercase letters. - - The '%F' format is a POSIX extension to ISO C; not all systems - support it. On those that don't, 'gawk' uses '%f' instead. - -'%g', '%G' - Print a number in either scientific notation or in floating-point - notation, whichever uses fewer characters; if the result is printed - in scientific notation, '%G' uses 'E' instead of 'e'. - -'%o' - Print an unsigned octal integer (*note Nondecimal-numbers::). - -'%s' - Print a string. - -'%u' - Print an unsigned decimal integer. (This format is of marginal - use, because all numbers in 'awk' are floating point; it is - provided primarily for compatibility with C.) - -'%x', '%X' - Print an unsigned hexadecimal integer; '%X' uses the letters 'A' - through 'F' instead of 'a' through 'f' (*note - Nondecimal-numbers::). - -'%%' - Print a single '%'. This does not consume an argument and it - ignores any modifiers. - - NOTE: When using the integer format-control letters for values that - are outside the range of the widest C integer type, 'gawk' switches - to the '%g' format specifier. If '--lint' is provided on the - command line (*note Options::), 'gawk' warns about this. Other - versions of 'awk' may print invalid values or do something else - entirely. (d.c.) - - -File: gawk.info, Node: Format Modifiers, Next: Printf Examples, Prev: Control Letters, Up: Printf - -5.5.3 Modifiers for 'printf' Formats ------------------------------------- - -A format specification can also include "modifiers" that can control how -much of the item's value is printed, as well as how much space it gets. -The modifiers come between the '%' and the format-control letter. We -use the bullet symbol "*" in the following examples to represent spaces -in the output. Here are the possible modifiers, in the order in which -they may appear: - -'N$' - An integer constant followed by a '$' is a "positional specifier". - Normally, format specifications are applied to arguments in the - order given in the format string. With a positional specifier, the - format specification is applied to a specific argument, instead of - what would be the next argument in the list. Positional specifiers - begin counting with one. Thus: - - printf "%s %s\n", "don't", "panic" - printf "%2$s %1$s\n", "panic", "don't" - - prints the famous friendly message twice. - - At first glance, this feature doesn't seem to be of much use. It - is in fact a 'gawk' extension, intended for use in translating - messages at runtime. *Note Printf Ordering::, which describes how - and why to use positional specifiers. For now, we ignore them. - -'-' (Minus) - The minus sign, used before the width modifier (see later on in - this list), says to left-justify the argument within its specified - width. Normally, the argument is printed right-justified in the - specified width. Thus: - - printf "%-4s", "foo" - - prints 'foo*'. - -SPACE - For numeric conversions, prefix positive values with a space and - negative values with a minus sign. - -'+' - The plus sign, used before the width modifier (see later on in this - list), says to always supply a sign for numeric conversions, even - if the data to format is positive. The '+' overrides the space - modifier. - -'#' - Use an "alternative form" for certain control letters. For '%o', - supply a leading zero. For '%x' and '%X', supply a leading '0x' or - '0X' for a nonzero result. For '%e', '%E', '%f', and '%F', the - result always contains a decimal point. For '%g' and '%G', - trailing zeros are not removed from the result. - -'0' - A leading '0' (zero) acts as a flag indicating that output should - be padded with zeros instead of spaces. This applies only to the - numeric output formats. This flag only has an effect when the - field width is wider than the value to print. - -''' - A single quote or apostrophe character is a POSIX extension to ISO - C. It indicates that the integer part of a floating-point value, or - the entire part of an integer decimal value, should have a - thousands-separator character in it. This only works in locales - that support such characters. For example: - - $ cat thousands.awk Show source program - -| BEGIN { printf "%'d\n", 1234567 } - $ LC_ALL=C gawk -f thousands.awk - -| 1234567 Results in "C" locale - $ LC_ALL=en_US.UTF-8 gawk -f thousands.awk - -| 1,234,567 Results in US English UTF locale - - For more information about locales and internationalization issues, - see *note Locales::. - - NOTE: The ''' flag is a nice feature, but its use complicates - things: it becomes difficult to use it in command-line - programs. For information on appropriate quoting tricks, see - *note Quoting::. - -WIDTH - This is a number specifying the desired minimum width of a field. - Inserting any number between the '%' sign and the format-control - character forces the field to expand to this width. The default - way to do this is to pad with spaces on the left. For example: - - printf "%4s", "foo" - - prints '*foo'. - - The value of WIDTH is a minimum width, not a maximum. If the item - value requires more than WIDTH characters, it can be as wide as - necessary. Thus, the following: - - printf "%4s", "foobar" - - prints 'foobar'. - - Preceding the WIDTH with a minus sign causes the output to be - padded with spaces on the right, instead of on the left. - -'.PREC' - A period followed by an integer constant specifies the precision to - use when printing. The meaning of the precision varies by control - letter: - - '%d', '%i', '%o', '%u', '%x', '%X' - Minimum number of digits to print. - - '%e', '%E', '%f', '%F' - Number of digits to the right of the decimal point. - - '%g', '%G' - Maximum number of significant digits. - - '%s' - Maximum number of characters from the string that should - print. - - Thus, the following: - - printf "%.4s", "foobar" - - prints 'foob'. - - The C library 'printf''s dynamic WIDTH and PREC capability (e.g., -'"%*.*s"') is supported. Instead of supplying explicit WIDTH and/or -PREC values in the format string, they are passed in the argument list. -For example: - - w = 5 - p = 3 - s = "abcdefg" - printf "%*.*s\n", w, p, s - -is exactly equivalent to: - - s = "abcdefg" - printf "%5.3s\n", s - -Both programs output '**abc'. Earlier versions of 'awk' did not support -this capability. If you must use such a version, you may simulate this -feature by using concatenation to build up the format string, like so: - - w = 5 - p = 3 - s = "abcdefg" - printf "%" w "." p "s\n", s - -This is not particularly easy to read, but it does work. - - C programmers may be used to supplying additional modifiers ('h', -'j', 'l', 'L', 't', and 'z') in 'printf' format strings. These are not -valid in 'awk'. Most 'awk' implementations silently ignore them. If -'--lint' is provided on the command line (*note Options::), 'gawk' warns -about their use. If '--posix' is supplied, their use is a fatal error. - - -File: gawk.info, Node: Printf Examples, Prev: Format Modifiers, Up: Printf - -5.5.4 Examples Using 'printf' ------------------------------ - -The following simple example shows how to use 'printf' to make an -aligned table: - - awk '{ printf "%-10s %s\n", $1, $2 }' mail-list - -This command prints the names of the people ('$1') in the file -'mail-list' as a string of 10 characters that are left-justified. It -also prints the phone numbers ('$2') next on the line. This produces an -aligned two-column table of names and phone numbers, as shown here: - - $ awk '{ printf "%-10s %s\n", $1, $2 }' mail-list - -| Amelia 555-5553 - -| Anthony 555-3412 - -| Becky 555-7685 - -| Bill 555-1675 - -| Broderick 555-0542 - -| Camilla 555-2912 - -| Fabius 555-1234 - -| Julie 555-6699 - -| Martin 555-6480 - -| Samuel 555-3430 - -| Jean-Paul 555-2127 - - In this case, the phone numbers had to be printed as strings because -the numbers are separated by dashes. Printing the phone numbers as -numbers would have produced just the first three digits: '555'. This -would have been pretty confusing. - - It wasn't necessary to specify a width for the phone numbers because -they are last on their lines. They don't need to have spaces after -them. - - The table could be made to look even nicer by adding headings to the -tops of the columns. This is done using a 'BEGIN' rule (*note -BEGIN/END::) so that the headers are only printed once, at the beginning -of the 'awk' program: - - awk 'BEGIN { print "Name Number" - print "---- ------" } - { printf "%-10s %s\n", $1, $2 }' mail-list - - The preceding example mixes 'print' and 'printf' statements in the -same program. Using just 'printf' statements can produce the same -results: - - awk 'BEGIN { printf "%-10s %s\n", "Name", "Number" - printf "%-10s %s\n", "----", "------" } - { printf "%-10s %s\n", $1, $2 }' mail-list - -Printing each column heading with the same format specification used for -the column elements ensures that the headings are aligned just like the -columns. - - The fact that the same format specification is used three times can -be emphasized by storing it in a variable, like this: - - awk 'BEGIN { format = "%-10s %s\n" - printf format, "Name", "Number" - printf format, "----", "------" } - { printf format, $1, $2 }' mail-list - - -File: gawk.info, Node: Redirection, Next: Special FD, Prev: Printf, Up: Printing - -5.6 Redirecting Output of 'print' and 'printf' -============================================== - -So far, the output from 'print' and 'printf' has gone to the standard -output, usually the screen. Both 'print' and 'printf' can also send -their output to other places. This is called "redirection". - - NOTE: When '--sandbox' is specified (*note Options::), redirecting - output to files, pipes, and coprocesses is disabled. - - A redirection appears after the 'print' or 'printf' statement. -Redirections in 'awk' are written just like redirections in shell -commands, except that they are written inside the 'awk' program. - - There are four forms of output redirection: output to a file, output -appended to a file, output through a pipe to another command, and output -to a coprocess. We show them all for the 'print' statement, but they -work identically for 'printf': - -'print ITEMS > OUTPUT-FILE' - This redirection prints the items into the output file named - OUTPUT-FILE. The file name OUTPUT-FILE can be any expression. Its - value is changed to a string and then used as a file name (*note - Expressions::). - - When this type of redirection is used, the OUTPUT-FILE is erased - before the first output is written to it. Subsequent writes to the - same OUTPUT-FILE do not erase OUTPUT-FILE, but append to it. (This - is different from how you use redirections in shell scripts.) If - OUTPUT-FILE does not exist, it is created. For example, here is - how an 'awk' program can write a list of peoples' names to one file - named 'name-list', and a list of phone numbers to another file - named 'phone-list': - - $ awk '{ print $2 > "phone-list" - > print $1 > "name-list" }' mail-list - $ cat phone-list - -| 555-5553 - -| 555-3412 - ... - $ cat name-list - -| Amelia - -| Anthony - ... - - Each output file contains one name or number per line. - -'print ITEMS >> OUTPUT-FILE' - This redirection prints the items into the preexisting output file - named OUTPUT-FILE. The difference between this and the single-'>' - redirection is that the old contents (if any) of OUTPUT-FILE are - not erased. Instead, the 'awk' output is appended to the file. If - OUTPUT-FILE does not exist, then it is created. - -'print ITEMS | COMMAND' - It is possible to send output to another program through a pipe - instead of into a file. This redirection opens a pipe to COMMAND, - and writes the values of ITEMS through this pipe to another process - created to execute COMMAND. - - The redirection argument COMMAND is actually an 'awk' expression. - Its value is converted to a string whose contents give the shell - command to be run. For example, the following produces two files, - one unsorted list of peoples' names, and one list sorted in reverse - alphabetical order: - - awk '{ print $1 > "names.unsorted" - command = "sort -r > names.sorted" - print $1 | command }' mail-list - - The unsorted list is written with an ordinary redirection, while - the sorted list is written by piping through the 'sort' utility. - - The next example uses redirection to mail a message to the mailing - list 'bug-system'. This might be useful when trouble is - encountered in an 'awk' script run periodically for system - maintenance: - - report = "mail bug-system" - print("Awk script failed:", $0) | report - print("at record number", FNR, "of", FILENAME) | report - close(report) - - The 'close()' function is called here because it's a good idea to - close the pipe as soon as all the intended output has been sent to - it. *Note Close Files And Pipes:: for more information. - - This example also illustrates the use of a variable to represent a - FILE or COMMAND--it is not necessary to always use a string - constant. Using a variable is generally a good idea, because (if - you mean to refer to that same file or command) 'awk' requires that - the string value be written identically every time. - -'print ITEMS |& COMMAND' - This redirection prints the items to the input of COMMAND. The - difference between this and the single-'|' redirection is that the - output from COMMAND can be read with 'getline'. Thus, COMMAND is a - "coprocess", which works together with but is subsidiary to the - 'awk' program. - - This feature is a 'gawk' extension, and is not available in POSIX - 'awk'. *Note Getline/Coprocess::, for a brief discussion. *Note - Two-way I/O::, for a more complete discussion. - - Redirecting output using '>', '>>', '|', or '|&' asks the system to -open a file, pipe, or coprocess only if the particular FILE or COMMAND -you specify has not already been written to by your program or if it has -been closed since it was last written to. - - It is a common error to use '>' redirection for the first 'print' to -a file, and then to use '>>' for subsequent output: - - # clear the file - print "Don't panic" > "guide.txt" - ... - # append - print "Avoid improbability generators" >> "guide.txt" - -This is indeed how redirections must be used from the shell. But in -'awk', it isn't necessary. In this kind of case, a program should use -'>' for all the 'print' statements, because the output file is only -opened once. (It happens that if you mix '>' and '>>' output is -produced in the expected order. However, mixing the operators for the -same file is definitely poor style, and is confusing to readers of your -program.) - - Many older 'awk' implementations limit the number of pipelines that -an 'awk' program may have open to just one! In 'gawk', there is no such -limit. 'gawk' allows a program to open as many pipelines as the -underlying operating system permits. - - Piping into 'sh' - - A particularly powerful way to use redirection is to build command -lines and pipe them into the shell, 'sh'. For example, suppose you have -a list of files brought over from a system where all the file names are -stored in uppercase, and you wish to rename them to have names in all -lowercase. The following program is both simple and efficient: - - { printf("mv %s %s\n", $0, tolower($0)) | "sh" } - - END { close("sh") } - - The 'tolower()' function returns its argument string with all -uppercase characters converted to lowercase (*note String Functions::). -The program builds up a list of command lines, using the 'mv' utility to -rename the files. It then sends the list to the shell for execution. - - *Note Shell Quoting:: for a function that can help in generating -command lines to be fed to the shell. - - -File: gawk.info, Node: Special FD, Next: Special Files, Prev: Redirection, Up: Printing - -5.7 Special Files for Standard Preopened Data Streams -===================================================== - -Running programs conventionally have three input and output streams -already available to them for reading and writing. These are known as -the "standard input", "standard output", and "standard error output". -These open streams (and any other open files or pipes) are often -referred to by the technical term "file descriptors". - - These streams are, by default, connected to your keyboard and screen, -but they are often redirected with the shell, via the '<', '<<', '>', -'>>', '>&', and '|' operators. Standard error is typically used for -writing error messages; the reason there are two separate streams, -standard output and standard error, is so that they can be redirected -separately. - - In traditional implementations of 'awk', the only way to write an -error message to standard error in an 'awk' program is as follows: - - print "Serious error detected!" | "cat 1>&2" - -This works by opening a pipeline to a shell command that can access the -standard error stream that it inherits from the 'awk' process. This is -far from elegant, and it also requires a separate process. So people -writing 'awk' programs often don't do this. Instead, they send the -error messages to the screen, like this: - - print "Serious error detected!" > "/dev/tty" - -('/dev/tty' is a special file supplied by the operating system that is -connected to your keyboard and screen. It represents the "terminal,"(1) -which on modern systems is a keyboard and screen, not a serial console.) -This generally has the same effect, but not always: although the -standard error stream is usually the screen, it can be redirected; when -that happens, writing to the screen is not correct. In fact, if 'awk' -is run from a background job, it may not have a terminal at all. Then -opening '/dev/tty' fails. - - 'gawk', BWK 'awk', and 'mawk' provide special file names for -accessing the three standard streams. If the file name matches one of -these special names when 'gawk' (or one of the others) redirects input -or output, then it directly uses the descriptor that the file name -stands for. These special file names work for all operating systems -that 'gawk' has been ported to, not just those that are POSIX-compliant: - -'/dev/stdin' - The standard input (file descriptor 0). - -'/dev/stdout' - The standard output (file descriptor 1). - -'/dev/stderr' - The standard error output (file descriptor 2). - - With these facilities, the proper way to write an error message then -becomes: - - print "Serious error detected!" > "/dev/stderr" - - Note the use of quotes around the file name. Like with any other -redirection, the value must be a string. It is a common error to omit -the quotes, which leads to confusing results. - - 'gawk' does not treat these file names as special when in -POSIX-compatibility mode. However, because BWK 'awk' supports them, -'gawk' does support them even when invoked with the '--traditional' -option (*note Options::). - - ---------- Footnotes ---------- - - (1) The "tty" in '/dev/tty' stands for "Teletype," a serial terminal. - - -File: gawk.info, Node: Special Files, Next: Close Files And Pipes, Prev: Special FD, Up: Printing - -5.8 Special File names in 'gawk' -================================ - -Besides access to standard input, standard output, and standard error, -'gawk' provides access to any open file descriptor. Additionally, there -are special file names reserved for TCP/IP networking. - -* Menu: - -* Other Inherited Files:: Accessing other open files with - 'gawk'. -* Special Network:: Special files for network communications. -* Special Caveats:: Things to watch out for. - - -File: gawk.info, Node: Other Inherited Files, Next: Special Network, Up: Special Files - -5.8.1 Accessing Other Open Files with 'gawk' --------------------------------------------- - -Besides the '/dev/stdin', '/dev/stdout', and '/dev/stderr' special file -names mentioned earlier, 'gawk' provides syntax for accessing any other -inherited open file: - -'/dev/fd/N' - The file associated with file descriptor N. Such a file must be - opened by the program initiating the 'awk' execution (typically the - shell). Unless special pains are taken in the shell from which - 'gawk' is invoked, only descriptors 0, 1, and 2 are available. - - The file names '/dev/stdin', '/dev/stdout', and '/dev/stderr' are -essentially aliases for '/dev/fd/0', '/dev/fd/1', and '/dev/fd/2', -respectively. However, those names are more self-explanatory. - - Note that using 'close()' on a file name of the form '"/dev/fd/N"', -for file descriptor numbers above two, does actually close the given -file descriptor. - - -File: gawk.info, Node: Special Network, Next: Special Caveats, Prev: Other Inherited Files, Up: Special Files - -5.8.2 Special Files for Network Communications ----------------------------------------------- - -'gawk' programs can open a two-way TCP/IP connection, acting as either a -client or a server. This is done using a special file name of the form: - - /NET-TYPE/PROTOCOL/LOCAL-PORT/REMOTE-HOST/REMOTE-PORT - - The NET-TYPE is one of 'inet', 'inet4', or 'inet6'. The PROTOCOL is -one of 'tcp' or 'udp', and the other fields represent the other -essential pieces of information for making a networking connection. -These file names are used with the '|&' operator for communicating with -a coprocess (*note Two-way I/O::). This is an advanced feature, -mentioned here only for completeness. Full discussion is delayed until -*note TCP/IP Networking::. - - -File: gawk.info, Node: Special Caveats, Prev: Special Network, Up: Special Files - -5.8.3 Special File name Caveats -------------------------------- - -Here are some things to bear in mind when using the special file names -that 'gawk' provides: - - * Recognition of the file names for the three standard preopened - files is disabled only in POSIX mode. - - * Recognition of the other special file names is disabled if 'gawk' - is in compatibility mode (either '--traditional' or '--posix'; - *note Options::). - - * 'gawk' _always_ interprets these special file names. For example, - using '/dev/fd/4' for output actually writes on file descriptor 4, - and not on a new file descriptor that is 'dup()'ed from file - descriptor 4. Most of the time this does not matter; however, it - is important to _not_ close any of the files related to file - descriptors 0, 1, and 2. Doing so results in unpredictable - behavior. - - -File: gawk.info, Node: Close Files And Pipes, Next: Nonfatal, Prev: Special Files, Up: Printing - -5.9 Closing Input and Output Redirections -========================================= - -If the same file name or the same shell command is used with 'getline' -more than once during the execution of an 'awk' program (*note -Getline::), the file is opened (or the command is executed) the first -time only. At that time, the first record of input is read from that -file or command. The next time the same file or command is used with -'getline', another record is read from it, and so on. - - Similarly, when a file or pipe is opened for output, 'awk' remembers -the file name or command associated with it, and subsequent writes to -the same file or command are appended to the previous writes. The file -or pipe stays open until 'awk' exits. - - This implies that special steps are necessary in order to read the -same file again from the beginning, or to rerun a shell command (rather -than reading more output from the same command). The 'close()' function -makes these things possible: - - close(FILENAME) - -or: - - close(COMMAND) - - The argument FILENAME or COMMAND can be any expression. Its value -must _exactly_ match the string that was used to open the file or start -the command (spaces and other "irrelevant" characters included). For -example, if you open a pipe with this: - - "sort -r names" | getline foo - -then you must close it with this: - - close("sort -r names") - - Once this function call is executed, the next 'getline' from that -file or command, or the next 'print' or 'printf' to that file or -command, reopens the file or reruns the command. Because the expression -that you use to close a file or pipeline must exactly match the -expression used to open the file or run the command, it is good practice -to use a variable to store the file name or command. The previous -example becomes the following: - - sortcom = "sort -r names" - sortcom | getline foo - ... - close(sortcom) - -This helps avoid hard-to-find typographical errors in your 'awk' -programs. Here are some of the reasons for closing an output file: - - * To write a file and read it back later on in the same 'awk' - program. Close the file after writing it, then begin reading it - with 'getline'. - - * To write numerous files, successively, in the same 'awk' program. - If the files aren't closed, eventually 'awk' may exceed a system - limit on the number of open files in one process. It is best to - close each one when the program has finished writing it. - - * To make a command finish. When output is redirected through a - pipe, the command reading the pipe normally continues to try to - read input as long as the pipe is open. Often this means the - command cannot really do its work until the pipe is closed. For - example, if output is redirected to the 'mail' program, the message - is not actually sent until the pipe is closed. - - * To run the same program a second time, with the same arguments. - This is not the same thing as giving more input to the first run! - - For example, suppose a program pipes output to the 'mail' program. - If it outputs several lines redirected to this pipe without closing - it, they make a single message of several lines. By contrast, if - the program closes the pipe after each line of output, then each - line makes a separate message. - - If you use more files than the system allows you to have open, 'gawk' -attempts to multiplex the available open files among your data files. -'gawk''s ability to do this depends upon the facilities of your -operating system, so it may not always work. It is therefore both good -practice and good portability advice to always use 'close()' on your -files when you are done with them. In fact, if you are using a lot of -pipes, it is essential that you close commands when done. For example, -consider something like this: - - { - ... - command = ("grep " $1 " /some/file | my_prog -q " $3) - while ((command | getline) > 0) { - PROCESS OUTPUT OF command - } - # need close(command) here - } - - This example creates a new pipeline based on data in _each_ record. -Without the call to 'close()' indicated in the comment, 'awk' creates -child processes to run the commands, until it eventually runs out of -file descriptors for more pipelines. - - Even though each command has finished (as indicated by the -end-of-file return status from 'getline'), the child process is not -terminated;(1) more importantly, the file descriptor for the pipe is not -closed and released until 'close()' is called or 'awk' exits. - - 'close()' silently does nothing if given an argument that does not -represent a file, pipe, or coprocess that was opened with a redirection. -In such a case, it returns a negative value, indicating an error. In -addition, 'gawk' sets 'ERRNO' to a string indicating the error. - - Note also that 'close(FILENAME)' has no "magic" effects on the -implicit loop that reads through the files named on the command line. -It is, more likely, a close of a file that was never opened with a -redirection, so 'awk' silently does nothing, except return a negative -value. - - When using the '|&' operator to communicate with a coprocess, it is -occasionally useful to be able to close one end of the two-way pipe -without closing the other. This is done by supplying a second argument -to 'close()'. As in any other call to 'close()', the first argument is -the name of the command or special file used to start the coprocess. -The second argument should be a string, with either of the values '"to"' -or '"from"'. Case does not matter. As this is an advanced feature, -discussion is delayed until *note Two-way I/O::, which describes it in -more detail and gives an example. - - Using 'close()''s Return Value - - In many older versions of Unix 'awk', the 'close()' function is -actually a statement. (d.c.) It is a syntax error to try and use the -return value from 'close()': - - command = "..." - command | getline info - retval = close(command) # syntax error in many Unix awks - - 'gawk' treats 'close()' as a function. The return value is -1 if the -argument names something that was never opened with a redirection, or if -there is a system problem closing the file or process. In these cases, -'gawk' sets the predefined variable 'ERRNO' to a string describing the -problem. - - In 'gawk', starting with version 4.2, when closing a pipe or -coprocess (input or output), the return value is the exit status of the -command, as described in *note Table 5.1: -table-close-pipe-return-values.(2) Otherwise, it is the return value -from the system's 'close()' or 'fclose()' C functions when closing input -or output files, respectively. This value is zero if the close -succeeds, or -1 if it fails. - -Situation Return value from 'close()' --------------------------------------------------------------------------- -Normal exit of command Command's exit status -Death by signal of command 256 + number of murderous signal -Death by signal of command 512 + number of murderous signal -with core dump -Some kind of error -1 - -Table 5.1: Return values from 'close()' of a pipe - - The POSIX standard is very vague; it says that 'close()' returns zero -on success and a nonzero value otherwise. In general, different -implementations vary in what they report when closing pipes; thus, the -return value cannot be used portably. (d.c.) In POSIX mode (*note -Options::), 'gawk' just returns zero when closing a pipe. - - ---------- Footnotes ---------- - - (1) The technical terminology is rather morbid. The finished child -is called a "zombie," and cleaning up after it is referred to as -"reaping." - - (2) Prior to version 4.2, the return value from closing a pipe or -co-process was the full 16-bit exit value as defined by the 'wait()' -system call. - - -File: gawk.info, Node: Nonfatal, Next: Output Summary, Prev: Close Files And Pipes, Up: Printing - -5.10 Enabling Nonfatal Output -============================= - -This minor node describes a 'gawk'-specific feature. - - In standard 'awk', output with 'print' or 'printf' to a nonexistent -file, or some other I/O error (such as filling up the disk) is a fatal -error. - - $ gawk 'BEGIN { print "hi" > "/no/such/file" }' - error-> gawk: cmd. line:1: fatal: can't redirect to `/no/such/file' (No such file or directory) - - 'gawk' makes it possible to detect that an error has occurred, -allowing you to possibly recover from the error, or at least print an -error message of your choosing before exiting. You can do this in one -of two ways: - - * For all output files, by assigning any value to - 'PROCINFO["NONFATAL"]'. - - * On a per-file basis, by assigning any value to 'PROCINFO[FILENAME, - "NONFATAL"]'. Here, FILENAME is the name of the file to which you - wish output to be nonfatal. - - Once you have enabled nonfatal output, you must check 'ERRNO' after -every relevant 'print' or 'printf' statement to see if something went -wrong. It is also a good idea to initialize 'ERRNO' to zero before -attempting the output. For example: - - $ gawk ' - > BEGIN { - > PROCINFO["NONFATAL"] = 1 - > ERRNO = 0 - > print "hi" > "/no/such/file" - > if (ERRNO) { - > print("Output failed:", ERRNO) > "/dev/stderr" - > exit 1 - > } - > }' - error-> Output failed: No such file or directory - - Here, 'gawk' did not produce a fatal error; instead it let the 'awk' -program code detect the problem and handle it. - - This mechanism works also for standard output and standard error. -For standard output, you may use 'PROCINFO["-", "NONFATAL"]' or -'PROCINFO["/dev/stdout", "NONFATAL"]'. For standard error, use -'PROCINFO["/dev/stderr", "NONFATAL"]'. - - When attempting to open a TCP/IP socket (*note TCP/IP Networking::), -'gawk' tries multiple times. The 'GAWK_SOCK_RETRIES' environment -variable (*note Other Environment Variables::) allows you to override -'gawk''s builtin default number of attempts. However, once nonfatal I/O -is enabled for a given socket, 'gawk' only retries once, relying on -'awk'-level code to notice that there was a problem. - - -File: gawk.info, Node: Output Summary, Next: Output Exercises, Prev: Nonfatal, Up: Printing - -5.11 Summary -============ - - * The 'print' statement prints comma-separated expressions. Each - expression is separated by the value of 'OFS' and terminated by the - value of 'ORS'. 'OFMT' provides the conversion format for numeric - values for the 'print' statement. - - * The 'printf' statement provides finer-grained control over output, - with format-control letters for different data types and various - flags that modify the behavior of the format-control letters. - - * Output from both 'print' and 'printf' may be redirected to files, - pipes, and coprocesses. - - * 'gawk' provides special file names for access to standard input, - output, and error, and for network communications. - - * Use 'close()' to close open file, pipe, and coprocess redirections. - For coprocesses, it is possible to close only one direction of the - communications. - - * Normally errors with 'print' or 'printf' are fatal. 'gawk' lets - you make output errors be nonfatal either for all files or on a - per-file basis. You must then check for errors after every - relevant output statement. - - -File: gawk.info, Node: Output Exercises, Prev: Output Summary, Up: Printing - -5.12 Exercises -============== - - 1. Rewrite the program: - - awk 'BEGIN { print "Month Crates" - print "----- ------" } - { print $1, " ", $2 }' inventory-shipped - - from *note Output Separators::, by using a new value of 'OFS'. - - 2. Use the 'printf' statement to line up the headings and table data - for the 'inventory-shipped' example that was covered in *note - Print::. - - 3. What happens if you forget the double quotes when redirecting - output, as follows: - - BEGIN { print "Serious error detected!" > /dev/stderr } - - -File: gawk.info, Node: Expressions, Next: Patterns and Actions, Prev: Printing, Up: Top - -6 Expressions -************* - -Expressions are the basic building blocks of 'awk' patterns and actions. -An expression evaluates to a value that you can print, test, or pass to -a function. Additionally, an expression can assign a new value to a -variable or a field by using an assignment operator. - - An expression can serve as a pattern or action statement on its own. -Most other kinds of statements contain one or more expressions that -specify the data on which to operate. As in other languages, -expressions in 'awk' can include variables, array references, constants, -and function calls, as well as combinations of these with various -operators. - -* Menu: - -* Values:: Constants, Variables, and Regular Expressions. -* All Operators:: 'gawk''s operators. -* Truth Values and Conditions:: Testing for true and false. -* Function Calls:: A function call is an expression. -* Precedence:: How various operators nest. -* Locales:: How the locale affects things. -* Expressions Summary:: Expressions summary. - - -File: gawk.info, Node: Values, Next: All Operators, Up: Expressions - -6.1 Constants, Variables, and Conversions -========================================= - -Expressions are built up from values and the operations performed upon -them. This minor node describes the elementary objects that provide the -values used in expressions. - -* Menu: - -* Constants:: String, numeric and regexp constants. -* Using Constant Regexps:: When and how to use a regexp constant. -* Variables:: Variables give names to values for later use. -* Conversion:: The conversion of strings to numbers and vice - versa. - - -File: gawk.info, Node: Constants, Next: Using Constant Regexps, Up: Values - -6.1.1 Constant Expressions --------------------------- - -The simplest type of expression is the "constant", which always has the -same value. There are three types of constants: numeric, string, and -regular expression. - - Each is used in the appropriate context when you need a data value -that isn't going to change. Numeric constants can have different forms, -but are internally stored in an identical manner. - -* Menu: - -* Scalar Constants:: Numeric and string constants. -* Nondecimal-numbers:: What are octal and hex numbers. -* Regexp Constants:: Regular Expression constants. - - -File: gawk.info, Node: Scalar Constants, Next: Nondecimal-numbers, Up: Constants - -6.1.1.1 Numeric and String Constants -.................................... - -A "numeric constant" stands for a number. This number can be an -integer, a decimal fraction, or a number in scientific (exponential) -notation.(1) Here are some examples of numeric constants that all have -the same value: - - 105 - 1.05e+2 - 1050e-1 - - A "string constant" consists of a sequence of characters enclosed in -double quotation marks. For example: - - "parrot" - -represents the string whose contents are 'parrot'. Strings in 'gawk' -can be of any length, and they can contain any of the possible eight-bit -ASCII characters, including ASCII NUL (character code zero). Other -'awk' implementations may have difficulty with some character codes. - - ---------- Footnotes ---------- - - (1) The internal representation of all numbers, including integers, -uses double-precision floating-point numbers. On most modern systems, -these are in IEEE 754 standard format. *Note Arbitrary Precision -Arithmetic::, for much more information. - - -File: gawk.info, Node: Nondecimal-numbers, Next: Regexp Constants, Prev: Scalar Constants, Up: Constants - -6.1.1.2 Octal and Hexadecimal Numbers -..................................... - -In 'awk', all numbers are in decimal (i.e., base 10). Many other -programming languages allow you to specify numbers in other bases, often -octal (base 8) and hexadecimal (base 16). In octal, the numbers go 0, -1, 2, 3, 4, 5, 6, 7, 10, 11, 12, and so on. Just as '11' in decimal is -1 times 10 plus 1, so '11' in octal is 1 times 8 plus 1. This equals 9 -in decimal. In hexadecimal, there are 16 digits. Because the everyday -decimal number system only has ten digits ('0'-'9'), the letters 'a' -through 'f' are used to represent the rest. (Case in the letters is -usually irrelevant; hexadecimal 'a' and 'A' have the same value.) Thus, -'11' in hexadecimal is 1 times 16 plus 1, which equals 17 in decimal. - - Just by looking at plain '11', you can't tell what base it's in. So, -in C, C++, and other languages derived from C, there is a special -notation to signify the base. Octal numbers start with a leading '0', -and hexadecimal numbers start with a leading '0x' or '0X': - -'11' - Decimal value 11 - -'011' - Octal 11, decimal value 9 - -'0x11' - Hexadecimal 11, decimal value 17 - - This example shows the difference: - - $ gawk 'BEGIN { printf "%d, %d, %d\n", 011, 11, 0x11 }' - -| 9, 11, 17 - - Being able to use octal and hexadecimal constants in your programs is -most useful when working with data that cannot be represented -conveniently as characters or as regular numbers, such as binary data of -various sorts. - - 'gawk' allows the use of octal and hexadecimal constants in your -program text. However, such numbers in the input data are not treated -differently; doing so by default would break old programs. (If you -really need to do this, use the '--non-decimal-data' command-line -option; *note Nondecimal Data::.) If you have octal or hexadecimal -data, you can use the 'strtonum()' function (*note String Functions::) -to convert the data into a number. Most of the time, you will want to -use octal or hexadecimal constants when working with the built-in -bit-manipulation functions; see *note Bitwise Functions:: for more -information. - - Unlike in some early C implementations, '8' and '9' are not valid in -octal constants. For example, 'gawk' treats '018' as decimal 18: - - $ gawk 'BEGIN { print "021 is", 021 ; print 018 }' - -| 021 is 17 - -| 18 - - Octal and hexadecimal source code constants are a 'gawk' extension. -If 'gawk' is in compatibility mode (*note Options::), they are not -available. - - A Constant's Base Does Not Affect Its Value - - Once a numeric constant has been converted internally into a number, -'gawk' no longer remembers what the original form of the constant was; -the internal value is always used. This has particular consequences for -conversion of numbers to strings: - - $ gawk 'BEGIN { printf "0x11 is <%s>\n", 0x11 }' - -| 0x11 is <17> - - -File: gawk.info, Node: Regexp Constants, Prev: Nondecimal-numbers, Up: Constants - -6.1.1.3 Regular Expression Constants -.................................... - -A "regexp constant" is a regular expression description enclosed in -slashes, such as '/^beginning and end$/'. Most regexps used in 'awk' -programs are constant, but the '~' and '!~' matching operators can also -match computed or dynamic regexps (which are typically just ordinary -strings or variables that contain a regexp, but could be more complex -expressions). - - -File: gawk.info, Node: Using Constant Regexps, Next: Variables, Prev: Constants, Up: Values - -6.1.2 Using Regular Expression Constants ----------------------------------------- - -When used on the righthand side of the '~' or '!~' operators, a regexp -constant merely stands for the regexp that is to be matched. However, -regexp constants (such as '/foo/') may be used like simple expressions. -When a regexp constant appears by itself, it has the same meaning as if -it appeared in a pattern (i.e., '($0 ~ /foo/)'). (d.c.) *Note -Expression Patterns::. This means that the following two code segments: - - if ($0 ~ /barfly/ || $0 ~ /camelot/) - print "found" - -and: - - if (/barfly/ || /camelot/) - print "found" - -are exactly equivalent. One rather bizarre consequence of this rule is -that the following Boolean expression is valid, but does not do what its -author probably intended: - - # Note that /foo/ is on the left of the ~ - if (/foo/ ~ $1) print "found foo" - -This code is "obviously" testing '$1' for a match against the regexp -'/foo/'. But in fact, the expression '/foo/ ~ $1' really means '($0 ~ -/foo/) ~ $1'. In other words, first match the input record against the -regexp '/foo/'. The result is either zero or one, depending upon the -success or failure of the match. That result is then matched against -the first field in the record. Because it is unlikely that you would -ever really want to make this kind of test, 'gawk' issues a warning when -it sees this construct in a program. Another consequence of this rule -is that the assignment statement: - - matches = /foo/ - -assigns either zero or one to the variable 'matches', depending upon the -contents of the current input record. - - Constant regular expressions are also used as the first argument for -the 'gensub()', 'sub()', and 'gsub()' functions, as the second argument -of the 'match()' function, and as the third argument of the 'split()' -and 'patsplit()' functions (*note String Functions::). Modern -implementations of 'awk', including 'gawk', allow the third argument of -'split()' to be a regexp constant, but some older implementations do -not. (d.c.) Because some built-in functions accept regexp constants as -arguments, confusion can arise when attempting to use regexp constants -as arguments to user-defined functions (*note User-defined::). For -example: - - function mysub(pat, repl, str, global) - { - if (global) - gsub(pat, repl, str) - else - sub(pat, repl, str) - return str - } - - { - ... - text = "hi! hi yourself!" - mysub(/hi/, "howdy", text, 1) - ... - } - - In this example, the programmer wants to pass a regexp constant to -the user-defined function 'mysub()', which in turn passes it on to -either 'sub()' or 'gsub()'. However, what really happens is that the -'pat' parameter is assigned a value of either one or zero, depending -upon whether or not '$0' matches '/hi/'. 'gawk' issues a warning when -it sees a regexp constant used as a parameter to a user-defined -function, because passing a truth value in this way is probably not what -was intended. - - -File: gawk.info, Node: Variables, Next: Conversion, Prev: Using Constant Regexps, Up: Values - -6.1.3 Variables ---------------- - -"Variables" are ways of storing values at one point in your program for -use later in another part of your program. They can be manipulated -entirely within the program text, and they can also be assigned values -on the 'awk' command line. - -* Menu: - -* Using Variables:: Using variables in your programs. -* Assignment Options:: Setting variables on the command line and a - summary of command-line syntax. This is an - advanced method of input. - - -File: gawk.info, Node: Using Variables, Next: Assignment Options, Up: Variables - -6.1.3.1 Using Variables in a Program -.................................... - -Variables let you give names to values and refer to them later. -Variables have already been used in many of the examples. The name of a -variable must be a sequence of letters, digits, or underscores, and it -may not begin with a digit. Here, a "letter" is any one of the 52 -upper- and lowercase English letters. Other characters that may be -defined as letters in non-English locales are not valid in variable -names. Case is significant in variable names; 'a' and 'A' are distinct -variables. - - A variable name is a valid expression by itself; it represents the -variable's current value. Variables are given new values with -"assignment operators", "increment operators", and "decrement operators" -(*note Assignment Ops::). In addition, the 'sub()' and 'gsub()' -functions can change a variable's value, and the 'match()', 'split()', -and 'patsplit()' functions can change the contents of their array -parameters (*note String Functions::). - - A few variables have special built-in meanings, such as 'FS' (the -field separator) and 'NF' (the number of fields in the current input -record). *Note Built-in Variables:: for a list of the predefined -variables. These predefined variables can be used and assigned just -like all other variables, but their values are also used or changed -automatically by 'awk'. All predefined variables' names are entirely -uppercase. - - Variables in 'awk' can be assigned either numeric or string values. -The kind of value a variable holds can change over the life of a -program. By default, variables are initialized to the empty string, -which is zero if converted to a number. There is no need to explicitly -initialize a variable in 'awk', which is what you would do in C and in -most other traditional languages. - - -File: gawk.info, Node: Assignment Options, Prev: Using Variables, Up: Variables - -6.1.3.2 Assigning Variables on the Command Line -............................................... - -Any 'awk' variable can be set by including a "variable assignment" among -the arguments on the command line when 'awk' is invoked (*note Other -Arguments::). Such an assignment has the following form: - - VARIABLE=TEXT - -With it, a variable is set either at the beginning of the 'awk' run or -in between input files. When the assignment is preceded with the '-v' -option, as in the following: - - -v VARIABLE=TEXT - -the variable is set at the very beginning, even before the 'BEGIN' rules -execute. The '-v' option and its assignment must precede all the file -name arguments, as well as the program text. (*Note Options:: for more -information about the '-v' option.) Otherwise, the variable assignment -is performed at a time determined by its position among the input file -arguments--after the processing of the preceding input file argument. -For example: - - awk '{ print $n }' n=4 inventory-shipped n=2 mail-list - -prints the value of field number 'n' for all input records. Before the -first file is read, the command line sets the variable 'n' equal to -four. This causes the fourth field to be printed in lines from -'inventory-shipped'. After the first file has finished, but before the -second file is started, 'n' is set to two, so that the second field is -printed in lines from 'mail-list': - - $ awk '{ print $n }' n=4 inventory-shipped n=2 mail-list - -| 15 - -| 24 - ... - -| 555-5553 - -| 555-3412 - ... - - Command-line arguments are made available for explicit examination by -the 'awk' program in the 'ARGV' array (*note ARGC and ARGV::). 'awk' -processes the values of command-line assignments for escape sequences -(*note Escape Sequences::). (d.c.) - - -File: gawk.info, Node: Conversion, Prev: Variables, Up: Values - -6.1.4 Conversion of Strings and Numbers ---------------------------------------- - -Number-to-string and string-to-number conversion are generally -straightforward. There can be subtleties to be aware of; this minor -node discusses this important facet of 'awk'. - -* Menu: - -* Strings And Numbers:: How 'awk' Converts Between Strings And - Numbers. -* Locale influences conversions:: How the locale may affect conversions. - - -File: gawk.info, Node: Strings And Numbers, Next: Locale influences conversions, Up: Conversion - -6.1.4.1 How 'awk' Converts Between Strings and Numbers -...................................................... - -Strings are converted to numbers and numbers are converted to strings, -if the context of the 'awk' program demands it. For example, if the -value of either 'foo' or 'bar' in the expression 'foo + bar' happens to -be a string, it is converted to a number before the addition is -performed. If numeric values appear in string concatenation, they are -converted to strings. Consider the following: - - two = 2; three = 3 - print (two three) + 4 - -This prints the (numeric) value 27. The numeric values of the variables -'two' and 'three' are converted to strings and concatenated together. -The resulting string is converted back to the number 23, to which 4 is -then added. - - If, for some reason, you need to force a number to be converted to a -string, concatenate that number with the empty string, '""'. To force a -string to be converted to a number, add zero to that string. A string -is converted to a number by interpreting any numeric prefix of the -string as numerals: '"2.5"' converts to 2.5, '"1e3"' converts to 1,000, -and '"25fix"' has a numeric value of 25. Strings that can't be -interpreted as valid numbers convert to zero. - - The exact manner in which numbers are converted into strings is -controlled by the 'awk' predefined variable 'CONVFMT' (*note Built-in -Variables::). Numbers are converted using the 'sprintf()' function with -'CONVFMT' as the format specifier (*note String Functions::). - - 'CONVFMT''s default value is '"%.6g"', which creates a value with at -most six significant digits. For some applications, you might want to -change it to specify more precision. On most modern machines, 17 digits -is usually enough to capture a floating-point number's value exactly.(1) - - Strange results can occur if you set 'CONVFMT' to a string that -doesn't tell 'sprintf()' how to format floating-point numbers in a -useful way. For example, if you forget the '%' in the format, 'awk' -converts all numbers to the same constant string. - - As a special case, if a number is an integer, then the result of -converting it to a string is _always_ an integer, no matter what the -value of 'CONVFMT' may be. Given the following code fragment: - - CONVFMT = "%2.2f" - a = 12 - b = a "" - -'b' has the value '"12"', not '"12.00"'. (d.c.) - - Pre-POSIX 'awk' Used 'OFMT' for String Conversion - - Prior to the POSIX standard, 'awk' used the value of 'OFMT' for -converting numbers to strings. 'OFMT' specifies the output format to -use when printing numbers with 'print'. 'CONVFMT' was introduced in -order to separate the semantics of conversion from the semantics of -printing. Both 'CONVFMT' and 'OFMT' have the same default value: -'"%.6g"'. In the vast majority of cases, old 'awk' programs do not -change their behavior. *Note Print:: for more information on the -'print' statement. - - ---------- Footnotes ---------- - - (1) Pathological cases can require up to 752 digits (!), but we doubt -that you need to worry about this. - - -File: gawk.info, Node: Locale influences conversions, Prev: Strings And Numbers, Up: Conversion - -6.1.4.2 Locales Can Influence Conversion -........................................ - -Where you are can matter when it comes to converting between numbers and -strings. The local character set and language--the "locale"--can affect -numeric formats. In particular, for 'awk' programs, it affects the -decimal point character and the thousands-separator character. The -'"C"' locale, and most English-language locales, use the period -character ('.') as the decimal point and don't have a thousands -separator. However, many (if not most) European and non-English locales -use the comma (',') as the decimal point character. European locales -often use either a space or a period as the thousands separator, if they -have one. - - The POSIX standard says that 'awk' always uses the period as the -decimal point when reading the 'awk' program source code, and for -command-line variable assignments (*note Other Arguments::). However, -when interpreting input data, for 'print' and 'printf' output, and for -number-to-string conversion, the local decimal point character is used. -(d.c.) In all cases, numbers in source code and in input data cannot -have a thousands separator. Here are some examples indicating the -difference in behavior, on a GNU/Linux system: - - $ export POSIXLY_CORRECT=1 Force POSIX behavior - $ gawk 'BEGIN { printf "%g\n", 3.1415927 }' - -| 3.14159 - $ LC_ALL=en_DK.utf-8 gawk 'BEGIN { printf "%g\n", 3.1415927 }' - -| 3,14159 - $ echo 4,321 | gawk '{ print $1 + 1 }' - -| 5 - $ echo 4,321 | LC_ALL=en_DK.utf-8 gawk '{ print $1 + 1 }' - -| 5,321 - -The 'en_DK.utf-8' locale is for English in Denmark, where the comma acts -as the decimal point separator. In the normal '"C"' locale, 'gawk' -treats '4,321' as 4, while in the Danish locale, it's treated as the -full number including the fractional part, 4.321. - - Some earlier versions of 'gawk' fully complied with this aspect of -the standard. However, many users in non-English locales complained -about this behavior, because their data used a period as the decimal -point, so the default behavior was restored to use a period as the -decimal point character. You can use the '--use-lc-numeric' option -(*note Options::) to force 'gawk' to use the locale's decimal point -character. ('gawk' also uses the locale's decimal point character when -in POSIX mode, either via '--posix' or the 'POSIXLY_CORRECT' environment -variable, as shown previously.) - - *note Table 6.1: table-locale-affects. describes the cases in which -the locale's decimal point character is used and when a period is used. -Some of these features have not been described yet. - -Feature Default '--posix' or - '--use-lc-numeric' ------------------------------------------------------------- -'%'g' Use locale Use locale -'%g' Use period Use locale -Input Use period Use locale -'strtonum()'Use period Use locale - -Table 6.1: Locale decimal point versus a period - - Finally, modern-day formal standards and the IEEE standard -floating-point representation can have an unusual but important effect -on the way 'gawk' converts some special string values to numbers. The -details are presented in *note POSIX Floating Point Problems::. - - -File: gawk.info, Node: All Operators, Next: Truth Values and Conditions, Prev: Values, Up: Expressions - -6.2 Operators: Doing Something with Values -========================================== - -This minor node introduces the "operators" that make use of the values -provided by constants and variables. - -* Menu: - -* Arithmetic Ops:: Arithmetic operations ('+', '-', - etc.) -* Concatenation:: Concatenating strings. -* Assignment Ops:: Changing the value of a variable or a field. -* Increment Ops:: Incrementing the numeric value of a variable. - - -File: gawk.info, Node: Arithmetic Ops, Next: Concatenation, Up: All Operators - -6.2.1 Arithmetic Operators --------------------------- - -The 'awk' language uses the common arithmetic operators when evaluating -expressions. All of these arithmetic operators follow normal precedence -rules and work as you would expect them to. - - The following example uses a file named 'grades', which contains a -list of student names as well as three test scores per student (it's a -small class): - - Pat 100 97 58 - Sandy 84 72 93 - Chris 72 92 89 - -This program takes the file 'grades' and prints the average of the -scores: - - $ awk '{ sum = $2 + $3 + $4 ; avg = sum / 3 - > print $1, avg }' grades - -| Pat 85 - -| Sandy 83 - -| Chris 84.3333 - - The following list provides the arithmetic operators in 'awk', in -order from the highest precedence to the lowest: - -'X ^ Y' -'X ** Y' - Exponentiation; X raised to the Y power. '2 ^ 3' has the value - eight; the character sequence '**' is equivalent to '^'. (c.e.) - -'- X' - Negation. - -'+ X' - Unary plus; the expression is converted to a number. - -'X * Y' - Multiplication. - -'X / Y' - Division; because all numbers in 'awk' are floating-point numbers, - the result is _not_ rounded to an integer--'3 / 4' has the value - 0.75. (It is a common mistake, especially for C programmers, to - forget that _all_ numbers in 'awk' are floating point, and that - division of integer-looking constants produces a real number, not - an integer.) - -'X % Y' - Remainder; further discussion is provided in the text, just after - this list. - -'X + Y' - Addition. - -'X - Y' - Subtraction. - - Unary plus and minus have the same precedence, the multiplication -operators all have the same precedence, and addition and subtraction -have the same precedence. - - When computing the remainder of 'X % Y', the quotient is rounded -toward zero to an integer and multiplied by Y. This result is -subtracted from X; this operation is sometimes known as "trunc-mod." -The following relation always holds: - - b * int(a / b) + (a % b) == a - - One possibly undesirable effect of this definition of remainder is -that 'X % Y' is negative if X is negative. Thus: - - -17 % 8 = -1 - - In other 'awk' implementations, the signedness of the remainder may -be machine-dependent. - - NOTE: The POSIX standard only specifies the use of '^' for - exponentiation. For maximum portability, do not use the '**' - operator. - - -File: gawk.info, Node: Concatenation, Next: Assignment Ops, Prev: Arithmetic Ops, Up: All Operators - -6.2.2 String Concatenation --------------------------- - - It seemed like a good idea at the time. - -- _Brian Kernighan_ - - There is only one string operation: concatenation. It does not have -a specific operator to represent it. Instead, concatenation is -performed by writing expressions next to one another, with no operator. -For example: - - $ awk '{ print "Field number one: " $1 }' mail-list - -| Field number one: Amelia - -| Field number one: Anthony - ... - - Without the space in the string constant after the ':', the line runs -together. For example: - - $ awk '{ print "Field number one:" $1 }' mail-list - -| Field number one:Amelia - -| Field number one:Anthony - ... - - Because string concatenation does not have an explicit operator, it -is often necessary to ensure that it happens at the right time by using -parentheses to enclose the items to concatenate. For example, you might -expect that the following code fragment concatenates 'file' and 'name': - - file = "file" - name = "name" - print "something meaningful" > file name - -This produces a syntax error with some versions of Unix 'awk'.(1) It is -necessary to use the following: - - print "something meaningful" > (file name) - - Parentheses should be used around concatenation in all but the most -common contexts, such as on the righthand side of '='. Be careful about -the kinds of expressions used in string concatenation. In particular, -the order of evaluation of expressions used for concatenation is -undefined in the 'awk' language. Consider this example: - - BEGIN { - a = "don't" - print (a " " (a = "panic")) - } - -It is not defined whether the second assignment to 'a' happens before or -after the value of 'a' is retrieved for producing the concatenated -value. The result could be either 'don't panic', or 'panic panic'. - - The precedence of concatenation, when mixed with other operators, is -often counter-intuitive. Consider this example: - - $ awk 'BEGIN { print -12 " " -24 }' - -| -12-24 - - This "obviously" is concatenating -12, a space, and -24. But where -did the space disappear to? The answer lies in the combination of -operator precedences and 'awk''s automatic conversion rules. To get the -desired result, write the program this way: - - $ awk 'BEGIN { print -12 " " (-24) }' - -| -12 -24 - - This forces 'awk' to treat the '-' on the '-24' as unary. Otherwise, -it's parsed as follows: - - -12 ('" "' - 24) - => -12 (0 - 24) - => -12 (-24) - => -12-24 - - As mentioned earlier, when mixing concatenation with other operators, -_parenthesize_. Otherwise, you're never quite sure what you'll get. - - ---------- Footnotes ---------- - - (1) It happens that BWK 'awk', 'gawk', and 'mawk' all "get it right," -but you should not rely on this. - - -File: gawk.info, Node: Assignment Ops, Next: Increment Ops, Prev: Concatenation, Up: All Operators - -6.2.3 Assignment Expressions ----------------------------- - -An "assignment" is an expression that stores a (usually different) value -into a variable. For example, let's assign the value one to the -variable 'z': - - z = 1 - - After this expression is executed, the variable 'z' has the value -one. Whatever old value 'z' had before the assignment is forgotten. - - Assignments can also store string values. For example, the following -stores the value '"this food is good"' in the variable 'message': - - thing = "food" - predicate = "good" - message = "this " thing " is " predicate - -This also illustrates string concatenation. The '=' sign is called an -"assignment operator". It is the simplest assignment operator because -the value of the righthand operand is stored unchanged. Most operators -(addition, concatenation, and so on) have no effect except to compute a -value. If the value isn't used, there's no reason to use the operator. -An assignment operator is different; it does produce a value, but even -if you ignore it, the assignment still makes itself felt through the -alteration of the variable. We call this a "side effect". - - The lefthand operand of an assignment need not be a variable (*note -Variables::); it can also be a field (*note Changing Fields::) or an -array element (*note Arrays::). These are all called "lvalues", which -means they can appear on the lefthand side of an assignment operator. -The righthand operand may be any expression; it produces the new value -that the assignment stores in the specified variable, field, or array -element. (Such values are called "rvalues".) - - It is important to note that variables do _not_ have permanent types. -A variable's type is simply the type of whatever value was last assigned -to it. In the following program fragment, the variable 'foo' has a -numeric value at first, and a string value later on: - - foo = 1 - print foo - foo = "bar" - print foo - -When the second assignment gives 'foo' a string value, the fact that it -previously had a numeric value is forgotten. - - String values that do not begin with a digit have a numeric value of -zero. After executing the following code, the value of 'foo' is five: - - foo = "a string" - foo = foo + 5 - - NOTE: Using a variable as a number and then later as a string can - be confusing and is poor programming style. The previous two - examples illustrate how 'awk' works, _not_ how you should write - your programs! - - An assignment is an expression, so it has a value--the same value -that is assigned. Thus, 'z = 1' is an expression with the value one. -One consequence of this is that you can write multiple assignments -together, such as: - - x = y = z = 5 - -This example stores the value five in all three variables ('x', 'y', and -'z'). It does so because the value of 'z = 5', which is five, is stored -into 'y' and then the value of 'y = z = 5', which is five, is stored -into 'x'. - - Assignments may be used anywhere an expression is called for. For -example, it is valid to write 'x != (y = 1)' to set 'y' to one, and then -test whether 'x' equals one. But this style tends to make programs hard -to read; such nesting of assignments should be avoided, except perhaps -in a one-shot program. - - Aside from '=', there are several other assignment operators that do -arithmetic with the old value of the variable. For example, the -operator '+=' computes a new value by adding the righthand value to the -old value of the variable. Thus, the following assignment adds five to -the value of 'foo': - - foo += 5 - -This is equivalent to the following: - - foo = foo + 5 - -Use whichever makes the meaning of your program clearer. - - There are situations where using '+=' (or any assignment operator) is -_not_ the same as simply repeating the lefthand operand in the righthand -expression. For example: - - # Thanks to Pat Rankin for this example - BEGIN { - foo[rand()] += 5 - for (x in foo) - print x, foo[x] - - bar[rand()] = bar[rand()] + 5 - for (x in bar) - print x, bar[x] - } - -The indices of 'bar' are practically guaranteed to be different, because -'rand()' returns different values each time it is called. (Arrays and -the 'rand()' function haven't been covered yet. *Note Arrays::, and -*note Numeric Functions:: for more information.) This example -illustrates an important fact about assignment operators: the lefthand -expression is only evaluated _once_. - - It is up to the implementation as to which expression is evaluated -first, the lefthand or the righthand. Consider this example: - - i = 1 - a[i += 2] = i + 1 - -The value of 'a[3]' could be either two or four. - - *note Table 6.2: table-assign-ops. lists the arithmetic assignment -operators. In each case, the righthand operand is an expression whose -value is converted to a number. - -Operator Effect --------------------------------------------------------------------------- -LVALUE '+=' Add INCREMENT to the value of LVALUE. -INCREMENT -LVALUE '-=' Subtract DECREMENT from the value of LVALUE. -DECREMENT -LVALUE '*=' Multiply the value of LVALUE by COEFFICIENT. -COEFFICIENT -LVALUE '/=' DIVISOR Divide the value of LVALUE by DIVISOR. -LVALUE '%=' MODULUS Set LVALUE to its remainder by MODULUS. -LVALUE '^=' POWER Raise LVALUE to the power POWER. -LVALUE '**=' POWER Raise LVALUE to the power POWER. (c.e.) - -Table 6.2: Arithmetic assignment operators - - NOTE: Only the '^=' operator is specified by POSIX. For maximum - portability, do not use the '**=' operator. - - Syntactic Ambiguities Between '/=' and Regular Expressions - - There is a syntactic ambiguity between the '/=' assignment operator -and regexp constants whose first character is an '='. (d.c.) This is -most notable in some commercial 'awk' versions. For example: - - $ awk /==/ /dev/null - error-> awk: syntax error at source line 1 - error-> context is - error-> >>> /= <<< - error-> awk: bailing out at source line 1 - -A workaround is: - - awk '/[=]=/' /dev/null - - 'gawk' does not have this problem; BWK 'awk' and 'mawk' also do not. - - -File: gawk.info, Node: Increment Ops, Prev: Assignment Ops, Up: All Operators - -6.2.4 Increment and Decrement Operators ---------------------------------------- - -"Increment" and "decrement operators" increase or decrease the value of -a variable by one. An assignment operator can do the same thing, so the -increment operators add no power to the 'awk' language; however, they -are convenient abbreviations for very common operations. - - The operator used for adding one is written '++'. It can be used to -increment a variable either before or after taking its value. To -"pre-increment" a variable 'v', write '++v'. This adds one to the value -of 'v'--that new value is also the value of the expression. (The -assignment expression 'v += 1' is completely equivalent.) Writing the -'++' after the variable specifies "post-increment". This increments the -variable value just the same; the difference is that the value of the -increment expression itself is the variable's _old_ value. Thus, if -'foo' has the value four, then the expression 'foo++' has the value -four, but it changes the value of 'foo' to five. In other words, the -operator returns the old value of the variable, but with the side effect -of incrementing it. - - The post-increment 'foo++' is nearly the same as writing '(foo += 1) -- 1'. It is not perfectly equivalent because all numbers in 'awk' are -floating point--in floating point, 'foo + 1 - 1' does not necessarily -equal 'foo'. But the difference is minute as long as you stick to -numbers that are fairly small (less than 10e12). - - Fields and array elements are incremented just like variables. (Use -'$(i++)' when you want to do a field reference and a variable increment -at the same time. The parentheses are necessary because of the -precedence of the field reference operator '$'.) - - The decrement operator '--' works just like '++', except that it -subtracts one instead of adding it. As with '++', it can be used before -the lvalue to pre-decrement or after it to post-decrement. Following is -a summary of increment and decrement expressions: - -'++LVALUE' - Increment LVALUE, returning the new value as the value of the - expression. - -'LVALUE++' - Increment LVALUE, returning the _old_ value of LVALUE as the value - of the expression. - -'--LVALUE' - Decrement LVALUE, returning the new value as the value of the - expression. (This expression is like '++LVALUE', but instead of - adding, it subtracts.) - -'LVALUE--' - Decrement LVALUE, returning the _old_ value of LVALUE as the value - of the expression. (This expression is like 'LVALUE++', but - instead of adding, it subtracts.) - - Operator Evaluation Order - - Doctor, it hurts when I do this! - Then don't do that! - -- _Groucho Marx_ - -What happens for something like the following? - - b = 6 - print b += b++ - -Or something even stranger? - - b = 6 - b += ++b + b++ - print b - - In other words, when do the various side effects prescribed by the -postfix operators ('b++') take effect? When side effects happen is -"implementation-defined". In other words, it is up to the particular -version of 'awk'. The result for the first example may be 12 or 13, and -for the second, it may be 22 or 23. - - In short, doing things like this is not recommended and definitely -not anything that you can rely upon for portability. You should avoid -such things in your own programs. - - -File: gawk.info, Node: Truth Values and Conditions, Next: Function Calls, Prev: All Operators, Up: Expressions - -6.3 Truth Values and Conditions -=============================== - -In certain contexts, expression values also serve as "truth values"; -i.e., they determine what should happen next as the program runs. This -minor node describes how 'awk' defines "true" and "false" and how values -are compared. - -* Menu: - -* Truth Values:: What is "true" and what is "false". -* Typing and Comparison:: How variables acquire types and how this - affects comparison of numbers and strings with - '<', etc. -* Boolean Ops:: Combining comparison expressions using boolean - operators '||' ("or"), '&&' - ("and") and '!' ("not"). -* Conditional Exp:: Conditional expressions select between two - subexpressions under control of a third - subexpression. - - -File: gawk.info, Node: Truth Values, Next: Typing and Comparison, Up: Truth Values and Conditions - -6.3.1 True and False in 'awk' ------------------------------ - -Many programming languages have a special representation for the -concepts of "true" and "false." Such languages usually use the special -constants 'true' and 'false', or perhaps their uppercase equivalents. -However, 'awk' is different. It borrows a very simple concept of true -and false from C. In 'awk', any nonzero numeric value _or_ any nonempty -string value is true. Any other value (zero or the null string, '""') -is false. The following program prints 'A strange truth value' three -times: - - BEGIN { - if (3.1415927) - print "A strange truth value" - if ("Four Score And Seven Years Ago") - print "A strange truth value" - if (j = 57) - print "A strange truth value" - } - - There is a surprising consequence of the "nonzero or non-null" rule: -the string constant '"0"' is actually true, because it is non-null. -(d.c.) - - -File: gawk.info, Node: Typing and Comparison, Next: Boolean Ops, Prev: Truth Values, Up: Truth Values and Conditions - -6.3.2 Variable Typing and Comparison Expressions ------------------------------------------------- - - The Guide is definitive. Reality is frequently inaccurate. - -- _Douglas Adams, 'The Hitchhiker's Guide to the Galaxy'_ - - Unlike in other programming languages, in 'awk' variables do not have -a fixed type. Instead, they can be either a number or a string, -depending upon the value that is assigned to them. We look now at how -variables are typed, and how 'awk' compares variables. - -* Menu: - -* Variable Typing:: String type versus numeric type. -* Comparison Operators:: The comparison operators. -* POSIX String Comparison:: String comparison with POSIX rules. - - -File: gawk.info, Node: Variable Typing, Next: Comparison Operators, Up: Typing and Comparison - -6.3.2.1 String Type versus Numeric Type -....................................... - -The POSIX standard introduced the concept of a "numeric string", which -is simply a string that looks like a number--for example, '" +2"'. This -concept is used for determining the type of a variable. The type of the -variable is important because the types of two variables determine how -they are compared. Variable typing follows these rules: - - * A numeric constant or the result of a numeric operation has the - "numeric" attribute. - - * A string constant or the result of a string operation has the - "string" attribute. - - * Fields, 'getline' input, 'FILENAME', 'ARGV' elements, 'ENVIRON' - elements, and the elements of an array created by 'match()', - 'split()', and 'patsplit()' that are numeric strings have the - "strnum" attribute. Otherwise, they have the "string" attribute. - Uninitialized variables also have the "strnum" attribute. - - * Attributes propagate across assignments but are not changed by any - use. - - The last rule is particularly important. In the following program, -'a' has numeric type, even though it is later used in a string -operation: - - BEGIN { - a = 12.345 - b = a " is a cute number" - print b - } - - When two operands are compared, either string comparison or numeric -comparison may be used. This depends upon the attributes of the -operands, according to the following symmetric matrix: - - +------------------------------- - | STRING NUMERIC STRNUM - -----+------------------------------- - | - STRING | string string string - | - NUMERIC | string numeric numeric - | - STRNUM | string numeric numeric - -----+------------------------------- - - The basic idea is that user input that looks numeric--and _only_ user -input--should be treated as numeric, even though it is actually made of -characters and is therefore also a string. Thus, for example, the -string constant '" +3.14"', when it appears in program source code, is a -string--even though it looks numeric--and is _never_ treated as a number -for comparison purposes. - - In short, when one operand is a "pure" string, such as a string -constant, then a string comparison is performed. Otherwise, a numeric -comparison is performed. - - This point bears additional emphasis: All user input is made of -characters, and so is first and foremost of string type; input strings -that look numeric are additionally given the strnum attribute. Thus, -the six-character input string ' +3.14' receives the strnum attribute. -In contrast, the eight characters '" +3.14"' appearing in program text -comprise a string constant. The following examples print '1' when the -comparison between the two different constants is true, and '0' -otherwise: - - $ echo ' +3.14' | awk '{ print($0 == " +3.14") }' True - -| 1 - $ echo ' +3.14' | awk '{ print($0 == "+3.14") }' False - -| 0 - $ echo ' +3.14' | awk '{ print($0 == "3.14") }' False - -| 0 - $ echo ' +3.14' | awk '{ print($0 == 3.14) }' True - -| 1 - $ echo ' +3.14' | awk '{ print($1 == " +3.14") }' False - -| 0 - $ echo ' +3.14' | awk '{ print($1 == "+3.14") }' True - -| 1 - $ echo ' +3.14' | awk '{ print($1 == "3.14") }' False - -| 0 - $ echo ' +3.14' | awk '{ print($1 == 3.14) }' True - -| 1 - - -File: gawk.info, Node: Comparison Operators, Next: POSIX String Comparison, Prev: Variable Typing, Up: Typing and Comparison - -6.3.2.2 Comparison Operators -............................ - -"Comparison expressions" compare strings or numbers for relationships -such as equality. They are written using "relational operators", which -are a superset of those in C. *note Table 6.3: table-relational-ops. -describes them. - -Expression Result --------------------------------------------------------------------------- -X '<' Y True if X is less than Y -X '<=' Y True if X is less than or equal to Y -X '>' Y True if X is greater than Y -X '>=' Y True if X is greater than or equal to Y -X '==' Y True if X is equal to Y -X '!=' Y True if X is not equal to Y -X '~' Y True if the string X matches the regexp denoted by Y -X '!~' Y True if the string X does not match the regexp - denoted by Y -SUBSCRIPT 'in' True if the array ARRAY has an element with the -ARRAY subscript SUBSCRIPT - -Table 6.3: Relational operators - - Comparison expressions have the value one if true and zero if false. -When comparing operands of mixed types, numeric operands are converted -to strings using the value of 'CONVFMT' (*note Conversion::). - - Strings are compared by comparing the first character of each, then -the second character of each, and so on. Thus, '"10"' is less than -'"9"'. If there are two strings where one is a prefix of the other, the -shorter string is less than the longer one. Thus, '"abc"' is less than -'"abcd"'. - - It is very easy to accidentally mistype the '==' operator and leave -off one of the '=' characters. The result is still valid 'awk' code, -but the program does not do what is intended: - - if (a = b) # oops! should be a == b - ... - else - ... - -Unless 'b' happens to be zero or the null string, the 'if' part of the -test always succeeds. Because the operators are so similar, this kind -of error is very difficult to spot when scanning the source code. - - The following list of expressions illustrates the kinds of -comparisons 'awk' performs, as well as what the result of each -comparison is: - -'1.5 <= 2.0' - Numeric comparison (true) - -'"abc" >= "xyz"' - String comparison (false) - -'1.5 != " +2"' - String comparison (true) - -'"1e2" < "3"' - String comparison (true) - -'a = 2; b = "2"' -'a == b' - String comparison (true) - -'a = 2; b = " +2"' -'a == b' - String comparison (false) - - In this example: - - $ echo 1e2 3 | awk '{ print ($1 < $2) ? "true" : "false" }' - -| false - -the result is 'false' because both '$1' and '$2' are user input. They -are numeric strings--therefore both have the strnum attribute, dictating -a numeric comparison. The purpose of the comparison rules and the use -of numeric strings is to attempt to produce the behavior that is "least -surprising," while still "doing the right thing." - - String comparisons and regular expression comparisons are very -different. For example: - - x == "foo" - -has the value one, or is true if the variable 'x' is precisely 'foo'. -By contrast: - - x ~ /foo/ - -has the value one if 'x' contains 'foo', such as '"Oh, what a fool am -I!"'. - - The righthand operand of the '~' and '!~' operators may be either a -regexp constant ('/'...'/') or an ordinary expression. In the latter -case, the value of the expression as a string is used as a dynamic -regexp (*note Regexp Usage::; also *note Computed Regexps::). - - A constant regular expression in slashes by itself is also an -expression. '/REGEXP/' is an abbreviation for the following comparison -expression: - - $0 ~ /REGEXP/ - - One special place where '/foo/' is _not_ an abbreviation for '$0 ~ -/foo/' is when it is the righthand operand of '~' or '!~'. *Note Using -Constant Regexps::, where this is discussed in more detail. - - -File: gawk.info, Node: POSIX String Comparison, Prev: Comparison Operators, Up: Typing and Comparison - -6.3.2.3 String Comparison Based on Locale Collating Order -......................................................... - -The POSIX standard used to say that all string comparisons are performed -based on the locale's "collating order". This is the order in which -characters sort, as defined by the locale (for more discussion, *note -Locales::). This order is usually very different from the results -obtained when doing straight byte-by-byte comparison.(1) - - Because this behavior differs considerably from existing practice, -'gawk' only implemented it when in POSIX mode (*note Options::). Here -is an example to illustrate the difference, in an 'en_US.UTF-8' locale: - - $ gawk 'BEGIN { printf("ABC < abc = %s\n", - > ("ABC" < "abc" ? "TRUE" : "FALSE")) }' - -| ABC < abc = TRUE - $ gawk --posix 'BEGIN { printf("ABC < abc = %s\n", - > ("ABC" < "abc" ? "TRUE" : "FALSE")) }' - -| ABC < abc = FALSE - - Fortunately, as of August 2016, comparison based on locale collating -order is no longer required for the '==' and '!=' operators.(2) -However, comparison based on locales is still required for '<', '<=', -'>', and '>='. POSIX thus recommends as follows: - - Since the '==' operator checks whether strings are identical, not - whether they collate equally, applications needing to check whether - strings collate equally can use: - - a <= b && a >= b - - As of version 4.2, 'gawk' continues to use locale collating order for -'<', '<=', '>', and '>=' only in POSIX mode. - - ---------- Footnotes ---------- - - (1) Technically, string comparison is supposed to behave the same way -as if the strings were compared with the C 'strcoll()' function. - - (2) See the Austin Group website -(http://austingroupbugs.net/view.php?id=1070). - - -File: gawk.info, Node: Boolean Ops, Next: Conditional Exp, Prev: Typing and Comparison, Up: Truth Values and Conditions - -6.3.3 Boolean Expressions -------------------------- - -A "Boolean expression" is a combination of comparison expressions or -matching expressions, using the Boolean operators "or" ('||'), "and" -('&&'), and "not" ('!'), along with parentheses to control nesting. The -truth value of the Boolean expression is computed by combining the truth -values of the component expressions. Boolean expressions are also -referred to as "logical expressions". The terms are equivalent. - - Boolean expressions can be used wherever comparison and matching -expressions can be used. They can be used in 'if', 'while', 'do', and -'for' statements (*note Statements::). They have numeric values (one if -true, zero if false) that come into play if the result of the Boolean -expression is stored in a variable or used in arithmetic. - - In addition, every Boolean expression is also a valid pattern, so you -can use one as a pattern to control the execution of rules. The Boolean -operators are: - -'BOOLEAN1 && BOOLEAN2' - True if both BOOLEAN1 and BOOLEAN2 are true. For example, the - following statement prints the current input record if it contains - both 'edu' and 'li': - - if ($0 ~ /edu/ && $0 ~ /li/) print - - The subexpression BOOLEAN2 is evaluated only if BOOLEAN1 is true. - This can make a difference when BOOLEAN2 contains expressions that - have side effects. In the case of '$0 ~ /foo/ && ($2 == bar++)', - the variable 'bar' is not incremented if there is no substring - 'foo' in the record. - -'BOOLEAN1 || BOOLEAN2' - True if at least one of BOOLEAN1 or BOOLEAN2 is true. For example, - the following statement prints all records in the input that - contain _either_ 'edu' or 'li': - - if ($0 ~ /edu/ || $0 ~ /li/) print - - The subexpression BOOLEAN2 is evaluated only if BOOLEAN1 is false. - This can make a difference when BOOLEAN2 contains expressions that - have side effects. (Thus, this test never really distinguishes - records that contain both 'edu' and 'li'--as soon as 'edu' is - matched, the full test succeeds.) - -'! BOOLEAN' - True if BOOLEAN is false. For example, the following program - prints 'no home!' in the unusual event that the 'HOME' environment - variable is not defined: - - BEGIN { if (! ("HOME" in ENVIRON)) - print "no home!" } - - (The 'in' operator is described in *note Reference to Elements::.) - - The '&&' and '||' operators are called "short-circuit" operators -because of the way they work. Evaluation of the full expression is -"short-circuited" if the result can be determined partway through its -evaluation. - - Statements that end with '&&' or '||' can be continued simply by -putting a newline after them. But you cannot put a newline in front of -either of these operators without using backslash continuation (*note -Statements/Lines::). - - The actual value of an expression using the '!' operator is either -one or zero, depending upon the truth value of the expression it is -applied to. The '!' operator is often useful for changing the sense of -a flag variable from false to true and back again. For example, the -following program is one way to print lines in between special -bracketing lines: - - $1 == "START" { interested = ! interested; next } - interested { print } - $1 == "END" { interested = ! interested; next } - -The variable 'interested', as with all 'awk' variables, starts out -initialized to zero, which is also false. When a line is seen whose -first field is 'START', the value of 'interested' is toggled to true, -using '!'. The next rule prints lines as long as 'interested' is true. -When a line is seen whose first field is 'END', 'interested' is toggled -back to false.(1) - - Most commonly, the '!' operator is used in the conditions of 'if' and -'while' statements, where it often makes more sense to phrase the logic -in the negative: - - if (! SOME CONDITION || SOME OTHER CONDITION) { - ... DO WHATEVER PROCESSING ... - } - - NOTE: The 'next' statement is discussed in *note Next Statement::. - 'next' tells 'awk' to skip the rest of the rules, get the next - record, and start processing the rules over again at the top. The - reason it's there is to avoid printing the bracketing 'START' and - 'END' lines. - - ---------- Footnotes ---------- - - (1) This program has a bug; it prints lines starting with 'END'. How -would you fix it? - - -File: gawk.info, Node: Conditional Exp, Prev: Boolean Ops, Up: Truth Values and Conditions - -6.3.4 Conditional Expressions ------------------------------ - -A "conditional expression" is a special kind of expression that has -three operands. It allows you to use one expression's value to select -one of two other expressions. The conditional expression in 'awk' is -the same as in the C language, as shown here: - - SELECTOR ? IF-TRUE-EXP : IF-FALSE-EXP - -There are three subexpressions. The first, SELECTOR, is always computed -first. If it is "true" (not zero or not null), then IF-TRUE-EXP is -computed next, and its value becomes the value of the whole expression. -Otherwise, IF-FALSE-EXP is computed next, and its value becomes the -value of the whole expression. For example, the following expression -produces the absolute value of 'x': - - x >= 0 ? x : -x - - Each time the conditional expression is computed, only one of -IF-TRUE-EXP and IF-FALSE-EXP is used; the other is ignored. This is -important when the expressions have side effects. For example, this -conditional expression examines element 'i' of either array 'a' or array -'b', and increments 'i': - - x == y ? a[i++] : b[i++] - -This is guaranteed to increment 'i' exactly once, because each time only -one of the two increment expressions is executed and the other is not. -*Note Arrays::, for more information about arrays. - - As a minor 'gawk' extension, a statement that uses '?:' can be -continued simply by putting a newline after either character. However, -putting a newline in front of either character does not work without -using backslash continuation (*note Statements/Lines::). If '--posix' -is specified (*note Options::), this extension is disabled. - - -File: gawk.info, Node: Function Calls, Next: Precedence, Prev: Truth Values and Conditions, Up: Expressions - -6.4 Function Calls -================== - -A "function" is a name for a particular calculation. This enables you -to ask for it by name at any point in the program. For example, the -function 'sqrt()' computes the square root of a number. - - A fixed set of functions are "built in", which means they are -available in every 'awk' program. The 'sqrt()' function is one of -these. *Note Built-in:: for a list of built-in functions and their -descriptions. In addition, you can define functions for use in your -program. *Note User-defined:: for instructions on how to do this. -Finally, 'gawk' lets you write functions in C or C++ that may be called -from your program (*note Dynamic Extensions::). - - The way to use a function is with a "function call" expression, which -consists of the function name followed immediately by a list of -"arguments" in parentheses. The arguments are expressions that provide -the raw materials for the function's calculations. When there is more -than one argument, they are separated by commas. If there are no -arguments, just write '()' after the function name. The following -examples show function calls with and without arguments: - - sqrt(x^2 + y^2) one argument - atan2(y, x) two arguments - rand() no arguments - - CAUTION: Do not put any space between the function name and the - opening parenthesis! A user-defined function name looks just like - the name of a variable--a space would make the expression look like - concatenation of a variable with an expression inside parentheses. - With built-in functions, space before the parenthesis is harmless, - but it is best not to get into the habit of using space to avoid - mistakes with user-defined functions. - - Each function expects a particular number of arguments. For example, -the 'sqrt()' function must be called with a single argument, the number -of which to take the square root: - - sqrt(ARGUMENT) - - Some of the built-in functions have one or more optional arguments. -If those arguments are not supplied, the functions use a reasonable -default value. *Note Built-in:: for full details. If arguments are -omitted in calls to user-defined functions, then those arguments are -treated as local variables. Such local variables act like the empty -string if referenced where a string value is required, and like zero if -referenced where a numeric value is required (*note User-defined::). - - As an advanced feature, 'gawk' provides indirect function calls, -which is a way to choose the function to call at runtime, instead of -when you write the source code to your program. We defer discussion of -this feature until later; see *note Indirect Calls::. - - Like every other expression, the function call has a value, often -called the "return value", which is computed by the function based on -the arguments you give it. In this example, the return value of -'sqrt(ARGUMENT)' is the square root of ARGUMENT. The following program -reads numbers, one number per line, and prints the square root of each -one: - - $ awk '{ print "The square root of", $1, "is", sqrt($1) }' - 1 - -| The square root of 1 is 1 - 3 - -| The square root of 3 is 1.73205 - 5 - -| The square root of 5 is 2.23607 - Ctrl-d - - A function can also have side effects, such as assigning values to -certain variables or doing I/O. This program shows how the 'match()' -function (*note String Functions::) changes the variables 'RSTART' and -'RLENGTH': - - { - if (match($1, $2)) - print RSTART, RLENGTH - else - print "no match" - } - -Here is a sample run: - - $ awk -f matchit.awk - aaccdd c+ - -| 3 2 - foo bar - -| no match - abcdefg e - -| 5 1 - - -File: gawk.info, Node: Precedence, Next: Locales, Prev: Function Calls, Up: Expressions - -6.5 Operator Precedence (How Operators Nest) -============================================ - -"Operator precedence" determines how operators are grouped when -different operators appear close by in one expression. For example, '*' -has higher precedence than '+'; thus, 'a + b * c' means to multiply 'b' -and 'c', and then add 'a' to the product (i.e., 'a + (b * c)'). - - The normal precedence of the operators can be overruled by using -parentheses. Think of the precedence rules as saying where the -parentheses are assumed to be. In fact, it is wise to always use -parentheses whenever there is an unusual combination of operators, -because other people who read the program may not remember what the -precedence is in this case. Even experienced programmers occasionally -forget the exact rules, which leads to mistakes. Explicit parentheses -help prevent any such mistakes. - - When operators of equal precedence are used together, the leftmost -operator groups first, except for the assignment, conditional, and -exponentiation operators, which group in the opposite order. Thus, 'a - -b + c' groups as '(a - b) + c' and 'a = b = c' groups as 'a = (b = c)'. - - Normally the precedence of prefix unary operators does not matter, -because there is only one way to interpret them: innermost first. Thus, -'$++i' means '$(++i)' and '++$x' means '++($x)'. However, when another -operator follows the operand, then the precedence of the unary operators -can matter. '$x^2' means '($x)^2', but '-x^2' means '-(x^2)', because -'-' has lower precedence than '^', whereas '$' has higher precedence. -Also, operators cannot be combined in a way that violates the precedence -rules; for example, '$$0++--' is not a valid expression because the -first '$' has higher precedence than the '++'; to avoid the problem the -expression can be rewritten as '$($0++)--'. - - This list presents 'awk''s operators, in order of highest to lowest -precedence: - -'('...')' - Grouping. - -'$' - Field reference. - -'++ --' - Increment, decrement. - -'^ **' - Exponentiation. These operators group right to left. - -'+ - !' - Unary plus, minus, logical "not." - -'* / %' - Multiplication, division, remainder. - -'+ -' - Addition, subtraction. - -String concatenation - There is no special symbol for concatenation. The operands are - simply written side by side (*note Concatenation::). - -'< <= == != > >= >> | |&' - Relational and redirection. The relational operators and the - redirections have the same precedence level. Characters such as - '>' serve both as relationals and as redirections; the context - distinguishes between the two meanings. - - Note that the I/O redirection operators in 'print' and 'printf' - statements belong to the statement level, not to expressions. The - redirection does not produce an expression that could be the - operand of another operator. As a result, it does not make sense - to use a redirection operator near another operator of lower - precedence without parentheses. Such combinations (e.g., 'print - foo > a ? b : c') result in syntax errors. The correct way to - write this statement is 'print foo > (a ? b : c)'. - -'~ !~' - Matching, nonmatching. - -'in' - Array membership. - -'&&' - Logical "and." - -'||' - Logical "or." - -'?:' - Conditional. This operator groups right to left. - -'= += -= *= /= %= ^= **=' - Assignment. These operators group right to left. - - NOTE: The '|&', '**', and '**=' operators are not specified by - POSIX. For maximum portability, do not use them. - - -File: gawk.info, Node: Locales, Next: Expressions Summary, Prev: Precedence, Up: Expressions - -6.6 Where You Are Makes a Difference -==================================== - -Modern systems support the notion of "locales": a way to tell the system -about the local character set and language. The ISO C standard defines -a default '"C"' locale, which is an environment that is typical of what -many C programmers are used to. - - Once upon a time, the locale setting used to affect regexp matching, -but this is no longer true (*note Ranges and Locales::). - - Locales can affect record splitting. For the normal case of 'RS = -"\n"', the locale is largely irrelevant. For other single-character -record separators, setting 'LC_ALL=C' in the environment will give you -much better performance when reading records. Otherwise, 'gawk' has to -make several function calls, _per input character_, to find the record -terminator. - - Locales can affect how dates and times are formatted (*note Time -Functions::). For example, a common way to abbreviate the date -September 4, 2015, in the United States is "9/4/15." In many countries -in Europe, however, it is abbreviated "4.9.15." Thus, the '%x' -specification in a '"US"' locale might produce '9/4/15', while in a -'"EUROPE"' locale, it might produce '4.9.15'. - - According to POSIX, string comparison is also affected by locales -(similar to regular expressions). The details are presented in *note -POSIX String Comparison::. - - Finally, the locale affects the value of the decimal point character -used when 'gawk' parses input data. This is discussed in detail in -*note Conversion::. - - -File: gawk.info, Node: Expressions Summary, Prev: Locales, Up: Expressions - -6.7 Summary -=========== - - * Expressions are the basic elements of computation in programs. - They are built from constants, variables, function calls, and - combinations of the various kinds of values with operators. - - * 'awk' supplies three kinds of constants: numeric, string, and - regexp. 'gawk' lets you specify numeric constants in octal and - hexadecimal (bases 8 and 16) as well as decimal (base 10). In - certain contexts, a standalone regexp constant such as '/foo/' has - the same meaning as '$0 ~ /foo/'. - - * Variables hold values between uses in computations. A number of - built-in variables provide information to your 'awk' program, and a - number of others let you control how 'awk' behaves. - - * Numbers are automatically converted to strings, and strings to - numbers, as needed by 'awk'. Numeric values are converted as if - they were formatted with 'sprintf()' using the format in 'CONVFMT'. - Locales can influence the conversions. - - * 'awk' provides the usual arithmetic operators (addition, - subtraction, multiplication, division, modulus), and unary plus and - minus. It also provides comparison operators, Boolean operators, - an array membership testing operator, and regexp matching - operators. String concatenation is accomplished by placing two - expressions next to each other; there is no explicit operator. The - three-operand '?:' operator provides an "if-else" test within - expressions. - - * Assignment operators provide convenient shorthands for common - arithmetic operations. - - * In 'awk', a value is considered to be true if it is nonzero _or_ - non-null. Otherwise, the value is false. - - * A variable's type is set upon each assignment and may change over - its lifetime. The type determines how it behaves in comparisons - (string or numeric). - - * Function calls return a value that may be used as part of a larger - expression. Expressions used to pass parameter values are fully - evaluated before the function is called. 'awk' provides built-in - and user-defined functions; this is described in *note Functions::. - - * Operator precedence specifies the order in which operations are - performed, unless explicitly overridden by parentheses. 'awk''s - operator precedence is compatible with that of C. - - * Locales can affect the format of data as output by an 'awk' - program, and occasionally the format for data read as input. - - -File: gawk.info, Node: Patterns and Actions, Next: Arrays, Prev: Expressions, Up: Top - -7 Patterns, Actions, and Variables -********************************** - -As you have already seen, each 'awk' statement consists of a pattern -with an associated action. This major node describes how you build -patterns and actions, what kinds of things you can do within actions, -and 'awk''s predefined variables. - - The pattern-action rules and the statements available for use within -actions form the core of 'awk' programming. In a sense, everything -covered up to here has been the foundation that programs are built on -top of. Now it's time to start building something useful. - -* Menu: - -* Pattern Overview:: What goes into a pattern. -* Using Shell Variables:: How to use shell variables with 'awk'. -* Action Overview:: What goes into an action. -* Statements:: Describes the various control statements in - detail. -* Built-in Variables:: Summarizes the predefined variables. -* Pattern Action Summary:: Patterns and Actions summary. - - -File: gawk.info, Node: Pattern Overview, Next: Using Shell Variables, Up: Patterns and Actions - -7.1 Pattern Elements -==================== - -* Menu: - -* Regexp Patterns:: Using regexps as patterns. -* Expression Patterns:: Any expression can be used as a pattern. -* Ranges:: Pairs of patterns specify record ranges. -* BEGIN/END:: Specifying initialization and cleanup rules. -* BEGINFILE/ENDFILE:: Two special patterns for advanced control. -* Empty:: The empty pattern, which matches every record. - -Patterns in 'awk' control the execution of rules--a rule is executed -when its pattern matches the current input record. The following is a -summary of the types of 'awk' patterns: - -'/REGULAR EXPRESSION/' - A regular expression. It matches when the text of the input record - fits the regular expression. (*Note Regexp::.) - -'EXPRESSION' - A single expression. It matches when its value is nonzero (if a - number) or non-null (if a string). (*Note Expression Patterns::.) - -'BEGPAT, ENDPAT' - A pair of patterns separated by a comma, specifying a "range" of - records. The range includes both the initial record that matches - BEGPAT and the final record that matches ENDPAT. (*Note Ranges::.) - -'BEGIN' -'END' - Special patterns for you to supply startup or cleanup actions for - your 'awk' program. (*Note BEGIN/END::.) - -'BEGINFILE' -'ENDFILE' - Special patterns for you to supply startup or cleanup actions to be - done on a per-file basis. (*Note BEGINFILE/ENDFILE::.) - -'EMPTY' - The empty pattern matches every input record. (*Note Empty::.) - - -File: gawk.info, Node: Regexp Patterns, Next: Expression Patterns, Up: Pattern Overview - -7.1.1 Regular Expressions as Patterns -------------------------------------- - -Regular expressions are one of the first kinds of patterns presented in -this book. This kind of pattern is simply a regexp constant in the -pattern part of a rule. Its meaning is '$0 ~ /PATTERN/'. The pattern -matches when the input record matches the regexp. For example: - - /foo|bar|baz/ { buzzwords++ } - END { print buzzwords, "buzzwords seen" } - - -File: gawk.info, Node: Expression Patterns, Next: Ranges, Prev: Regexp Patterns, Up: Pattern Overview - -7.1.2 Expressions as Patterns ------------------------------ - -Any 'awk' expression is valid as an 'awk' pattern. The pattern matches -if the expression's value is nonzero (if a number) or non-null (if a -string). The expression is reevaluated each time the rule is tested -against a new input record. If the expression uses fields such as '$1', -the value depends directly on the new input record's text; otherwise, it -depends on only what has happened so far in the execution of the 'awk' -program. - - Comparison expressions, using the comparison operators described in -*note Typing and Comparison::, are a very common kind of pattern. -Regexp matching and nonmatching are also very common expressions. The -left operand of the '~' and '!~' operators is a string. The right -operand is either a constant regular expression enclosed in slashes -('/REGEXP/'), or any expression whose string value is used as a dynamic -regular expression (*note Computed Regexps::). The following example -prints the second field of each input record whose first field is -precisely 'li': - - $ awk '$1 == "li" { print $2 }' mail-list - -(There is no output, because there is no person with the exact name -'li'.) Contrast this with the following regular expression match, which -accepts any record with a first field that contains 'li': - - $ awk '$1 ~ /li/ { print $2 }' mail-list - -| 555-5553 - -| 555-6699 - - A regexp constant as a pattern is also a special case of an -expression pattern. The expression '/li/' has the value one if 'li' -appears in the current input record. Thus, as a pattern, '/li/' matches -any record containing 'li'. - - Boolean expressions are also commonly used as patterns. Whether the -pattern matches an input record depends on whether its subexpressions -match. For example, the following command prints all the records in -'mail-list' that contain both 'edu' and 'li': - - $ awk '/edu/ && /li/' mail-list - -| Samuel 555-3430 samuel.lanceolis@shu.edu A - - The following command prints all records in 'mail-list' that contain -_either_ 'edu' or 'li' (or both, of course): - - $ awk '/edu/ || /li/' mail-list - -| Amelia 555-5553 amelia.zodiacusque@gmail.com F - -| Broderick 555-0542 broderick.aliquotiens@yahoo.com R - -| Fabius 555-1234 fabius.undevicesimus@ucb.edu F - -| Julie 555-6699 julie.perscrutabor@skeeve.com F - -| Samuel 555-3430 samuel.lanceolis@shu.edu A - -| Jean-Paul 555-2127 jeanpaul.campanorum@nyu.edu R - - The following command prints all records in 'mail-list' that do _not_ -contain the string 'li': - - $ awk '! /li/' mail-list - -| Anthony 555-3412 anthony.asserturo@hotmail.com A - -| Becky 555-7685 becky.algebrarum@gmail.com A - -| Bill 555-1675 bill.drowning@hotmail.com A - -| Camilla 555-2912 camilla.infusarum@skynet.be R - -| Fabius 555-1234 fabius.undevicesimus@ucb.edu F - -| Martin 555-6480 martin.codicibus@hotmail.com A - -| Jean-Paul 555-2127 jeanpaul.campanorum@nyu.edu R - - The subexpressions of a Boolean operator in a pattern can be constant -regular expressions, comparisons, or any other 'awk' expressions. Range -patterns are not expressions, so they cannot appear inside Boolean -patterns. Likewise, the special patterns 'BEGIN', 'END', 'BEGINFILE', -and 'ENDFILE', which never match any input record, are not expressions -and cannot appear inside Boolean patterns. - - The precedence of the different operators that can appear in patterns -is described in *note Precedence::. - - -File: gawk.info, Node: Ranges, Next: BEGIN/END, Prev: Expression Patterns, Up: Pattern Overview - -7.1.3 Specifying Record Ranges with Patterns --------------------------------------------- - -A "range pattern" is made of two patterns separated by a comma, in the -form 'BEGPAT, ENDPAT'. It is used to match ranges of consecutive input -records. The first pattern, BEGPAT, controls where the range begins, -while ENDPAT controls where the pattern ends. For example, the -following: - - awk '$1 == "on", $1 == "off"' myfile - -prints every record in 'myfile' between 'on'/'off' pairs, inclusive. - - A range pattern starts out by matching BEGPAT against every input -record. When a record matches BEGPAT, the range pattern is "turned on", -and the range pattern matches this record as well. As long as the range -pattern stays turned on, it automatically matches every input record -read. The range pattern also matches ENDPAT against every input record; -when this succeeds, the range pattern is "turned off" again for the -following record. Then the range pattern goes back to checking BEGPAT -against each record. - - The record that turns on the range pattern and the one that turns it -off both match the range pattern. If you don't want to operate on these -records, you can write 'if' statements in the rule's action to -distinguish them from the records you are interested in. - - It is possible for a pattern to be turned on and off by the same -record. If the record satisfies both conditions, then the action is -executed for just that record. For example, suppose there is text -between two identical markers (e.g., the '%' symbol), each on its own -line, that should be ignored. A first attempt would be to combine a -range pattern that describes the delimited text with the 'next' -statement (not discussed yet, *note Next Statement::). This causes -'awk' to skip any further processing of the current record and start -over again with the next input record. Such a program looks like this: - - /^%$/,/^%$/ { next } - { print } - -This program fails because the range pattern is both turned on and -turned off by the first line, which just has a '%' on it. To accomplish -this task, write the program in the following manner, using a flag: - - /^%$/ { skip = ! skip; next } - skip == 1 { next } # skip lines with `skip' set - - In a range pattern, the comma (',') has the lowest precedence of all -the operators (i.e., it is evaluated last). Thus, the following program -attempts to combine a range pattern with another, simpler test: - - echo Yes | awk '/1/,/2/ || /Yes/' - - The intent of this program is '(/1/,/2/) || /Yes/'. However, 'awk' -interprets this as '/1/, (/2/ || /Yes/)'. This cannot be changed or -worked around; range patterns do not combine with other patterns: - - $ echo Yes | gawk '(/1/,/2/) || /Yes/' - error-> gawk: cmd. line:1: (/1/,/2/) || /Yes/ - error-> gawk: cmd. line:1: ^ syntax error - - As a minor point of interest, although it is poor style, POSIX allows -you to put a newline after the comma in a range pattern. (d.c.) - - -File: gawk.info, Node: BEGIN/END, Next: BEGINFILE/ENDFILE, Prev: Ranges, Up: Pattern Overview - -7.1.4 The 'BEGIN' and 'END' Special Patterns --------------------------------------------- - -All the patterns described so far are for matching input records. The -'BEGIN' and 'END' special patterns are different. They supply startup -and cleanup actions for 'awk' programs. 'BEGIN' and 'END' rules must -have actions; there is no default action for these rules because there -is no current record when they run. 'BEGIN' and 'END' rules are often -referred to as "'BEGIN' and 'END' blocks" by longtime 'awk' programmers. - -* Menu: - -* Using BEGIN/END:: How and why to use BEGIN/END rules. -* I/O And BEGIN/END:: I/O issues in BEGIN/END rules. - - -File: gawk.info, Node: Using BEGIN/END, Next: I/O And BEGIN/END, Up: BEGIN/END - -7.1.4.1 Startup and Cleanup Actions -................................... - -A 'BEGIN' rule is executed once only, before the first input record is -read. Likewise, an 'END' rule is executed once only, after all the -input is read. For example: - - $ awk ' - > BEGIN { print "Analysis of \"li\"" } - > /li/ { ++n } - > END { print "\"li\" appears in", n, "records." }' mail-list - -| Analysis of "li" - -| "li" appears in 4 records. - - This program finds the number of records in the input file -'mail-list' that contain the string 'li'. The 'BEGIN' rule prints a -title for the report. There is no need to use the 'BEGIN' rule to -initialize the counter 'n' to zero, as 'awk' does this automatically -(*note Variables::). The second rule increments the variable 'n' every -time a record containing the pattern 'li' is read. The 'END' rule -prints the value of 'n' at the end of the run. - - The special patterns 'BEGIN' and 'END' cannot be used in ranges or -with Boolean operators (indeed, they cannot be used with any operators). -An 'awk' program may have multiple 'BEGIN' and/or 'END' rules. They are -executed in the order in which they appear: all the 'BEGIN' rules at -startup and all the 'END' rules at termination. 'BEGIN' and 'END' rules -may be intermixed with other rules. This feature was added in the 1987 -version of 'awk' and is included in the POSIX standard. The original -(1978) version of 'awk' required the 'BEGIN' rule to be placed at the -beginning of the program, the 'END' rule to be placed at the end, and -only allowed one of each. This is no longer required, but it is a good -idea to follow this template in terms of program organization and -readability. - - Multiple 'BEGIN' and 'END' rules are useful for writing library -functions, because each library file can have its own 'BEGIN' and/or -'END' rule to do its own initialization and/or cleanup. The order in -which library functions are named on the command line controls the order -in which their 'BEGIN' and 'END' rules are executed. Therefore, you -have to be careful when writing such rules in library files so that the -order in which they are executed doesn't matter. *Note Options:: for -more information on using library functions. *Note Library Functions::, -for a number of useful library functions. - - If an 'awk' program has only 'BEGIN' rules and no other rules, then -the program exits after the 'BEGIN' rules are run.(1) However, if an -'END' rule exists, then the input is read, even if there are no other -rules in the program. This is necessary in case the 'END' rule checks -the 'FNR' and 'NR' variables. - - ---------- Footnotes ---------- - - (1) The original version of 'awk' kept reading and ignoring input -until the end of the file was seen. - - -File: gawk.info, Node: I/O And BEGIN/END, Prev: Using BEGIN/END, Up: BEGIN/END - -7.1.4.2 Input/Output from 'BEGIN' and 'END' Rules -................................................. - -There are several (sometimes subtle) points to be aware of when doing -I/O from a 'BEGIN' or 'END' rule. The first has to do with the value of -'$0' in a 'BEGIN' rule. Because 'BEGIN' rules are executed before any -input is read, there simply is no input record, and therefore no fields, -when executing 'BEGIN' rules. References to '$0' and the fields yield a -null string or zero, depending upon the context. One way to give '$0' a -real value is to execute a 'getline' command without a variable (*note -Getline::). Another way is simply to assign a value to '$0'. - - The second point is similar to the first, but from the other -direction. Traditionally, due largely to implementation issues, '$0' -and 'NF' were _undefined_ inside an 'END' rule. The POSIX standard -specifies that 'NF' is available in an 'END' rule. It contains the -number of fields from the last input record. Most probably due to an -oversight, the standard does not say that '$0' is also preserved, -although logically one would think that it should be. In fact, all of -BWK 'awk', 'mawk', and 'gawk' preserve the value of '$0' for use in -'END' rules. Be aware, however, that some other implementations and -many older versions of Unix 'awk' do not. - - The third point follows from the first two. The meaning of 'print' -inside a 'BEGIN' or 'END' rule is the same as always: 'print $0'. If -'$0' is the null string, then this prints an empty record. Many -longtime 'awk' programmers use an unadorned 'print' in 'BEGIN' and 'END' -rules, to mean 'print ""', relying on '$0' being null. Although one -might generally get away with this in 'BEGIN' rules, it is a very bad -idea in 'END' rules, at least in 'gawk'. It is also poor style, because -if an empty line is needed in the output, the program should print one -explicitly. - - Finally, the 'next' and 'nextfile' statements are not allowed in a -'BEGIN' rule, because the implicit -read-a-record-and-match-against-the-rules loop has not started yet. -Similarly, those statements are not valid in an 'END' rule, because all -the input has been read. (*Note Next Statement:: and *note Nextfile -Statement::.) - - -File: gawk.info, Node: BEGINFILE/ENDFILE, Next: Empty, Prev: BEGIN/END, Up: Pattern Overview - -7.1.5 The 'BEGINFILE' and 'ENDFILE' Special Patterns ----------------------------------------------------- - -This minor node describes a 'gawk'-specific feature. - - Two special kinds of rule, 'BEGINFILE' and 'ENDFILE', give you -"hooks" into 'gawk''s command-line file processing loop. As with the -'BEGIN' and 'END' rules (*note BEGIN/END::), all 'BEGINFILE' rules in a -program are merged, in the order they are read by 'gawk', and all -'ENDFILE' rules are merged as well. - - The body of the 'BEGINFILE' rules is executed just before 'gawk' -reads the first record from a file. 'FILENAME' is set to the name of -the current file, and 'FNR' is set to zero. - - The 'BEGINFILE' rule provides you the opportunity to accomplish two -tasks that would otherwise be difficult or impossible to perform: - - * You can test if the file is readable. Normally, it is a fatal - error if a file named on the command line cannot be opened for - reading. However, you can bypass the fatal error and move on to - the next file on the command line. - - You do this by checking if the 'ERRNO' variable is not the empty - string; if so, then 'gawk' was not able to open the file. In this - case, your program can execute the 'nextfile' statement (*note - Nextfile Statement::). This causes 'gawk' to skip the file - entirely. Otherwise, 'gawk' exits with the usual fatal error. - - * If you have written extensions that modify the record handling (by - inserting an "input parser"; *note Input Parsers::), you can invoke - them at this point, before 'gawk' has started processing the file. - (This is a _very_ advanced feature, currently used only by the - 'gawkextlib' project (http://sourceforge.net/projects/gawkextlib).) - - The 'ENDFILE' rule is called when 'gawk' has finished processing the -last record in an input file. For the last input file, it will be -called before any 'END' rules. The 'ENDFILE' rule is executed even for -empty input files. - - Normally, when an error occurs when reading input in the normal -input-processing loop, the error is fatal. However, if an 'ENDFILE' -rule is present, the error becomes non-fatal, and instead 'ERRNO' is -set. This makes it possible to catch and process I/O errors at the -level of the 'awk' program. - - The 'next' statement (*note Next Statement::) is not allowed inside -either a 'BEGINFILE' or an 'ENDFILE' rule. The 'nextfile' statement is -allowed only inside a 'BEGINFILE' rule, not inside an 'ENDFILE' rule. - - The 'getline' statement (*note Getline::) is restricted inside both -'BEGINFILE' and 'ENDFILE': only redirected forms of 'getline' are -allowed. - - 'BEGINFILE' and 'ENDFILE' are 'gawk' extensions. In most other 'awk' -implementations, or if 'gawk' is in compatibility mode (*note -Options::), they are not special. - - -File: gawk.info, Node: Empty, Prev: BEGINFILE/ENDFILE, Up: Pattern Overview - -7.1.6 The Empty Pattern ------------------------ - -An empty (i.e., nonexistent) pattern is considered to match _every_ -input record. For example, the program: - - awk '{ print $1 }' mail-list - -prints the first field of every record. - - -File: gawk.info, Node: Using Shell Variables, Next: Action Overview, Prev: Pattern Overview, Up: Patterns and Actions - -7.2 Using Shell Variables in Programs -===================================== - -'awk' programs are often used as components in larger programs written -in shell. For example, it is very common to use a shell variable to -hold a pattern that the 'awk' program searches for. There are two ways -to get the value of the shell variable into the body of the 'awk' -program. - - A common method is to use shell quoting to substitute the variable's -value into the program inside the script. For example, consider the -following program: - - printf "Enter search pattern: " - read pattern - awk "/$pattern/ "'{ nmatches++ } - END { print nmatches, "found" }' /path/to/data - -The 'awk' program consists of two pieces of quoted text that are -concatenated together to form the program. The first part is -double-quoted, which allows substitution of the 'pattern' shell variable -inside the quotes. The second part is single-quoted. - - Variable substitution via quoting works, but can potentially be -messy. It requires a good understanding of the shell's quoting rules -(*note Quoting::), and it's often difficult to correctly match up the -quotes when reading the program. - - A better method is to use 'awk''s variable assignment feature (*note -Assignment Options::) to assign the shell variable's value to an 'awk' -variable. Then use dynamic regexps to match the pattern (*note Computed -Regexps::). The following shows how to redo the previous example using -this technique: - - printf "Enter search pattern: " - read pattern - awk -v pat="$pattern" '$0 ~ pat { nmatches++ } - END { print nmatches, "found" }' /path/to/data - -Now, the 'awk' program is just one single-quoted string. The assignment -'-v pat="$pattern"' still requires double quotes, in case there is -whitespace in the value of '$pattern'. The 'awk' variable 'pat' could -be named 'pattern' too, but that would be more confusing. Using a -variable also provides more flexibility, as the variable can be used -anywhere inside the program--for printing, as an array subscript, or for -any other use--without requiring the quoting tricks at every point in -the program. - - -File: gawk.info, Node: Action Overview, Next: Statements, Prev: Using Shell Variables, Up: Patterns and Actions - -7.3 Actions -=========== - -An 'awk' program or script consists of a series of rules and function -definitions interspersed. (Functions are described later. *Note -User-defined::.) A rule contains a pattern and an action, either of -which (but not both) may be omitted. The purpose of the "action" is to -tell 'awk' what to do once a match for the pattern is found. Thus, in -outline, an 'awk' program generally looks like this: - - [PATTERN] '{ ACTION }' - PATTERN ['{ ACTION }'] - ... - 'function NAME(ARGS) { ... }' - ... - - An action consists of one or more 'awk' "statements", enclosed in -braces ('{...}'). Each statement specifies one thing to do. The -statements are separated by newlines or semicolons. The braces around -an action must be used even if the action contains only one statement, -or if it contains no statements at all. However, if you omit the action -entirely, omit the braces as well. An omitted action is equivalent to -'{ print $0 }': - - /foo/ { } match 'foo', do nothing -- empty action - /foo/ match 'foo', print the record -- omitted action - - The following types of statements are supported in 'awk': - -Expressions - Call functions or assign values to variables (*note Expressions::). - Executing this kind of statement simply computes the value of the - expression. This is useful when the expression has side effects - (*note Assignment Ops::). - -Control statements - Specify the control flow of 'awk' programs. The 'awk' language - gives you C-like constructs ('if', 'for', 'while', and 'do') as - well as a few special ones (*note Statements::). - -Compound statements - Enclose one or more statements in braces. A compound statement is - used in order to put several statements together in the body of an - 'if', 'while', 'do', or 'for' statement. - -Input statements - Use the 'getline' command (*note Getline::). Also supplied in - 'awk' are the 'next' statement (*note Next Statement::) and the - 'nextfile' statement (*note Nextfile Statement::). - -Output statements - Such as 'print' and 'printf'. *Note Printing::. - -Deletion statements - For deleting array elements. *Note Delete::. - - -File: gawk.info, Node: Statements, Next: Built-in Variables, Prev: Action Overview, Up: Patterns and Actions - -7.4 Control Statements in Actions -================================= - -"Control statements", such as 'if', 'while', and so on, control the flow -of execution in 'awk' programs. Most of 'awk''s control statements are -patterned after similar statements in C. - - All the control statements start with special keywords, such as 'if' -and 'while', to distinguish them from simple expressions. Many control -statements contain other statements. For example, the 'if' statement -contains another statement that may or may not be executed. The -contained statement is called the "body". To include more than one -statement in the body, group them into a single "compound statement" -with braces, separating them with newlines or semicolons. - -* Menu: - -* If Statement:: Conditionally execute some 'awk' - statements. -* While Statement:: Loop until some condition is satisfied. -* Do Statement:: Do specified action while looping until some - condition is satisfied. -* For Statement:: Another looping statement, that provides - initialization and increment clauses. -* Switch Statement:: Switch/case evaluation for conditional - execution of statements based on a value. -* Break Statement:: Immediately exit the innermost enclosing loop. -* Continue Statement:: Skip to the end of the innermost enclosing - loop. -* Next Statement:: Stop processing the current input record. -* Nextfile Statement:: Stop processing the current file. -* Exit Statement:: Stop execution of 'awk'. - - -File: gawk.info, Node: If Statement, Next: While Statement, Up: Statements - -7.4.1 The 'if'-'else' Statement -------------------------------- - -The 'if'-'else' statement is 'awk''s decision-making statement. It -looks like this: - - 'if (CONDITION) THEN-BODY' ['else ELSE-BODY'] - -The CONDITION is an expression that controls what the rest of the -statement does. If the CONDITION is true, THEN-BODY is executed; -otherwise, ELSE-BODY is executed. The 'else' part of the statement is -optional. The condition is considered false if its value is zero or the -null string; otherwise, the condition is true. Refer to the following: - - if (x % 2 == 0) - print "x is even" - else - print "x is odd" - - In this example, if the expression 'x % 2 == 0' is true (i.e., if the -value of 'x' is evenly divisible by two), then the first 'print' -statement is executed; otherwise, the second 'print' statement is -executed. If the 'else' keyword appears on the same line as THEN-BODY -and THEN-BODY is not a compound statement (i.e., not surrounded by -braces), then a semicolon must separate THEN-BODY from the 'else'. To -illustrate this, the previous example can be rewritten as: - - if (x % 2 == 0) print "x is even"; else - print "x is odd" - -If the ';' is left out, 'awk' can't interpret the statement and it -produces a syntax error. Don't actually write programs this way, -because a human reader might fail to see the 'else' if it is not the -first thing on its line. - - -File: gawk.info, Node: While Statement, Next: Do Statement, Prev: If Statement, Up: Statements - -7.4.2 The 'while' Statement ---------------------------- - -In programming, a "loop" is a part of a program that can be executed two -or more times in succession. The 'while' statement is the simplest -looping statement in 'awk'. It repeatedly executes a statement as long -as a condition is true. For example: - - while (CONDITION) - BODY - -BODY is a statement called the "body" of the loop, and CONDITION is an -expression that controls how long the loop keeps running. The first -thing the 'while' statement does is test the CONDITION. If the -CONDITION is true, it executes the statement BODY. (The CONDITION is -true when the value is not zero and not a null string.) After BODY has -been executed, CONDITION is tested again, and if it is still true, BODY -executes again. This process repeats until the CONDITION is no longer -true. If the CONDITION is initially false, the body of the loop never -executes and 'awk' continues with the statement following the loop. -This example prints the first three fields of each record, one per line: - - awk ' - { - i = 1 - while (i <= 3) { - print $i - i++ - } - }' inventory-shipped - -The body of this loop is a compound statement enclosed in braces, -containing two statements. The loop works in the following manner: -first, the value of 'i' is set to one. Then, the 'while' statement -tests whether 'i' is less than or equal to three. This is true when 'i' -equals one, so the 'i'th field is printed. Then the 'i++' increments -the value of 'i' and the loop repeats. The loop terminates when 'i' -reaches four. - - A newline is not required between the condition and the body; -however, using one makes the program clearer unless the body is a -compound statement or else is very simple. The newline after the open -brace that begins the compound statement is not required either, but the -program is harder to read without it. - - -File: gawk.info, Node: Do Statement, Next: For Statement, Prev: While Statement, Up: Statements - -7.4.3 The 'do'-'while' Statement --------------------------------- - -The 'do' loop is a variation of the 'while' looping statement. The 'do' -loop executes the BODY once and then repeats the BODY as long as the -CONDITION is true. It looks like this: - - do - BODY - while (CONDITION) - - Even if the CONDITION is false at the start, the BODY executes at -least once (and only once, unless executing BODY makes CONDITION true). -Contrast this with the corresponding 'while' statement: - - while (CONDITION) - BODY - -This statement does not execute the BODY even once if the CONDITION is -false to begin with. The following is an example of a 'do' statement: - - { - i = 1 - do { - print $0 - i++ - } while (i <= 10) - } - -This program prints each input record 10 times. However, it isn't a -very realistic example, because in this case an ordinary 'while' would -do just as well. This situation reflects actual experience; only -occasionally is there a real use for a 'do' statement. - - -File: gawk.info, Node: For Statement, Next: Switch Statement, Prev: Do Statement, Up: Statements - -7.4.4 The 'for' Statement -------------------------- - -The 'for' statement makes it more convenient to count iterations of a -loop. The general form of the 'for' statement looks like this: - - for (INITIALIZATION; CONDITION; INCREMENT) - BODY - -The INITIALIZATION, CONDITION, and INCREMENT parts are arbitrary 'awk' -expressions, and BODY stands for any 'awk' statement. - - The 'for' statement starts by executing INITIALIZATION. Then, as -long as the CONDITION is true, it repeatedly executes BODY and then -INCREMENT. Typically, INITIALIZATION sets a variable to either zero or -one, INCREMENT adds one to it, and CONDITION compares it against the -desired number of iterations. For example: - - awk ' - { - for (i = 1; i <= 3; i++) - print $i - }' inventory-shipped - -This prints the first three fields of each input record, with one field -per line. - - It isn't possible to set more than one variable in the INITIALIZATION -part without using a multiple assignment statement such as 'x = y = 0'. -This makes sense only if all the initial values are equal. (But it is -possible to initialize additional variables by writing their assignments -as separate statements preceding the 'for' loop.) - - The same is true of the INCREMENT part. Incrementing additional -variables requires separate statements at the end of the loop. The C -compound expression, using C's comma operator, is useful in this -context, but it is not supported in 'awk'. - - Most often, INCREMENT is an increment expression, as in the previous -example. But this is not required; it can be any expression whatsoever. -For example, the following statement prints all the powers of two -between 1 and 100: - - for (i = 1; i <= 100; i *= 2) - print i - - If there is nothing to be done, any of the three expressions in the -parentheses following the 'for' keyword may be omitted. Thus, -'for (; x > 0;)' is equivalent to 'while (x > 0)'. If the CONDITION is -omitted, it is treated as true, effectively yielding an "infinite loop" -(i.e., a loop that never terminates). - - In most cases, a 'for' loop is an abbreviation for a 'while' loop, as -shown here: - - INITIALIZATION - while (CONDITION) { - BODY - INCREMENT - } - -The only exception is when the 'continue' statement (*note Continue -Statement::) is used inside the loop. Changing a 'for' statement to a -'while' statement in this way can change the effect of the 'continue' -statement inside the loop. - - The 'awk' language has a 'for' statement in addition to a 'while' -statement because a 'for' loop is often both less work to type and more -natural to think of. Counting the number of iterations is very common -in loops. It can be easier to think of this counting as part of looping -rather than as something to do inside the loop. - - There is an alternative version of the 'for' loop, for iterating over -all the indices of an array: - - for (i in array) - DO SOMETHING WITH array[i] - -*Note Scanning an Array:: for more information on this version of the -'for' loop. - - -File: gawk.info, Node: Switch Statement, Next: Break Statement, Prev: For Statement, Up: Statements - -7.4.5 The 'switch' Statement ----------------------------- - -This minor node describes a 'gawk'-specific feature. If 'gawk' is in -compatibility mode (*note Options::), it is not available. - - The 'switch' statement allows the evaluation of an expression and the -execution of statements based on a 'case' match. Case statements are -checked for a match in the order they are defined. If no suitable -'case' is found, the 'default' section is executed, if supplied. - - Each 'case' contains a single constant, be it numeric, string, or -regexp. The 'switch' expression is evaluated, and then each 'case''s -constant is compared against the result in turn. The type of constant -determines the comparison: numeric or string do the usual comparisons. -A regexp constant does a regular expression match against the string -value of the original expression. The general form of the 'switch' -statement looks like this: - - switch (EXPRESSION) { - case VALUE OR REGULAR EXPRESSION: - CASE-BODY - default: - DEFAULT-BODY - } - - Control flow in the 'switch' statement works as it does in C. Once a -match to a given case is made, the case statement bodies execute until a -'break', 'continue', 'next', 'nextfile', or 'exit' is encountered, or -the end of the 'switch' statement itself. For example: - - while ((c = getopt(ARGC, ARGV, "aksx")) != -1) { - switch (c) { - case "a": - # report size of all files - all_files = TRUE; - break - case "k": - BLOCK_SIZE = 1024 # 1K block size - break - case "s": - # do sums only - sum_only = TRUE - break - case "x": - # don't cross filesystems - fts_flags = or(fts_flags, FTS_XDEV) - break - case "?": - default: - usage() - break - } - } - - Note that if none of the statements specified here halt execution of -a matched 'case' statement, execution falls through to the next 'case' -until execution halts. In this example, the 'case' for '"?"' falls -through to the 'default' case, which is to call a function named -'usage()'. (The 'getopt()' function being called here is described in -*note Getopt Function::.) - - -File: gawk.info, Node: Break Statement, Next: Continue Statement, Prev: Switch Statement, Up: Statements - -7.4.6 The 'break' Statement ---------------------------- - -The 'break' statement jumps out of the innermost 'for', 'while', or 'do' -loop that encloses it. The following example finds the smallest divisor -of any integer, and also identifies prime numbers: - - # find smallest divisor of num - { - num = $1 - for (divisor = 2; divisor * divisor <= num; divisor++) { - if (num % divisor == 0) - break - } - if (num % divisor == 0) - printf "Smallest divisor of %d is %d\n", num, divisor - else - printf "%d is prime\n", num - } - - When the remainder is zero in the first 'if' statement, 'awk' -immediately "breaks out" of the containing 'for' loop. This means that -'awk' proceeds immediately to the statement following the loop and -continues processing. (This is very different from the 'exit' -statement, which stops the entire 'awk' program. *Note Exit -Statement::.) - - The following program illustrates how the CONDITION of a 'for' or -'while' statement could be replaced with a 'break' inside an 'if': - - # find smallest divisor of num - { - num = $1 - for (divisor = 2; ; divisor++) { - if (num % divisor == 0) { - printf "Smallest divisor of %d is %d\n", num, divisor - break - } - if (divisor * divisor > num) { - printf "%d is prime\n", num - break - } - } - } - - The 'break' statement is also used to break out of the 'switch' -statement. This is discussed in *note Switch Statement::. - - The 'break' statement has no meaning when used outside the body of a -loop or 'switch'. However, although it was never documented, historical -implementations of 'awk' treated the 'break' statement outside of a loop -as if it were a 'next' statement (*note Next Statement::). (d.c.) -Recent versions of BWK 'awk' no longer allow this usage, nor does -'gawk'. - - -File: gawk.info, Node: Continue Statement, Next: Next Statement, Prev: Break Statement, Up: Statements - -7.4.7 The 'continue' Statement ------------------------------- - -Similar to 'break', the 'continue' statement is used only inside 'for', -'while', and 'do' loops. It skips over the rest of the loop body, -causing the next cycle around the loop to begin immediately. Contrast -this with 'break', which jumps out of the loop altogether. - - The 'continue' statement in a 'for' loop directs 'awk' to skip the -rest of the body of the loop and resume execution with the -increment-expression of the 'for' statement. The following program -illustrates this fact: - - BEGIN { - for (x = 0; x <= 20; x++) { - if (x == 5) - continue - printf "%d ", x - } - print "" - } - -This program prints all the numbers from 0 to 20--except for 5, for -which the 'printf' is skipped. Because the increment 'x++' is not -skipped, 'x' does not remain stuck at 5. Contrast the 'for' loop from -the previous example with the following 'while' loop: - - BEGIN { - x = 0 - while (x <= 20) { - if (x == 5) - continue - printf "%d ", x - x++ - } - print "" - } - -This program loops forever once 'x' reaches 5, because the increment -('x++') is never reached. - - The 'continue' statement has no special meaning with respect to the -'switch' statement, nor does it have any meaning when used outside the -body of a loop. Historical versions of 'awk' treated a 'continue' -statement outside a loop the same way they treated a 'break' statement -outside a loop: as if it were a 'next' statement (*note Next -Statement::). (d.c.) Recent versions of BWK 'awk' no longer work this -way, nor does 'gawk'. - - -File: gawk.info, Node: Next Statement, Next: Nextfile Statement, Prev: Continue Statement, Up: Statements - -7.4.8 The 'next' Statement --------------------------- - -The 'next' statement forces 'awk' to immediately stop processing the -current record and go on to the next record. This means that no further -rules are executed for the current record, and the rest of the current -rule's action isn't executed. - - Contrast this with the effect of the 'getline' function (*note -Getline::). That also causes 'awk' to read the next record immediately, -but it does not alter the flow of control in any way (i.e., the rest of -the current action executes with a new input record). - - At the highest level, 'awk' program execution is a loop that reads an -input record and then tests each rule's pattern against it. If you -think of this loop as a 'for' statement whose body contains the rules, -then the 'next' statement is analogous to a 'continue' statement. It -skips to the end of the body of this implicit loop and executes the -increment (which reads another record). - - For example, suppose an 'awk' program works only on records with four -fields, and it shouldn't fail when given bad input. To avoid -complicating the rest of the program, write a "weed out" rule near the -beginning, in the following manner: - - NF != 4 { - printf("%s:%d: skipped: NF != 4\n", FILENAME, FNR) > "/dev/stderr" - next - } - -Because of the 'next' statement, the program's subsequent rules won't -see the bad record. The error message is redirected to the standard -error output stream, as error messages should be. For more detail, see -*note Special Files::. - - If the 'next' statement causes the end of the input to be reached, -then the code in any 'END' rules is executed. *Note BEGIN/END::. - - The 'next' statement is not allowed inside 'BEGINFILE' and 'ENDFILE' -rules. *Note BEGINFILE/ENDFILE::. - - According to the POSIX standard, the behavior is undefined if the -'next' statement is used in a 'BEGIN' or 'END' rule. 'gawk' treats it -as a syntax error. Although POSIX does not disallow it, most other -'awk' implementations don't allow the 'next' statement inside function -bodies (*note User-defined::). Just as with any other 'next' statement, -a 'next' statement inside a function body reads the next record and -starts processing it with the first rule in the program. - - -File: gawk.info, Node: Nextfile Statement, Next: Exit Statement, Prev: Next Statement, Up: Statements - -7.4.9 The 'nextfile' Statement ------------------------------- - -The 'nextfile' statement is similar to the 'next' statement. However, -instead of abandoning processing of the current record, the 'nextfile' -statement instructs 'awk' to stop processing the current data file. - - Upon execution of the 'nextfile' statement, 'FILENAME' is updated to -the name of the next data file listed on the command line, 'FNR' is -reset to one, and processing starts over with the first rule in the -program. If the 'nextfile' statement causes the end of the input to be -reached, then the code in any 'END' rules is executed. An exception to -this is when 'nextfile' is invoked during execution of any statement in -an 'END' rule; in this case, it causes the program to stop immediately. -*Note BEGIN/END::. - - The 'nextfile' statement is useful when there are many data files to -process but it isn't necessary to process every record in every file. -Without 'nextfile', in order to move on to the next data file, a program -would have to continue scanning the unwanted records. The 'nextfile' -statement accomplishes this much more efficiently. - - In 'gawk', execution of 'nextfile' causes additional things to -happen: any 'ENDFILE' rules are executed if 'gawk' is not currently in -an 'END' or 'BEGINFILE' rule, 'ARGIND' is incremented, and any -'BEGINFILE' rules are executed. ('ARGIND' hasn't been introduced yet. -*Note Built-in Variables::.) - - With 'gawk', 'nextfile' is useful inside a 'BEGINFILE' rule to skip -over a file that would otherwise cause 'gawk' to exit with a fatal -error. In this case, 'ENDFILE' rules are not executed. *Note -BEGINFILE/ENDFILE::. - - Although it might seem that 'close(FILENAME)' would accomplish the -same as 'nextfile', this isn't true. 'close()' is reserved for closing -files, pipes, and coprocesses that are opened with redirections. It is -not related to the main processing that 'awk' does with the files listed -in 'ARGV'. - - NOTE: For many years, 'nextfile' was a common extension. In - September 2012, it was accepted for inclusion into the POSIX - standard. See the Austin Group website - (http://austingroupbugs.net/view.php?id=607). - - The current version of BWK 'awk' and 'mawk' also support 'nextfile'. -However, they don't allow the 'nextfile' statement inside function -bodies (*note User-defined::). 'gawk' does; a 'nextfile' inside a -function body reads the first record from the next file and starts -processing it with the first rule in the program, just as any other -'nextfile' statement. - - -File: gawk.info, Node: Exit Statement, Prev: Nextfile Statement, Up: Statements - -7.4.10 The 'exit' Statement ---------------------------- - -The 'exit' statement causes 'awk' to immediately stop executing the -current rule and to stop processing input; any remaining input is -ignored. The 'exit' statement is written as follows: - - 'exit' [RETURN CODE] - - When an 'exit' statement is executed from a 'BEGIN' rule, the program -stops processing everything immediately. No input records are read. -However, if an 'END' rule is present, as part of executing the 'exit' -statement, the 'END' rule is executed (*note BEGIN/END::). If 'exit' is -used in the body of an 'END' rule, it causes the program to stop -immediately. - - An 'exit' statement that is not part of a 'BEGIN' or 'END' rule stops -the execution of any further automatic rules for the current record, -skips reading any remaining input records, and executes the 'END' rule -if there is one. 'gawk' also skips any 'ENDFILE' rules; they do not -execute. - - In such a case, if you don't want the 'END' rule to do its job, set a -variable to a nonzero value before the 'exit' statement and check that -variable in the 'END' rule. *Note Assert Function:: for an example that -does this. - - If an argument is supplied to 'exit', its value is used as the exit -status code for the 'awk' process. If no argument is supplied, 'exit' -causes 'awk' to return a "success" status. In the case where an -argument is supplied to a first 'exit' statement, and then 'exit' is -called a second time from an 'END' rule with no argument, 'awk' uses the -previously supplied exit value. (d.c.) *Note Exit Status:: for more -information. - - For example, suppose an error condition occurs that is difficult or -impossible to handle. Conventionally, programs report this by exiting -with a nonzero status. An 'awk' program can do this using an 'exit' -statement with a nonzero argument, as shown in the following example: - - BEGIN { - if (("date" | getline date_now) <= 0) { - print "Can't get system date" > "/dev/stderr" - exit 1 - } - print "current date is", date_now - close("date") - } - - NOTE: For full portability, exit values should be between zero and - 126, inclusive. Negative values, and values of 127 or greater, may - not produce consistent results across different operating systems. - - -File: gawk.info, Node: Built-in Variables, Next: Pattern Action Summary, Prev: Statements, Up: Patterns and Actions - -7.5 Predefined Variables -======================== - -Most 'awk' variables are available to use for your own purposes; they -never change unless your program assigns values to them, and they never -affect anything unless your program examines them. However, a few -variables in 'awk' have special built-in meanings. 'awk' examines some -of these automatically, so that they enable you to tell 'awk' how to do -certain things. Others are set automatically by 'awk', so that they -carry information from the internal workings of 'awk' to your program. - - This minor node documents all of 'gawk''s predefined variables, most -of which are also documented in the major nodes describing their areas -of activity. - -* Menu: - -* User-modified:: Built-in variables that you change to control - 'awk'. -* Auto-set:: Built-in variables where 'awk' gives - you information. -* ARGC and ARGV:: Ways to use 'ARGC' and 'ARGV'. - - -File: gawk.info, Node: User-modified, Next: Auto-set, Up: Built-in Variables - -7.5.1 Built-in Variables That Control 'awk' -------------------------------------------- - -The following is an alphabetical list of variables that you can change -to control how 'awk' does certain things. - - The variables that are specific to 'gawk' are marked with a pound -sign ('#'). These variables are 'gawk' extensions. In other 'awk' -implementations or if 'gawk' is in compatibility mode (*note Options::), -they are not special. (Any exceptions are noted in the description of -each variable.) - -'BINMODE #' - On non-POSIX systems, this variable specifies use of binary mode - for all I/O. Numeric values of one, two, or three specify that - input files, output files, or all files, respectively, should use - binary I/O. A numeric value less than zero is treated as zero, and - a numeric value greater than three is treated as three. - Alternatively, string values of '"r"' or '"w"' specify that input - files and output files, respectively, should use binary I/O. A - string value of '"rw"' or '"wr"' indicates that all files should - use binary I/O. Any other string value is treated the same as - '"rw"', but causes 'gawk' to generate a warning message. 'BINMODE' - is described in more detail in *note PC Using::. 'mawk' (*note - Other Versions::) also supports this variable, but only using - numeric values. - -'CONVFMT' - A string that controls the conversion of numbers to strings (*note - Conversion::). It works by being passed, in effect, as the first - argument to the 'sprintf()' function (*note String Functions::). - Its default value is '"%.6g"'. 'CONVFMT' was introduced by the - POSIX standard. - -'FIELDWIDTHS #' - A space-separated list of columns that tells 'gawk' how to split - input with fixed columnar boundaries. Assigning a value to - 'FIELDWIDTHS' overrides the use of 'FS' and 'FPAT' for field - splitting. *Note Constant Size:: for more information. - -'FPAT #' - A regular expression (as a string) that tells 'gawk' to create the - fields based on text that matches the regular expression. - Assigning a value to 'FPAT' overrides the use of 'FS' and - 'FIELDWIDTHS' for field splitting. *Note Splitting By Content:: - for more information. - -'FS' - The input field separator (*note Field Separators::). The value is - a single-character string or a multicharacter regular expression - that matches the separations between fields in an input record. If - the value is the null string ('""'), then each character in the - record becomes a separate field. (This behavior is a 'gawk' - extension. POSIX 'awk' does not specify the behavior when 'FS' is - the null string. Nonetheless, some other versions of 'awk' also - treat '""' specially.) - - The default value is '" "', a string consisting of a single space. - As a special exception, this value means that any sequence of - spaces, TABs, and/or newlines is a single separator. It also - causes spaces, TABs, and newlines at the beginning and end of a - record to be ignored. - - You can set the value of 'FS' on the command line using the '-F' - option: - - awk -F, 'PROGRAM' INPUT-FILES - - If 'gawk' is using 'FIELDWIDTHS' or 'FPAT' for field splitting, - assigning a value to 'FS' causes 'gawk' to return to the normal, - 'FS'-based field splitting. An easy way to do this is to simply - say 'FS = FS', perhaps with an explanatory comment. - -'IGNORECASE #' - If 'IGNORECASE' is nonzero or non-null, then all string comparisons - and all regular expression matching are case-independent. This - applies to regexp matching with '~' and '!~', the 'gensub()', - 'gsub()', 'index()', 'match()', 'patsplit()', 'split()', and - 'sub()' functions, record termination with 'RS', and field - splitting with 'FS' and 'FPAT'. However, the value of 'IGNORECASE' - does _not_ affect array subscripting and it does not affect field - splitting when using a single-character field separator. *Note - Case-sensitivity::. - -'LINT #' - When this variable is true (nonzero or non-null), 'gawk' behaves as - if the '--lint' command-line option is in effect (*note Options::). - With a value of '"fatal"', lint warnings become fatal errors. With - a value of '"invalid"', only warnings about things that are - actually invalid are issued. (This is not fully implemented yet.) - Any other true value prints nonfatal warnings. Assigning a false - value to 'LINT' turns off the lint warnings. - - This variable is a 'gawk' extension. It is not special in other - 'awk' implementations. Unlike with the other special variables, - changing 'LINT' does affect the production of lint warnings, even - if 'gawk' is in compatibility mode. Much as the '--lint' and - '--traditional' options independently control different aspects of - 'gawk''s behavior, the control of lint warnings during program - execution is independent of the flavor of 'awk' being executed. - -'OFMT' - A string that controls conversion of numbers to strings (*note - Conversion::) for printing with the 'print' statement. It works by - being passed as the first argument to the 'sprintf()' function - (*note String Functions::). Its default value is '"%.6g"'. - Earlier versions of 'awk' used 'OFMT' to specify the format for - converting numbers to strings in general expressions; this is now - done by 'CONVFMT'. - -'OFS' - The output field separator (*note Output Separators::). It is - output between the fields printed by a 'print' statement. Its - default value is '" "', a string consisting of a single space. - -'ORS' - The output record separator. It is output at the end of every - 'print' statement. Its default value is '"\n"', the newline - character. (*Note Output Separators::.) - -'PREC #' - The working precision of arbitrary-precision floating-point - numbers, 53 bits by default (*note Setting precision::). - -'ROUNDMODE #' - The rounding mode to use for arbitrary-precision arithmetic on - numbers, by default '"N"' ('roundTiesToEven' in the IEEE 754 - standard; *note Setting the rounding mode::). - -'RS' - The input record separator. Its default value is a string - containing a single newline character, which means that an input - record consists of a single line of text. It can also be the null - string, in which case records are separated by runs of blank lines. - If it is a regexp, records are separated by matches of the regexp - in the input text. (*Note Records::.) - - The ability for 'RS' to be a regular expression is a 'gawk' - extension. In most other 'awk' implementations, or if 'gawk' is in - compatibility mode (*note Options::), just the first character of - 'RS''s value is used. - -'SUBSEP' - The subscript separator. It has the default value of '"\034"' and - is used to separate the parts of the indices of a multidimensional - array. Thus, the expression 'foo["A", "B"]' really accesses - 'foo["A\034B"]' (*note Multidimensional::). - -'TEXTDOMAIN #' - Used for internationalization of programs at the 'awk' level. It - sets the default text domain for specially marked string constants - in the source text, as well as for the 'dcgettext()', - 'dcngettext()', and 'bindtextdomain()' functions (*note - Internationalization::). The default value of 'TEXTDOMAIN' is - '"messages"'. - - -File: gawk.info, Node: Auto-set, Next: ARGC and ARGV, Prev: User-modified, Up: Built-in Variables - -7.5.2 Built-in Variables That Convey Information ------------------------------------------------- - -The following is an alphabetical list of variables that 'awk' sets -automatically on certain occasions in order to provide information to -your program. - - The variables that are specific to 'gawk' are marked with a pound -sign ('#'). These variables are 'gawk' extensions. In other 'awk' -implementations or if 'gawk' is in compatibility mode (*note Options::), -they are not special: - -'ARGC', 'ARGV' - The command-line arguments available to 'awk' programs are stored - in an array called 'ARGV'. 'ARGC' is the number of command-line - arguments present. *Note Other Arguments::. Unlike most 'awk' - arrays, 'ARGV' is indexed from 0 to 'ARGC' - 1. In the following - example: - - $ awk 'BEGIN { - > for (i = 0; i < ARGC; i++) - > print ARGV[i] - > }' inventory-shipped mail-list - -| awk - -| inventory-shipped - -| mail-list - - 'ARGV[0]' contains 'awk', 'ARGV[1]' contains 'inventory-shipped', - and 'ARGV[2]' contains 'mail-list'. The value of 'ARGC' is three, - one more than the index of the last element in 'ARGV', because the - elements are numbered from zero. - - The names 'ARGC' and 'ARGV', as well as the convention of indexing - the array from 0 to 'ARGC' - 1, are derived from the C language's - method of accessing command-line arguments. - - The value of 'ARGV[0]' can vary from system to system. Also, you - should note that the program text is _not_ included in 'ARGV', nor - are any of 'awk''s command-line options. *Note ARGC and ARGV:: for - information about how 'awk' uses these variables. (d.c.) - -'ARGIND #' - The index in 'ARGV' of the current file being processed. Every - time 'gawk' opens a new data file for processing, it sets 'ARGIND' - to the index in 'ARGV' of the file name. When 'gawk' is processing - the input files, 'FILENAME == ARGV[ARGIND]' is always true. - - This variable is useful in file processing; it allows you to tell - how far along you are in the list of data files as well as to - distinguish between successive instances of the same file name on - the command line. - - While you can change the value of 'ARGIND' within your 'awk' - program, 'gawk' automatically sets it to a new value when it opens - the next file. - -'ENVIRON' - An associative array containing the values of the environment. The - array indices are the environment variable names; the elements are - the values of the particular environment variables. For example, - 'ENVIRON["HOME"]' might be '/home/arnold'. - - For POSIX 'awk', changing this array does not affect the - environment passed on to any programs that 'awk' may spawn via - redirection or the 'system()' function. - - However, beginning with version 4.2, if not in POSIX compatibility - mode, 'gawk' does update its own environment when 'ENVIRON' is - changed, thus changing the environment seen by programs that it - creates. You should therefore be especially careful if you modify - 'ENVIRON["PATH"]', which is the search path for finding executable - programs. - - This can also affect the running 'gawk' program, since some of the - built-in functions may pay attention to certain environment - variables. The most notable instance of this is 'mktime()' (*note - Time Functions::), which pays attention the value of the 'TZ' - environment variable on many systems. - - Some operating systems may not have environment variables. On such - systems, the 'ENVIRON' array is empty (except for - 'ENVIRON["AWKPATH"]' and 'ENVIRON["AWKLIBPATH"]'; *note AWKPATH - Variable:: and *note AWKLIBPATH Variable::). - -'ERRNO #' - If a system error occurs during a redirection for 'getline', during - a read for 'getline', or during a 'close()' operation, then 'ERRNO' - contains a string describing the error. - - In addition, 'gawk' clears 'ERRNO' before opening each command-line - input file. This enables checking if the file is readable inside a - 'BEGINFILE' pattern (*note BEGINFILE/ENDFILE::). - - Otherwise, 'ERRNO' works similarly to the C variable 'errno'. - Except for the case just mentioned, 'gawk' _never_ clears it (sets - it to zero or '""'). Thus, you should only expect its value to be - meaningful when an I/O operation returns a failure value, such as - 'getline' returning -1. You are, of course, free to clear it - yourself before doing an I/O operation. - - If the value of 'ERRNO' corresponds to a system error in the C - 'errno' variable, then 'PROCINFO["errno"]' will be set to the value - of 'errno'. For non-system errors, 'PROCINFO["errno"]' will be - zero. - -'FILENAME' - The name of the current input file. When no data files are listed - on the command line, 'awk' reads from the standard input and - 'FILENAME' is set to '"-"'. 'FILENAME' changes each time a new - file is read (*note Reading Files::). Inside a 'BEGIN' rule, the - value of 'FILENAME' is '""', because there are no input files being - processed yet.(1) (d.c.) Note, though, that using 'getline' - (*note Getline::) inside a 'BEGIN' rule can give 'FILENAME' a - value. - -'FNR' - The current record number in the current file. 'awk' increments - 'FNR' each time it reads a new record (*note Records::). 'awk' - resets 'FNR' to zero each time it starts a new input file. - -'NF' - The number of fields in the current input record. 'NF' is set each - time a new record is read, when a new field is created, or when - '$0' changes (*note Fields::). - - Unlike most of the variables described in this node, assigning a - value to 'NF' has the potential to affect 'awk''s internal - workings. In particular, assignments to 'NF' can be used to create - fields in or remove fields from the current record. *Note Changing - Fields::. - -'FUNCTAB #' - An array whose indices and corresponding values are the names of - all the built-in, user-defined, and extension functions in the - program. - - NOTE: Attempting to use the 'delete' statement with the - 'FUNCTAB' array causes a fatal error. Any attempt to assign - to an element of 'FUNCTAB' also causes a fatal error. - -'NR' - The number of input records 'awk' has processed since the beginning - of the program's execution (*note Records::). 'awk' increments - 'NR' each time it reads a new record. - -'PROCINFO #' - The elements of this array provide access to information about the - running 'awk' program. The following elements (listed - alphabetically) are guaranteed to be available: - - 'PROCINFO["egid"]' - The value of the 'getegid()' system call. - - 'PROCINFO["errno"]' - The value of the C 'errno' variable when 'ERRNO' is set to the - associated error message. - - 'PROCINFO["euid"]' - The value of the 'geteuid()' system call. - - 'PROCINFO["FS"]' - This is '"FS"' if field splitting with 'FS' is in effect, - '"FIELDWIDTHS"' if field splitting with 'FIELDWIDTHS' is in - effect, or '"FPAT"' if field matching with 'FPAT' is in - effect. - - 'PROCINFO["gid"]' - The value of the 'getgid()' system call. - - 'PROCINFO["identifiers"]' - A subarray, indexed by the names of all identifiers used in - the text of the 'awk' program. An "identifier" is simply the - name of a variable (be it scalar or array), built-in function, - user-defined function, or extension function. For each - identifier, the value of the element is one of the following: - - '"array"' - The identifier is an array. - - '"builtin"' - The identifier is a built-in function. - - '"extension"' - The identifier is an extension function loaded via - '@load' or '-l'. - - '"scalar"' - The identifier is a scalar. - - '"untyped"' - The identifier is untyped (could be used as a scalar or - an array; 'gawk' doesn't know yet). - - '"user"' - The identifier is a user-defined function. - - The values indicate what 'gawk' knows about the identifiers - after it has finished parsing the program; they are _not_ - updated while the program runs. - - 'PROCINFO["pgrpid"]' - The process group ID of the current process. - - 'PROCINFO["pid"]' - The process ID of the current process. - - 'PROCINFO["ppid"]' - The parent process ID of the current process. - - 'PROCINFO["strftime"]' - The default time format string for 'strftime()'. Assigning a - new value to this element changes the default. *Note Time - Functions::. - - 'PROCINFO["uid"]' - The value of the 'getuid()' system call. - - 'PROCINFO["version"]' - The version of 'gawk'. - - The following additional elements in the array are available to - provide information about the MPFR and GMP libraries if your - version of 'gawk' supports arbitrary-precision arithmetic (*note - Arbitrary Precision Arithmetic::): - - 'PROCINFO["gmp_version"]' - The version of the GNU MP library. - - 'PROCINFO["mpfr_version"]' - The version of the GNU MPFR library. - - 'PROCINFO["prec_max"]' - The maximum precision supported by MPFR. - - 'PROCINFO["prec_min"]' - The minimum precision required by MPFR. - - The following additional elements in the array are available to - provide information about the version of the extension API, if your - version of 'gawk' supports dynamic loading of extension functions - (*note Dynamic Extensions::): - - 'PROCINFO["api_major"]' - The major version of the extension API. - - 'PROCINFO["api_minor"]' - The minor version of the extension API. - - On some systems, there may be elements in the array, '"group1"' - through '"groupN"' for some N. N is the number of supplementary - groups that the process has. Use the 'in' operator to test for - these elements (*note Reference to Elements::). - - The following elements allow you to change 'gawk''s behavior: - - 'PROCINFO["NONFATAL"]' - If this element exists, then I/O errors for all output - redirections become nonfatal. *Note Nonfatal::. - - 'PROCINFO["OUTPUT_NAME", "NONFATAL"]' - Make output errors for OUTPUT_NAME be nonfatal. *Note - Nonfatal::. - - 'PROCINFO["COMMAND", "pty"]' - For two-way communication to COMMAND, use a pseudo-tty instead - of setting up a two-way pipe. *Note Two-way I/O:: for more - information. - - 'PROCINFO["INPUT_NAME", "READ_TIMEOUT"]' - Set a timeout for reading from input redirection INPUT_NAME. - *Note Read Timeout:: for more information. - - 'PROCINFO["sorted_in"]' - If this element exists in 'PROCINFO', its value controls the - order in which array indices will be processed by 'for (INDX - in ARRAY)' loops. This is an advanced feature, so we defer - the full description until later; see *note Scanning an - Array::. - -'RLENGTH' - The length of the substring matched by the 'match()' function - (*note String Functions::). 'RLENGTH' is set by invoking the - 'match()' function. Its value is the length of the matched string, - or -1 if no match is found. - -'RSTART' - The start index in characters of the substring that is matched by - the 'match()' function (*note String Functions::). 'RSTART' is set - by invoking the 'match()' function. Its value is the position of - the string where the matched substring starts, or zero if no match - was found. - -'RT #' - The input text that matched the text denoted by 'RS', the record - separator. It is set every time a record is read. - -'SYMTAB #' - An array whose indices are the names of all defined global - variables and arrays in the program. 'SYMTAB' makes 'gawk''s - symbol table visible to the 'awk' programmer. It is built as - 'gawk' parses the program and is complete before the program starts - to run. - - The array may be used for indirect access to read or write the - value of a variable: - - foo = 5 - SYMTAB["foo"] = 4 - print foo # prints 4 - - The 'isarray()' function (*note Type Functions::) may be used to - test if an element in 'SYMTAB' is an array. Also, you may not use - the 'delete' statement with the 'SYMTAB' array. - - You may use an index for 'SYMTAB' that is not a predefined - identifier: - - SYMTAB["xxx"] = 5 - print SYMTAB["xxx"] - - This works as expected: in this case 'SYMTAB' acts just like a - regular array. The only difference is that you can't then delete - 'SYMTAB["xxx"]'. - - The 'SYMTAB' array is more interesting than it looks. Andrew - Schorr points out that it effectively gives 'awk' data pointers. - Consider his example: - - # Indirect multiply of any variable by amount, return result - - function multiply(variable, amount) - { - return SYMTAB[variable] *= amount - } - - You would use it like this: - - BEGIN { - answer = 10.5 - multiply("answer", 4) - print "The answer is", answer - } - - When run, this produces: - - $ gawk -f answer.awk - -| The answer is 42 - - NOTE: In order to avoid severe time-travel paradoxes,(2) - neither 'FUNCTAB' nor 'SYMTAB' is available as an element - within the 'SYMTAB' array. - - Changing 'NR' and 'FNR' - - 'awk' increments 'NR' and 'FNR' each time it reads a record, instead -of setting them to the absolute value of the number of records read. -This means that a program can change these variables and their new -values are incremented for each record. (d.c.) The following example -shows this: - - $ echo '1 - > 2 - > 3 - > 4' | awk 'NR == 2 { NR = 17 } - > { print NR }' - -| 1 - -| 17 - -| 18 - -| 19 - -Before 'FNR' was added to the 'awk' language (*note V7/SVR3.1::), many -'awk' programs used this feature to track the number of records in a -file by resetting 'NR' to zero when 'FILENAME' changed. - - ---------- Footnotes ---------- - - (1) Some early implementations of Unix 'awk' initialized 'FILENAME' -to '"-"', even if there were data files to be processed. This behavior -was incorrect and should not be relied upon in your programs. - - (2) Not to mention difficult implementation issues. - - -File: gawk.info, Node: ARGC and ARGV, Prev: Auto-set, Up: Built-in Variables - -7.5.3 Using 'ARGC' and 'ARGV' ------------------------------ - -*note Auto-set:: presented the following program describing the -information contained in 'ARGC' and 'ARGV': - - $ awk 'BEGIN { - > for (i = 0; i < ARGC; i++) - > print ARGV[i] - > }' inventory-shipped mail-list - -| awk - -| inventory-shipped - -| mail-list - -In this example, 'ARGV[0]' contains 'awk', 'ARGV[1]' contains -'inventory-shipped', and 'ARGV[2]' contains 'mail-list'. Notice that -the 'awk' program is not entered in 'ARGV'. The other command-line -options, with their arguments, are also not entered. This includes -variable assignments done with the '-v' option (*note Options::). -Normal variable assignments on the command line _are_ treated as -arguments and do show up in the 'ARGV' array. Given the following -program in a file named 'showargs.awk': - - BEGIN { - printf "A=%d, B=%d\n", A, B - for (i = 0; i < ARGC; i++) - printf "\tARGV[%d] = %s\n", i, ARGV[i] - } - END { printf "A=%d, B=%d\n", A, B } - -Running it produces the following: - - $ awk -v A=1 -f showargs.awk B=2 /dev/null - -| A=1, B=0 - -| ARGV[0] = awk - -| ARGV[1] = B=2 - -| ARGV[2] = /dev/null - -| A=1, B=2 - - A program can alter 'ARGC' and the elements of 'ARGV'. Each time -'awk' reaches the end of an input file, it uses the next element of -'ARGV' as the name of the next input file. By storing a different -string there, a program can change which files are read. Use '"-"' to -represent the standard input. Storing additional elements and -incrementing 'ARGC' causes additional files to be read. - - If the value of 'ARGC' is decreased, that eliminates input files from -the end of the list. By recording the old value of 'ARGC' elsewhere, a -program can treat the eliminated arguments as something other than file -names. - - To eliminate a file from the middle of the list, store the null -string ('""') into 'ARGV' in place of the file's name. As a special -feature, 'awk' ignores file names that have been replaced with the null -string. Another option is to use the 'delete' statement to remove -elements from 'ARGV' (*note Delete::). - - All of these actions are typically done in the 'BEGIN' rule, before -actual processing of the input begins. *Note Split Program:: and *note -Tee Program:: for examples of each way of removing elements from 'ARGV'. - - To actually get options into an 'awk' program, end the 'awk' options -with '--' and then supply the 'awk' program's options, in the following -manner: - - awk -f myprog.awk -- -v -q file1 file2 ... - - The following fragment processes 'ARGV' in order to examine, and then -remove, the previously mentioned command-line options: - - BEGIN { - for (i = 1; i < ARGC; i++) { - if (ARGV[i] == "-v") - verbose = 1 - else if (ARGV[i] == "-q") - debug = 1 - else if (ARGV[i] ~ /^-./) { - e = sprintf("%s: unrecognized option -- %c", - ARGV[0], substr(ARGV[i], 2, 1)) - print e > "/dev/stderr" - } else - break - delete ARGV[i] - } - } - - Ending the 'awk' options with '--' isn't necessary in 'gawk'. Unless -'--posix' has been specified, 'gawk' silently puts any unrecognized -options into 'ARGV' for the 'awk' program to deal with. As soon as it -sees an unknown option, 'gawk' stops looking for other options that it -might otherwise recognize. The previous command line with 'gawk' would -be: - - gawk -f myprog.awk -q -v file1 file2 ... - -Because '-q' is not a valid 'gawk' option, it and the following '-v' are -passed on to the 'awk' program. (*Note Getopt Function:: for an 'awk' -library function that parses command-line options.) - - When designing your program, you should choose options that don't -conflict with 'gawk''s, because it will process any options that it -accepts before passing the rest of the command line on to your program. -Using '#!' with the '-E' option may help (*note Executable Scripts:: and -*note Options::). - - -File: gawk.info, Node: Pattern Action Summary, Prev: Built-in Variables, Up: Patterns and Actions - -7.6 Summary -=========== - - * Pattern-action pairs make up the basic elements of an 'awk' - program. Patterns are either normal expressions, range - expressions, or regexp constants; one of the special keywords - 'BEGIN', 'END', 'BEGINFILE', or 'ENDFILE'; or empty. The action - executes if the current record matches the pattern. Empty - (missing) patterns match all records. - - * I/O from 'BEGIN' and 'END' rules has certain constraints. This is - also true, only more so, for 'BEGINFILE' and 'ENDFILE' rules. The - latter two give you "hooks" into 'gawk''s file processing, allowing - you to recover from a file that otherwise would cause a fatal error - (such as a file that cannot be opened). - - * Shell variables can be used in 'awk' programs by careful use of - shell quoting. It is easier to pass a shell variable into 'awk' by - using the '-v' option and an 'awk' variable. - - * Actions consist of statements enclosed in curly braces. Statements - are built up from expressions, control statements, compound - statements, input and output statements, and deletion statements. - - * The control statements in 'awk' are 'if'-'else', 'while', 'for', - and 'do'-'while'. 'gawk' adds the 'switch' statement. There are - two flavors of 'for' statement: one for performing general looping, - and the other for iterating through an array. - - * 'break' and 'continue' let you exit early or start the next - iteration of a loop (or get out of a 'switch'). - - * 'next' and 'nextfile' let you read the next record and start over - at the top of your program or skip to the next input file and start - over, respectively. - - * The 'exit' statement terminates your program. When executed from - an action (or function body), it transfers control to the 'END' - statements. From an 'END' statement body, it exits immediately. - You may pass an optional numeric value to be used as 'awk''s exit - status. - - * Some predefined variables provide control over 'awk', mainly for - I/O. Other variables convey information from 'awk' to your program. - - * 'ARGC' and 'ARGV' make the command-line arguments available to your - program. Manipulating them from a 'BEGIN' rule lets you control - how 'awk' will process the provided data files. - - -File: gawk.info, Node: Arrays, Next: Functions, Prev: Patterns and Actions, Up: Top - -8 Arrays in 'awk' -***************** - -An "array" is a table of values called "elements". The elements of an -array are distinguished by their "indices". Indices may be either -numbers or strings. - - This major node describes how arrays work in 'awk', how to use array -elements, how to scan through every element in an array, and how to -remove array elements. It also describes how 'awk' simulates -multidimensional arrays, as well as some of the less obvious points -about array usage. The major node moves on to discuss 'gawk''s facility -for sorting arrays, and ends with a brief description of 'gawk''s -ability to support true arrays of arrays. - -* Menu: - -* Array Basics:: The basics of arrays. -* Numeric Array Subscripts:: How to use numbers as subscripts in - 'awk'. -* Uninitialized Subscripts:: Using Uninitialized variables as subscripts. -* Delete:: The 'delete' statement removes an element - from an array. -* Multidimensional:: Emulating multidimensional arrays in - 'awk'. -* Arrays of Arrays:: True multidimensional arrays. -* Arrays Summary:: Summary of arrays. - - -File: gawk.info, Node: Array Basics, Next: Numeric Array Subscripts, Up: Arrays - -8.1 The Basics of Arrays -======================== - -This minor node presents the basics: working with elements in arrays one -at a time, and traversing all of the elements in an array. - -* Menu: - -* Array Intro:: Introduction to Arrays -* Reference to Elements:: How to examine one element of an array. -* Assigning Elements:: How to change an element of an array. -* Array Example:: Basic Example of an Array -* Scanning an Array:: A variation of the 'for' statement. It - loops through the indices of an array's - existing elements. -* Controlling Scanning:: Controlling the order in which arrays are - scanned. - - -File: gawk.info, Node: Array Intro, Next: Reference to Elements, Up: Array Basics - -8.1.1 Introduction to Arrays ----------------------------- - - Doing linear scans over an associative array is like trying to club - someone to death with a loaded Uzi. - -- _Larry Wall_ - - The 'awk' language provides one-dimensional arrays for storing groups -of related strings or numbers. Every 'awk' array must have a name. -Array names have the same syntax as variable names; any valid variable -name would also be a valid array name. But one name cannot be used in -both ways (as an array and as a variable) in the same 'awk' program. - - Arrays in 'awk' superficially resemble arrays in other programming -languages, but there are fundamental differences. In 'awk', it isn't -necessary to specify the size of an array before starting to use it. -Additionally, any number or string, not just consecutive integers, may -be used as an array index. - - In most other languages, arrays must be "declared" before use, -including a specification of how many elements or components they -contain. In such languages, the declaration causes a contiguous block -of memory to be allocated for that many elements. Usually, an index in -the array must be a nonnegative integer. For example, the index zero -specifies the first element in the array, which is actually stored at -the beginning of the block of memory. Index one specifies the second -element, which is stored in memory right after the first element, and so -on. It is impossible to add more elements to the array, because it has -room only for as many elements as given in the declaration. (Some -languages allow arbitrary starting and ending indices--e.g., '15 .. -27'--but the size of the array is still fixed when the array is -declared.) - - A contiguous array of four elements might look like *note Figure 8.1: -figure-array-elements, conceptually, if the element values are eight, -'"foo"', '""', and 30. - - -| 8 | \"foo\" | \"\" | 30 | Value -+---------+---------+--------+---------+ - 0 1 2 3 Index" - -Figure 8.1: A contiguous array - -Only the values are stored; the indices are implicit from the order of -the values. Here, eight is the value at index zero, because eight -appears in the position with zero elements before it. - - Arrays in 'awk' are different--they are "associative". This means -that each array is a collection of pairs--an index and its corresponding -array element value: - - Index Value ------------------------- - '3' '30' - '1' '"foo"' - '0' '8' - '2' '""' - -The pairs are shown in jumbled order because their order is -irrelevant.(1) - - One advantage of associative arrays is that new pairs can be added at -any time. For example, suppose a tenth element is added to the array -whose value is '"number ten"'. The result is: - - Index Value -------------------------------- - '10' '"number - ten"' - '3' '30' - '1' '"foo"' - '0' '8' - '2' '""' - -Now the array is "sparse", which just means some indices are missing. -It has elements 0-3 and 10, but doesn't have elements 4, 5, 6, 7, 8, or -9. - - Another consequence of associative arrays is that the indices don't -have to be nonnegative integers. Any number, or even a string, can be -an index. For example, the following is an array that translates words -from English to French: - - Index Value ------------------------- - '"dog"' '"chien"' - '"cat"' '"chat"' - '"one"' '"un"' - '1' '"un"' - -Here we decided to translate the number one in both spelled-out and -numeric form--thus illustrating that a single array can have both -numbers and strings as indices. (In fact, array subscripts are always -strings. There are some subtleties to how numbers work when used as -array subscripts; this is discussed in more detail in *note Numeric -Array Subscripts::.) Here, the number '1' isn't double-quoted, because -'awk' automatically converts it to a string. - - The value of 'IGNORECASE' has no effect upon array subscripting. The -identical string value used to store an array element must be used to -retrieve it. When 'awk' creates an array (e.g., with the 'split()' -built-in function), that array's indices are consecutive integers -starting at one. (*Note String Functions::.) - - 'awk''s arrays are efficient--the time to access an element is -independent of the number of elements in the array. - - ---------- Footnotes ---------- - - (1) The ordering will vary among 'awk' implementations, which -typically use hash tables to store array elements and values. - - -File: gawk.info, Node: Reference to Elements, Next: Assigning Elements, Prev: Array Intro, Up: Array Basics - -8.1.2 Referring to an Array Element ------------------------------------ - -The principal way to use an array is to refer to one of its elements. -An "array reference" is an expression as follows: - - ARRAY[INDEX-EXPRESSION] - -Here, ARRAY is the name of an array. The expression INDEX-EXPRESSION is -the index of the desired element of the array. - - The value of the array reference is the current value of that array -element. For example, 'foo[4.3]' is an expression referencing the -element of array 'foo' at index '4.3'. - - A reference to an array element that has no recorded value yields a -value of '""', the null string. This includes elements that have not -been assigned any value as well as elements that have been deleted -(*note Delete::). - - NOTE: A reference to an element that does not exist _automatically_ - creates that array element, with the null string as its value. (In - some cases, this is unfortunate, because it might waste memory - inside 'awk'.) - - Novice 'awk' programmers often make the mistake of checking if an - element exists by checking if the value is empty: - - # Check if "foo" exists in a: Incorrect! - if (a["foo"] != "") ... - - This is incorrect for two reasons. First, it _creates_ 'a["foo"]' - if it didn't exist before! Second, it is valid (if a bit unusual) - to set an array element equal to the empty string. - - To determine whether an element exists in an array at a certain -index, use the following expression: - - INDX in ARRAY - -This expression tests whether the particular index INDX exists, without -the side effect of creating that element if it is not present. The -expression has the value one (true) if 'ARRAY[INDX]' exists and zero -(false) if it does not exist. (We use INDX here, because 'index' is the -name of a built-in function.) For example, this statement tests whether -the array 'frequencies' contains the index '2': - - if (2 in frequencies) - print "Subscript 2 is present." - - Note that this is _not_ a test of whether the array 'frequencies' -contains an element whose _value_ is two. There is no way to do that -except to scan all the elements. Also, this _does not_ create -'frequencies[2]', while the following (incorrect) alternative does: - - if (frequencies[2] != "") - print "Subscript 2 is present." - - -File: gawk.info, Node: Assigning Elements, Next: Array Example, Prev: Reference to Elements, Up: Array Basics - -8.1.3 Assigning Array Elements ------------------------------- - -Array elements can be assigned values just like 'awk' variables: - - ARRAY[INDEX-EXPRESSION] = VALUE - -ARRAY is the name of an array. The expression INDEX-EXPRESSION is the -index of the element of the array that is assigned a value. The -expression VALUE is the value to assign to that element of the array. - - -File: gawk.info, Node: Array Example, Next: Scanning an Array, Prev: Assigning Elements, Up: Array Basics - -8.1.4 Basic Array Example -------------------------- - -The following program takes a list of lines, each beginning with a line -number, and prints them out in order of line number. The line numbers -are not in order when they are first read--instead, they are scrambled. -This program sorts the lines by making an array using the line numbers -as subscripts. The program then prints out the lines in sorted order of -their numbers. It is a very simple program and gets confused upon -encountering repeated numbers, gaps, or lines that don't begin with a -number: - - { - if ($1 > max) - max = $1 - arr[$1] = $0 - } - - END { - for (x = 1; x <= max; x++) - print arr[x] - } - - The first rule keeps track of the largest line number seen so far; it -also stores each line into the array 'arr', at an index that is the -line's number. The second rule runs after all the input has been read, -to print out all the lines. When this program is run with the following -input: - - 5 I am the Five man - 2 Who are you? The new number two! - 4 . . . And four on the floor - 1 Who is number one? - 3 I three you. - -Its output is: - - 1 Who is number one? - 2 Who are you? The new number two! - 3 I three you. - 4 . . . And four on the floor - 5 I am the Five man - - If a line number is repeated, the last line with a given number -overrides the others. Gaps in the line numbers can be handled with an -easy improvement to the program's 'END' rule, as follows: - - END { - for (x = 1; x <= max; x++) - if (x in arr) - print arr[x] - } - - -File: gawk.info, Node: Scanning an Array, Next: Controlling Scanning, Prev: Array Example, Up: Array Basics - -8.1.5 Scanning All Elements of an Array ---------------------------------------- - -In programs that use arrays, it is often necessary to use a loop that -executes once for each element of an array. In other languages, where -arrays are contiguous and indices are limited to nonnegative integers, -this is easy: all the valid indices can be found by counting from the -lowest index up to the highest. This technique won't do the job in -'awk', because any number or string can be an array index. So 'awk' has -a special kind of 'for' statement for scanning an array: - - for (VAR in ARRAY) - BODY - -This loop executes BODY once for each index in ARRAY that the program -has previously used, with the variable VAR set to that index. - - The following program uses this form of the 'for' statement. The -first rule scans the input records and notes which words appear (at -least once) in the input, by storing a one into the array 'used' with -the word as the index. The second rule scans the elements of 'used' to -find all the distinct words that appear in the input. It prints each -word that is more than 10 characters long and also prints the number of -such words. *Note String Functions:: for more information on the -built-in function 'length()'. - - # Record a 1 for each word that is used at least once - { - for (i = 1; i <= NF; i++) - used[$i] = 1 - } - - # Find number of distinct words more than 10 characters long - END { - for (x in used) { - if (length(x) > 10) { - ++num_long_words - print x - } - } - print num_long_words, "words longer than 10 characters" - } - -*Note Word Sorting:: for a more detailed example of this type. - - The order in which elements of the array are accessed by this -statement is determined by the internal arrangement of the array -elements within 'awk' and in standard 'awk' cannot be controlled or -changed. This can lead to problems if new elements are added to ARRAY -by statements in the loop body; it is not predictable whether the 'for' -loop will reach them. Similarly, changing VAR inside the loop may -produce strange results. It is best to avoid such things. - - As a point of information, 'gawk' sets up the list of elements to be -iterated over before the loop starts, and does not change it. But not -all 'awk' versions do so. Consider this program, named 'loopcheck.awk': - - BEGIN { - a["here"] = "here" - a["is"] = "is" - a["a"] = "a" - a["loop"] = "loop" - for (i in a) { - j++ - a[j] = j - print i - } - } - - Here is what happens when run with 'gawk' (and 'mawk'): - - $ gawk -f loopcheck.awk - -| here - -| loop - -| a - -| is - - Contrast this to BWK 'awk': - - $ nawk -f loopcheck.awk - -| loop - -| here - -| is - -| a - -| 1 - - -File: gawk.info, Node: Controlling Scanning, Prev: Scanning an Array, Up: Array Basics - -8.1.6 Using Predefined Array Scanning Orders with 'gawk' --------------------------------------------------------- - -This node describes a feature that is specific to 'gawk'. - - By default, when a 'for' loop traverses an array, the order is -undefined, meaning that the 'awk' implementation determines the order in -which the array is traversed. This order is usually based on the -internal implementation of arrays and will vary from one version of -'awk' to the next. - - Often, though, you may wish to do something simple, such as "traverse -the array by comparing the indices in ascending order," or "traverse the -array by comparing the values in descending order." 'gawk' provides two -mechanisms that give you this control: - - * Set 'PROCINFO["sorted_in"]' to one of a set of predefined values. - We describe this now. - - * Set 'PROCINFO["sorted_in"]' to the name of a user-defined function - to use for comparison of array elements. This advanced feature is - described later in *note Array Sorting::. - - The following special values for 'PROCINFO["sorted_in"]' are -available: - -'"@unsorted"' - Array elements are processed in arbitrary order, which is the - default 'awk' behavior. - -'"@ind_str_asc"' - Order by indices in ascending order compared as strings; this is - the most basic sort. (Internally, array indices are always - strings, so with 'a[2*5] = 1' the index is '"10"' rather than - numeric 10.) - -'"@ind_num_asc"' - Order by indices in ascending order but force them to be treated as - numbers in the process. Any index with a non-numeric value will - end up positioned as if it were zero. - -'"@val_type_asc"' - Order by element values in ascending order (rather than by - indices). Ordering is by the type assigned to the element (*note - Typing and Comparison::). All numeric values come before all - string values, which in turn come before all subarrays. (Subarrays - have not been described yet; *note Arrays of Arrays::.) - -'"@val_str_asc"' - Order by element values in ascending order (rather than by - indices). Scalar values are compared as strings. Subarrays, if - present, come out last. - -'"@val_num_asc"' - Order by element values in ascending order (rather than by - indices). Scalar values are compared as numbers. Subarrays, if - present, come out last. When numeric values are equal, the string - values are used to provide an ordering: this guarantees consistent - results across different versions of the C 'qsort()' function,(1) - which 'gawk' uses internally to perform the sorting. - -'"@ind_str_desc"' - Like '"@ind_str_asc"', but the string indices are ordered from high - to low. - -'"@ind_num_desc"' - Like '"@ind_num_asc"', but the numeric indices are ordered from - high to low. - -'"@val_type_desc"' - Like '"@val_type_asc"', but the element values, based on type, are - ordered from high to low. Subarrays, if present, come out first. - -'"@val_str_desc"' - Like '"@val_str_asc"', but the element values, treated as strings, - are ordered from high to low. Subarrays, if present, come out - first. - -'"@val_num_desc"' - Like '"@val_num_asc"', but the element values, treated as numbers, - are ordered from high to low. Subarrays, if present, come out - first. - - The array traversal order is determined before the 'for' loop starts -to run. Changing 'PROCINFO["sorted_in"]' in the loop body does not -affect the loop. For example: - - $ gawk ' - > BEGIN { - > a[4] = 4 - > a[3] = 3 - > for (i in a) - > print i, a[i] - > }' - -| 4 4 - -| 3 3 - $ gawk ' - > BEGIN { - > PROCINFO["sorted_in"] = "@ind_str_asc" - > a[4] = 4 - > a[3] = 3 - > for (i in a) - > print i, a[i] - > }' - -| 3 3 - -| 4 4 - - When sorting an array by element values, if a value happens to be a -subarray then it is considered to be greater than any string or numeric -value, regardless of what the subarray itself contains, and all -subarrays are treated as being equal to each other. Their order -relative to each other is determined by their index strings. - - Here are some additional things to bear in mind about sorted array -traversal: - - * The value of 'PROCINFO["sorted_in"]' is global. That is, it - affects all array traversal 'for' loops. If you need to change it - within your own code, you should see if it's defined and save and - restore the value: - - ... - if ("sorted_in" in PROCINFO) { - save_sorted = PROCINFO["sorted_in"] - PROCINFO["sorted_in"] = "@val_str_desc" # or whatever - } - ... - if (save_sorted) - PROCINFO["sorted_in"] = save_sorted - - * As already mentioned, the default array traversal order is - represented by '"@unsorted"'. You can also get the default - behavior by assigning the null string to 'PROCINFO["sorted_in"]' or - by just deleting the '"sorted_in"' element from the 'PROCINFO' - array with the 'delete' statement. (The 'delete' statement hasn't - been described yet; *note Delete::.) - - In addition, 'gawk' provides built-in functions for sorting arrays; -see *note Array Sorting Functions::. - - ---------- Footnotes ---------- - - (1) When two elements compare as equal, the C 'qsort()' function does -not guarantee that they will maintain their original relative order -after sorting. Using the string value to provide a unique ordering when -the numeric values are equal ensures that 'gawk' behaves consistently -across different environments. - - -File: gawk.info, Node: Numeric Array Subscripts, Next: Uninitialized Subscripts, Prev: Array Basics, Up: Arrays - -8.2 Using Numbers to Subscript Arrays -===================================== - -An important aspect to remember about arrays is that _array subscripts -are always strings_. When a numeric value is used as a subscript, it is -converted to a string value before being used for subscripting (*note -Conversion::). This means that the value of the predefined variable -'CONVFMT' can affect how your program accesses elements of an array. -For example: - - xyz = 12.153 - data[xyz] = 1 - CONVFMT = "%2.2f" - if (xyz in data) - printf "%s is in data\n", xyz - else - printf "%s is not in data\n", xyz - -This prints '12.15 is not in data'. The first statement gives 'xyz' a -numeric value. Assigning to 'data[xyz]' subscripts 'data' with the -string value '"12.153"' (using the default conversion value of -'CONVFMT', '"%.6g"'). Thus, the array element 'data["12.153"]' is -assigned the value one. The program then changes the value of -'CONVFMT'. The test '(xyz in data)' generates a new string value from -'xyz'--this time '"12.15"'--because the value of 'CONVFMT' only allows -two significant digits. This test fails, because '"12.15"' is different -from '"12.153"'. - - According to the rules for conversions (*note Conversion::), integer -values always convert to strings as integers, no matter what the value -of 'CONVFMT' may happen to be. So the usual case of the following -works: - - for (i = 1; i <= maxsub; i++) - do something with array[i] - - The "integer values always convert to strings as integers" rule has -an additional consequence for array indexing. Octal and hexadecimal -constants (*note Nondecimal-numbers::) are converted internally into -numbers, and their original form is forgotten. This means, for example, -that 'array[17]', 'array[021]', and 'array[0x11]' all refer to the same -element! - - As with many things in 'awk', the majority of the time things work as -you would expect them to. But it is useful to have a precise knowledge -of the actual rules, as they can sometimes have a subtle effect on your -programs. - - -File: gawk.info, Node: Uninitialized Subscripts, Next: Delete, Prev: Numeric Array Subscripts, Up: Arrays - -8.3 Using Uninitialized Variables as Subscripts -=============================================== - -Suppose it's necessary to write a program to print the input data in -reverse order. A reasonable attempt to do so (with some test data) -might look like this: - - $ echo 'line 1 - > line 2 - > line 3' | awk '{ l[lines] = $0; ++lines } - > END { - > for (i = lines - 1; i >= 0; i--) - > print l[i] - > }' - -| line 3 - -| line 2 - - Unfortunately, the very first line of input data did not appear in -the output! - - Upon first glance, we would think that this program should have -worked. The variable 'lines' is uninitialized, and uninitialized -variables have the numeric value zero. So, 'awk' should have printed -the value of 'l[0]'. - - The issue here is that subscripts for 'awk' arrays are _always_ -strings. Uninitialized variables, when used as strings, have the value -'""', not zero. Thus, 'line 1' ends up stored in 'l[""]'. The -following version of the program works correctly: - - { l[lines++] = $0 } - END { - for (i = lines - 1; i >= 0; i--) - print l[i] - } - - Here, the '++' forces 'lines' to be numeric, thus making the "old -value" numeric zero. This is then converted to '"0"' as the array -subscript. - - Even though it is somewhat unusual, the null string ('""') is a valid -array subscript. (d.c.) 'gawk' warns about the use of the null string -as a subscript if '--lint' is provided on the command line (*note -Options::). - - -File: gawk.info, Node: Delete, Next: Multidimensional, Prev: Uninitialized Subscripts, Up: Arrays - -8.4 The 'delete' Statement -========================== - -To remove an individual element of an array, use the 'delete' statement: - - delete ARRAY[INDEX-EXPRESSION] - - Once an array element has been deleted, any value the element once -had is no longer available. It is as if the element had never been -referred to or been given a value. The following is an example of -deleting elements in an array: - - for (i in frequencies) - delete frequencies[i] - -This example removes all the elements from the array 'frequencies'. -Once an element is deleted, a subsequent 'for' statement to scan the -array does not report that element and using the 'in' operator to check -for the presence of that element returns zero (i.e., false): - - delete foo[4] - if (4 in foo) - print "This will never be printed" - - It is important to note that deleting an element is _not_ the same as -assigning it a null value (the empty string, '""'). For example: - - foo[4] = "" - if (4 in foo) - print "This is printed, even though foo[4] is empty" - - It is not an error to delete an element that does not exist. -However, if '--lint' is provided on the command line (*note Options::), -'gawk' issues a warning message when an element that is not in the array -is deleted. - - All the elements of an array may be deleted with a single statement -by leaving off the subscript in the 'delete' statement, as follows: - - delete ARRAY - - Using this version of the 'delete' statement is about three times -more efficient than the equivalent loop that deletes each element one at -a time. - - This form of the 'delete' statement is also supported by BWK 'awk' -and 'mawk', as well as by a number of other implementations. - - NOTE: For many years, using 'delete' without a subscript was a - common extension. In September 2012, it was accepted for inclusion - into the POSIX standard. See the Austin Group website - (http://austingroupbugs.net/view.php?id=544). - - The following statement provides a portable but nonobvious way to -clear out an array:(1) - - split("", array) - - The 'split()' function (*note String Functions::) clears out the -target array first. This call asks it to split apart the null string. -Because there is no data to split out, the function simply clears the -array and then returns. - - CAUTION: Deleting all the elements from an array does not change - its type; you cannot clear an array and then use the array's name - as a scalar (i.e., a regular variable). For example, the following - does not work: - - a[1] = 3 - delete a - a = 3 - - ---------- Footnotes ---------- - - (1) Thanks to Michael Brennan for pointing this out. - - -File: gawk.info, Node: Multidimensional, Next: Arrays of Arrays, Prev: Delete, Up: Arrays - -8.5 Multidimensional Arrays -=========================== - -* Menu: - -* Multiscanning:: Scanning multidimensional arrays. - -A "multidimensional array" is an array in which an element is identified -by a sequence of indices instead of a single index. For example, a -two-dimensional array requires two indices. The usual way (in many -languages, including 'awk') to refer to an element of a two-dimensional -array named 'grid' is with 'grid[X,Y]'. - - Multidimensional arrays are supported in 'awk' through concatenation -of indices into one string. 'awk' converts the indices into strings -(*note Conversion::) and concatenates them together, with a separator -between them. This creates a single string that describes the values of -the separate indices. The combined string is used as a single index -into an ordinary, one-dimensional array. The separator used is the -value of the built-in variable 'SUBSEP'. - - For example, suppose we evaluate the expression 'foo[5,12] = "value"' -when the value of 'SUBSEP' is '"@"'. The numbers 5 and 12 are converted -to strings and concatenated with an '@' between them, yielding '"5@12"'; -thus, the array element 'foo["5@12"]' is set to '"value"'. - - Once the element's value is stored, 'awk' has no record of whether it -was stored with a single index or a sequence of indices. The two -expressions 'foo[5,12]' and 'foo[5 SUBSEP 12]' are always equivalent. - - The default value of 'SUBSEP' is the string '"\034"', which contains -a nonprinting character that is unlikely to appear in an 'awk' program -or in most input data. The usefulness of choosing an unlikely character -comes from the fact that index values that contain a string matching -'SUBSEP' can lead to combined strings that are ambiguous. Suppose that -'SUBSEP' is '"@"'; then 'foo["a@b", "c"]' and 'foo["a", "b@c"]' are -indistinguishable because both are actually stored as 'foo["a@b@c"]'. - - To test whether a particular index sequence exists in a -multidimensional array, use the same operator ('in') that is used for -single-dimensional arrays. Write the whole sequence of indices in -parentheses, separated by commas, as the left operand: - - if ((SUBSCRIPT1, SUBSCRIPT2, ...) in ARRAY) - ... - - Here is an example that treats its input as a two-dimensional array -of fields; it rotates this array 90 degrees clockwise and prints the -result. It assumes that all lines have the same number of elements: - - { - if (max_nf < NF) - max_nf = NF - max_nr = NR - for (x = 1; x <= NF; x++) - vector[x, NR] = $x - } - - END { - for (x = 1; x <= max_nf; x++) { - for (y = max_nr; y >= 1; --y) - printf("%s ", vector[x, y]) - printf("\n") - } - } - -When given the input: - - 1 2 3 4 5 6 - 2 3 4 5 6 1 - 3 4 5 6 1 2 - 4 5 6 1 2 3 - -the program produces the following output: - - 4 3 2 1 - 5 4 3 2 - 6 5 4 3 - 1 6 5 4 - 2 1 6 5 - 3 2 1 6 - - -File: gawk.info, Node: Multiscanning, Up: Multidimensional - -8.5.1 Scanning Multidimensional Arrays --------------------------------------- - -There is no special 'for' statement for scanning a "multidimensional" -array. There cannot be one, because, in truth, 'awk' does not have -multidimensional arrays or elements--there is only a multidimensional -_way of accessing_ an array. - - However, if your program has an array that is always accessed as -multidimensional, you can get the effect of scanning it by combining the -scanning 'for' statement (*note Scanning an Array::) with the built-in -'split()' function (*note String Functions::). It works in the -following manner: - - for (combined in array) { - split(combined, separate, SUBSEP) - ... - } - -This sets the variable 'combined' to each concatenated combined index in -the array, and splits it into the individual indices by breaking it -apart where the value of 'SUBSEP' appears. The individual indices then -become the elements of the array 'separate'. - - Thus, if a value is previously stored in 'array[1, "foo"]', then an -element with index '"1\034foo"' exists in 'array'. (Recall that the -default value of 'SUBSEP' is the character with code 034.) Sooner or -later, the 'for' statement finds that index and does an iteration with -the variable 'combined' set to '"1\034foo"'. Then the 'split()' -function is called as follows: - - split("1\034foo", separate, "\034") - -The result is to set 'separate[1]' to '"1"' and 'separate[2]' to -'"foo"'. Presto! The original sequence of separate indices is -recovered. - - -File: gawk.info, Node: Arrays of Arrays, Next: Arrays Summary, Prev: Multidimensional, Up: Arrays - -8.6 Arrays of Arrays -==================== - -'gawk' goes beyond standard 'awk''s multidimensional array access and -provides true arrays of arrays. Elements of a subarray are referred to -by their own indices enclosed in square brackets, just like the elements -of the main array. For example, the following creates a two-element -subarray at index '1' of the main array 'a': - - a[1][1] = 1 - a[1][2] = 2 - - This simulates a true two-dimensional array. Each subarray element -can contain another subarray as a value, which in turn can hold other -arrays as well. In this way, you can create arrays of three or more -dimensions. The indices can be any 'awk' expressions, including scalars -separated by commas (i.e., a regular 'awk' simulated multidimensional -subscript). So the following is valid in 'gawk': - - a[1][3][1, "name"] = "barney" - - Each subarray and the main array can be of different length. In -fact, the elements of an array or its subarray do not all have to have -the same type. This means that the main array and any of its subarrays -can be nonrectangular, or jagged in structure. You can assign a scalar -value to the index '4' of the main array 'a', even though 'a[1]' is -itself an array and not a scalar: - - a[4] = "An element in a jagged array" - - The terms "dimension", "row", and "column" are meaningless when -applied to such an array, but we will use "dimension" henceforth to -imply the maximum number of indices needed to refer to an existing -element. The type of any element that has already been assigned cannot -be changed by assigning a value of a different type. You have to first -delete the current element, which effectively makes 'gawk' forget about -the element at that index: - - delete a[4] - a[4][5][6][7] = "An element in a four-dimensional array" - -This removes the scalar value from index '4' and then inserts a -three-level nested subarray containing a scalar. You can also delete an -entire subarray or subarray of subarrays: - - delete a[4][5] - a[4][5] = "An element in subarray a[4]" - - But recall that you can not delete the main array 'a' and then use it -as a scalar. - - The built-in functions that take array arguments can also be used -with subarrays. For example, the following code fragment uses -'length()' (*note String Functions::) to determine the number of -elements in the main array 'a' and its subarrays: - - print length(a), length(a[1]), length(a[1][3]) - -This results in the following output for our main array 'a': - - 2, 3, 1 - -The 'SUBSCRIPT in ARRAY' expression (*note Reference to Elements::) -works similarly for both regular 'awk'-style arrays and arrays of -arrays. For example, the tests '1 in a', '3 in a[1]', and '(1, "name") -in a[1][3]' all evaluate to one (true) for our array 'a'. - - The 'for (item in array)' statement (*note Scanning an Array::) can -be nested to scan all the elements of an array of arrays if it is -rectangular in structure. In order to print the contents (scalar -values) of a two-dimensional array of arrays (i.e., in which each -first-level element is itself an array, not necessarily of the same -length), you could use the following code: - - for (i in array) - for (j in array[i]) - print array[i][j] - - The 'isarray()' function (*note Type Functions::) lets you test if an -array element is itself an array: - - for (i in array) { - if (isarray(array[i]) { - for (j in array[i]) { - print array[i][j] - } - } - else - print array[i] - } - - If the structure of a jagged array of arrays is known in advance, you -can often devise workarounds using control statements. For example, the -following code prints the elements of our main array 'a': - - for (i in a) { - for (j in a[i]) { - if (j == 3) { - for (k in a[i][j]) - print a[i][j][k] - } else - print a[i][j] - } - } - -*Note Walking Arrays:: for a user-defined function that "walks" an -arbitrarily dimensioned array of arrays. - - Recall that a reference to an uninitialized array element yields a -value of '""', the null string. This has one important implication when -you intend to use a subarray as an argument to a function, as -illustrated by the following example: - - $ gawk 'BEGIN { split("a b c d", b[1]); print b[1][1] }' - error-> gawk: cmd. line:1: fatal: split: second argument is not an array - - The way to work around this is to first force 'b[1]' to be an array -by creating an arbitrary index: - - $ gawk 'BEGIN { b[1][1] = ""; split("a b c d", b[1]); print b[1][1] }' - -| a - - -File: gawk.info, Node: Arrays Summary, Prev: Arrays of Arrays, Up: Arrays - -8.7 Summary -=========== - - * Standard 'awk' provides one-dimensional associative arrays (arrays - indexed by string values). All arrays are associative; numeric - indices are converted automatically to strings. - - * Array elements are referenced as 'ARRAY[INDX]'. Referencing an - element creates it if it did not exist previously. - - * The proper way to see if an array has an element with a given index - is to use the 'in' operator: 'INDX in ARRAY'. - - * Use 'for (INDX in ARRAY) ...' to scan through all the individual - elements of an array. In the body of the loop, INDX takes on the - value of each element's index in turn. - - * The order in which a 'for (INDX in ARRAY)' loop traverses an array - is undefined in POSIX 'awk' and varies among implementations. - 'gawk' lets you control the order by assigning special predefined - values to 'PROCINFO["sorted_in"]'. - - * Use 'delete ARRAY[INDX]' to delete an individual element. To - delete all of the elements in an array, use 'delete ARRAY'. This - latter feature has been a common extension for many years and is - now standard, but may not be supported by all commercial versions - of 'awk'. - - * Standard 'awk' simulates multidimensional arrays by separating - subscript values with commas. The values are concatenated into a - single string, separated by the value of 'SUBSEP'. The fact that - such a subscript was created in this way is not retained; thus, - changing 'SUBSEP' may have unexpected consequences. You can use - '(SUB1, SUB2, ...) in ARRAY' to see if such a multidimensional - subscript exists in ARRAY. - - * 'gawk' provides true arrays of arrays. You use a separate set of - square brackets for each dimension in such an array: - 'data[row][col]', for example. Array elements may thus be either - scalar values (number or string) or other arrays. - - * Use the 'isarray()' built-in function to determine if an array - element is itself a subarray. - - -File: gawk.info, Node: Functions, Next: Library Functions, Prev: Arrays, Up: Top - -9 Functions -*********** - -This major node describes 'awk''s built-in functions, which fall into -three categories: numeric, string, and I/O. 'gawk' provides additional -groups of functions to work with values that represent time, do bit -manipulation, sort arrays, provide type information, and -internationalize and localize programs. - - Besides the built-in functions, 'awk' has provisions for writing new -functions that the rest of a program can use. The second half of this -major node describes these "user-defined" functions. Finally, we -explore indirect function calls, a 'gawk'-specific extension that lets -you determine at runtime what function is to be called. - -* Menu: - -* Built-in:: Summarizes the built-in functions. -* User-defined:: Describes User-defined functions in detail. -* Indirect Calls:: Choosing the function to call at runtime. -* Functions Summary:: Summary of functions. - - -File: gawk.info, Node: Built-in, Next: User-defined, Up: Functions - -9.1 Built-in Functions -====================== - -"Built-in" functions are always available for your 'awk' program to -call. This minor node defines all the built-in functions in 'awk'; some -of these are mentioned in other minor nodes but are summarized here for -your convenience. - -* Menu: - -* Calling Built-in:: How to call built-in functions. -* Numeric Functions:: Functions that work with numbers, including - 'int()', 'sin()' and 'rand()'. -* String Functions:: Functions for string manipulation, such as - 'split()', 'match()' and - 'sprintf()'. -* I/O Functions:: Functions for files and shell commands. -* Time Functions:: Functions for dealing with timestamps. -* Bitwise Functions:: Functions for bitwise operations. -* Type Functions:: Functions for type information. -* I18N Functions:: Functions for string translation. - - -File: gawk.info, Node: Calling Built-in, Next: Numeric Functions, Up: Built-in - -9.1.1 Calling Built-in Functions --------------------------------- - -To call one of 'awk''s built-in functions, write the name of the -function followed by arguments in parentheses. For example, 'atan2(y + -z, 1)' is a call to the function 'atan2()' and has two arguments. - - Whitespace is ignored between the built-in function name and the -opening parenthesis, but nonetheless it is good practice to avoid using -whitespace there. User-defined functions do not permit whitespace in -this way, and it is easier to avoid mistakes by following a simple -convention that always works--no whitespace after a function name. - - Each built-in function accepts a certain number of arguments. In -some cases, arguments can be omitted. The defaults for omitted -arguments vary from function to function and are described under the -individual functions. In some 'awk' implementations, extra arguments -given to built-in functions are ignored. However, in 'gawk', it is a -fatal error to give extra arguments to a built-in function. - - When a function is called, expressions that create the function's -actual parameters are evaluated completely before the call is performed. -For example, in the following code fragment: - - i = 4 - j = sqrt(i++) - -the variable 'i' is incremented to the value five before 'sqrt()' is -called with a value of four for its actual parameter. The order of -evaluation of the expressions used for the function's parameters is -undefined. Thus, avoid writing programs that assume that parameters are -evaluated from left to right or from right to left. For example: - - i = 5 - j = atan2(++i, i *= 2) - - If the order of evaluation is left to right, then 'i' first becomes -six, and then 12, and 'atan2()' is called with the two arguments six and -12. But if the order of evaluation is right to left, 'i' first becomes -10, then 11, and 'atan2()' is called with the two arguments 11 and 10. - - -File: gawk.info, Node: Numeric Functions, Next: String Functions, Prev: Calling Built-in, Up: Built-in - -9.1.2 Numeric Functions ------------------------ - -The following list describes all of the built-in functions that work -with numbers. Optional parameters are enclosed in square -brackets ([ ]): - -'atan2(Y, X)' - Return the arctangent of 'Y / X' in radians. You can use 'pi = - atan2(0, -1)' to retrieve the value of pi. - -'cos(X)' - Return the cosine of X, with X in radians. - -'exp(X)' - Return the exponential of X ('e ^ X') or report an error if X is - out of range. The range of values X can have depends on your - machine's floating-point representation. - -'int(X)' - Return the nearest integer to X, located between X and zero and - truncated toward zero. For example, 'int(3)' is 3, 'int(3.9)' is - 3, 'int(-3.9)' is -3, and 'int(-3)' is -3 as well. - -'intdiv(NUMERATOR, DENOMINATOR, RESULT)' - Perform integer division, similar to the standard C function of the - same name. First, truncate 'numerator' and 'denominator' towards - zero, creating integer values. Clear the 'result' array, and then - set 'result["quotient"]' to the result of 'numerator / - denominator', truncated towards zero to an integer, and set - 'result["remainder"]' to the result of 'numerator % denominator', - truncated towards zero to an integer. This function is primarily - intended for use with arbitrary length integers; it avoids creating - MPFR arbitrary precision floating-point values (*note Arbitrary - Precision Integers::). - - This function is a 'gawk' extension. It is not available in - compatibility mode (*note Options::). - -'log(X)' - Return the natural logarithm of X, if X is positive; otherwise, - return 'NaN' ("not a number") on IEEE 754 systems. Additionally, - 'gawk' prints a warning message when 'x' is negative. - -'rand()' - Return a random number. The values of 'rand()' are uniformly - distributed between zero and one. The value could be zero but is - never one.(1) - - Often random integers are needed instead. Following is a - user-defined function that can be used to obtain a random - nonnegative integer less than N: - - function randint(n) - { - return int(n * rand()) - } - - The multiplication produces a random number greater than or equal - to zero and less than 'n'. Using 'int()', this result is made into - an integer between zero and 'n' - 1, inclusive. - - The following example uses a similar function to produce random - integers between one and N. This program prints a new random - number for each input record: - - # Function to roll a simulated die. - function roll(n) { return 1 + int(rand() * n) } - - # Roll 3 six-sided dice and - # print total number of points. - { - printf("%d points\n", roll(6) + roll(6) + roll(6)) - } - - CAUTION: In most 'awk' implementations, including 'gawk', - 'rand()' starts generating numbers from the same starting - number, or "seed", each time you run 'awk'.(2) Thus, a - program generates the same results each time you run it. The - numbers are random within one 'awk' run but predictable from - run to run. This is convenient for debugging, but if you want - a program to do different things each time it is used, you - must change the seed to a value that is different in each run. - To do this, use 'srand()'. - -'sin(X)' - Return the sine of X, with X in radians. - -'sqrt(X)' - Return the positive square root of X. 'gawk' prints a warning - message if X is negative. Thus, 'sqrt(4)' is 2. - -'srand('[X]')' - Set the starting point, or seed, for generating random numbers to - the value X. - - Each seed value leads to a particular sequence of random - numbers.(3) Thus, if the seed is set to the same value a second - time, the same sequence of random numbers is produced again. - - CAUTION: Different 'awk' implementations use different - random-number generators internally. Don't expect the same - 'awk' program to produce the same series of random numbers - when executed by different versions of 'awk'. - - If the argument X is omitted, as in 'srand()', then the current - date and time of day are used for a seed. This is the way to get - random numbers that are truly unpredictable. - - The return value of 'srand()' is the previous seed. This makes it - easy to keep track of the seeds in case you need to consistently - reproduce sequences of random numbers. - - POSIX does not specify the initial seed; it differs among 'awk' - implementations. - - ---------- Footnotes ---------- - - (1) The C version of 'rand()' on many Unix systems is known to -produce fairly poor sequences of random numbers. However, nothing -requires that an 'awk' implementation use the C 'rand()' to implement -the 'awk' version of 'rand()'. In fact, 'gawk' uses the BSD 'random()' -function, which is considerably better than 'rand()', to produce random -numbers. - - (2) 'mawk' uses a different seed each time. - - (3) Computer-generated random numbers really are not truly random. -They are technically known as "pseudorandom". This means that although -the numbers in a sequence appear to be random, you can in fact generate -the same sequence of random numbers over and over again. - - -File: gawk.info, Node: String Functions, Next: I/O Functions, Prev: Numeric Functions, Up: Built-in - -9.1.3 String-Manipulation Functions ------------------------------------ - -The functions in this minor node look at or change the text of one or -more strings. - - 'gawk' understands locales (*note Locales::) and does all string -processing in terms of _characters_, not _bytes_. This distinction is -particularly important to understand for locales where one character may -be represented by multiple bytes. Thus, for example, 'length()' returns -the number of characters in a string, and not the number of bytes used -to represent those characters. Similarly, 'index()' works with -character indices, and not byte indices. - - CAUTION: A number of functions deal with indices into strings. For - these functions, the first character of a string is at position - (index) one. This is different from C and the languages descended - from it, where the first character is at position zero. You need - to remember this when doing index calculations, particularly if you - are used to C. - - In the following list, optional parameters are enclosed in square -brackets ([ ]). Several functions perform string substitution; the full -discussion is provided in the description of the 'sub()' function, which -comes toward the end, because the list is presented alphabetically. - - Those functions that are specific to 'gawk' are marked with a pound -sign ('#'). They are not available in compatibility mode (*note -Options::): - -* Menu: - -* Gory Details:: More than you want to know about '\' and - '&' with 'sub()', 'gsub()', and - 'gensub()'. - -'asort('SOURCE [',' DEST [',' HOW ] ]') #' -'asorti('SOURCE [',' DEST [',' HOW ] ]') #' - These two functions are similar in behavior, so they are described - together. - - NOTE: The following description ignores the third argument, - HOW, as it requires understanding features that we have not - discussed yet. Thus, the discussion here is a deliberate - simplification. (We do provide all the details later on; see - *note Array Sorting Functions:: for the full story.) - - Both functions return the number of elements in the array SOURCE. - For 'asort()', 'gawk' sorts the values of SOURCE and replaces the - indices of the sorted values of SOURCE with sequential integers - starting with one. If the optional array DEST is specified, then - SOURCE is duplicated into DEST. DEST is then sorted, leaving the - indices of SOURCE unchanged. - - When comparing strings, 'IGNORECASE' affects the sorting (*note - Array Sorting Functions::). If the SOURCE array contains subarrays - as values (*note Arrays of Arrays::), they will come last, after - all scalar values. Subarrays are _not_ recursively sorted. - - For example, if the contents of 'a' are as follows: - - a["last"] = "de" - a["first"] = "sac" - a["middle"] = "cul" - - A call to 'asort()': - - asort(a) - - results in the following contents of 'a': - - a[1] = "cul" - a[2] = "de" - a[3] = "sac" - - The 'asorti()' function works similarly to 'asort()'; however, the - _indices_ are sorted, instead of the values. Thus, in the previous - example, starting with the same initial set of indices and values - in 'a', calling 'asorti(a)' would yield: - - a[1] = "first" - a[2] = "last" - a[3] = "middle" - -'gensub(REGEXP, REPLACEMENT, HOW' [', TARGET']') #' - Search the target string TARGET for matches of the regular - expression REGEXP. If HOW is a string beginning with 'g' or 'G' - (short for "global"), then replace all matches of REGEXP with - REPLACEMENT. Otherwise, HOW is treated as a number indicating - which match of REGEXP to replace. If no TARGET is supplied, use - '$0'. It returns the modified string as the result of the function - and the original target string is _not_ changed. - - 'gensub()' is a general substitution function. Its purpose is to - provide more features than the standard 'sub()' and 'gsub()' - functions. - - 'gensub()' provides an additional feature that is not available in - 'sub()' or 'gsub()': the ability to specify components of a regexp - in the replacement text. This is done by using parentheses in the - regexp to mark the components and then specifying '\N' in the - replacement text, where N is a digit from 1 to 9. For example: - - $ gawk ' - > BEGIN { - > a = "abc def" - > b = gensub(/(.+) (.+)/, "\\2 \\1", "g", a) - > print b - > }' - -| def abc - - As with 'sub()', you must type two backslashes in order to get one - into the string. In the replacement text, the sequence '\0' - represents the entire matched text, as does the character '&'. - - The following example shows how you can use the third argument to - control which match of the regexp should be changed: - - $ echo a b c a b c | - > gawk '{ print gensub(/a/, "AA", 2) }' - -| a b c AA b c - - In this case, '$0' is the default target string. 'gensub()' - returns the new string as its result, which is passed directly to - 'print' for printing. - - If the HOW argument is a string that does not begin with 'g' or - 'G', or if it is a number that is less than or equal to zero, only - one substitution is performed. If HOW is zero, 'gawk' issues a - warning message. - - If REGEXP does not match TARGET, 'gensub()''s return value is the - original unchanged value of TARGET. - -'gsub(REGEXP, REPLACEMENT' [', TARGET']')' - Search TARGET for _all_ of the longest, leftmost, _nonoverlapping_ - matching substrings it can find and replace them with REPLACEMENT. - The 'g' in 'gsub()' stands for "global," which means replace - everywhere. For example: - - { gsub(/Britain/, "United Kingdom"); print } - - replaces all occurrences of the string 'Britain' with 'United - Kingdom' for all input records. - - The 'gsub()' function returns the number of substitutions made. If - the variable to search and alter (TARGET) is omitted, then the - entire input record ('$0') is used. As in 'sub()', the characters - '&' and '\' are special, and the third argument must be assignable. - -'index(IN, FIND)' - Search the string IN for the first occurrence of the string FIND, - and return the position in characters where that occurrence begins - in the string IN. Consider the following example: - - $ awk 'BEGIN { print index("peanut", "an") }' - -| 3 - - If FIND is not found, 'index()' returns zero. - - With BWK 'awk' and 'gawk', it is a fatal error to use a regexp - constant for FIND. Other implementations allow it, simply treating - the regexp constant as an expression meaning '$0 ~ /regexp/'. - (d.c.) - -'length('[STRING]')' - Return the number of characters in STRING. If STRING is a number, - the length of the digit string representing that number is - returned. For example, 'length("abcde")' is five. By contrast, - 'length(15 * 35)' works out to three. In this example, 15 * 35 = - 525, and 525 is then converted to the string '"525"', which has - three characters. - - If no argument is supplied, 'length()' returns the length of '$0'. - - NOTE: In older versions of 'awk', the 'length()' function - could be called without any parentheses. Doing so is - considered poor practice, although the 2008 POSIX standard - explicitly allows it, to support historical practice. For - programs to be maximally portable, always supply the - parentheses. - - If 'length()' is called with a variable that has not been used, - 'gawk' forces the variable to be a scalar. Other implementations - of 'awk' leave the variable without a type. (d.c.) Consider: - - $ gawk 'BEGIN { print length(x) ; x[1] = 1 }' - -| 0 - error-> gawk: fatal: attempt to use scalar `x' as array - - $ nawk 'BEGIN { print length(x) ; x[1] = 1 }' - -| 0 - - If '--lint' has been specified on the command line, 'gawk' issues a - warning about this. - - With 'gawk' and several other 'awk' implementations, when given an - array argument, the 'length()' function returns the number of - elements in the array. (c.e.) This is less useful than it might - seem at first, as the array is not guaranteed to be indexed from - one to the number of elements in it. If '--lint' is provided on - the command line (*note Options::), 'gawk' warns that passing an - array argument is not portable. If '--posix' is supplied, using an - array argument is a fatal error (*note Arrays::). - -'match(STRING, REGEXP' [', ARRAY']')' - Search STRING for the longest, leftmost substring matched by the - regular expression REGEXP and return the character position (index) - at which that substring begins (one, if it starts at the beginning - of STRING). If no match is found, return zero. - - The REGEXP argument may be either a regexp constant ('/'...'/') or - a string constant ('"'...'"'). In the latter case, the string is - treated as a regexp to be matched. *Note Computed Regexps:: for a - discussion of the difference between the two forms, and the - implications for writing your program correctly. - - The order of the first two arguments is the opposite of most other - string functions that work with regular expressions, such as - 'sub()' and 'gsub()'. It might help to remember that for - 'match()', the order is the same as for the '~' operator: 'STRING ~ - REGEXP'. - - The 'match()' function sets the predefined variable 'RSTART' to the - index. It also sets the predefined variable 'RLENGTH' to the - length in characters of the matched substring. If no match is - found, 'RSTART' is set to zero, and 'RLENGTH' to -1. - - For example: - - { - if ($1 == "FIND") - regex = $2 - else { - where = match($0, regex) - if (where != 0) - print "Match of", regex, "found at", where, "in", $0 - } - } - - This program looks for lines that match the regular expression - stored in the variable 'regex'. This regular expression can be - changed. If the first word on a line is 'FIND', 'regex' is changed - to be the second word on that line. Therefore, if given: - - FIND ru+n - My program runs - but not very quickly - FIND Melvin - JF+KM - This line is property of Reality Engineering Co. - Melvin was here. - - 'awk' prints: - - Match of ru+n found at 12 in My program runs - Match of Melvin found at 1 in Melvin was here. - - If ARRAY is present, it is cleared, and then the zeroth element of - ARRAY is set to the entire portion of STRING matched by REGEXP. If - REGEXP contains parentheses, the integer-indexed elements of ARRAY - are set to contain the portion of STRING matching the corresponding - parenthesized subexpression. For example: - - $ echo foooobazbarrrrr | - > gawk '{ match($0, /(fo+).+(bar*)/, arr) - > print arr[1], arr[2] }' - -| foooo barrrrr - - In addition, multidimensional subscripts are available providing - the start index and length of each matched subexpression: - - $ echo foooobazbarrrrr | - > gawk '{ match($0, /(fo+).+(bar*)/, arr) - > print arr[1], arr[2] - > print arr[1, "start"], arr[1, "length"] - > print arr[2, "start"], arr[2, "length"] - > }' - -| foooo barrrrr - -| 1 5 - -| 9 7 - - There may not be subscripts for the start and index for every - parenthesized subexpression, because they may not all have matched - text; thus, they should be tested for with the 'in' operator (*note - Reference to Elements::). - - The ARRAY argument to 'match()' is a 'gawk' extension. In - compatibility mode (*note Options::), using a third argument is a - fatal error. - -'patsplit(STRING, ARRAY' [', FIELDPAT' [', SEPS' ] ]') #' - Divide STRING into pieces defined by FIELDPAT and store the pieces - in ARRAY and the separator strings in the SEPS array. The first - piece is stored in 'ARRAY[1]', the second piece in 'ARRAY[2]', and - so forth. The third argument, FIELDPAT, is a regexp describing the - fields in STRING (just as 'FPAT' is a regexp describing the fields - in input records). It may be either a regexp constant or a string. - If FIELDPAT is omitted, the value of 'FPAT' is used. 'patsplit()' - returns the number of elements created. 'SEPS[I]' is the separator - string between 'ARRAY[I]' and 'ARRAY[I+1]'. Any leading separator - will be in 'SEPS[0]'. - - The 'patsplit()' function splits strings into pieces in a manner - similar to the way input lines are split into fields using 'FPAT' - (*note Splitting By Content::). - - Before splitting the string, 'patsplit()' deletes any previously - existing elements in the arrays ARRAY and SEPS. - -'split(STRING, ARRAY' [', FIELDSEP' [', SEPS' ] ]')' - Divide STRING into pieces separated by FIELDSEP and store the - pieces in ARRAY and the separator strings in the SEPS array. The - first piece is stored in 'ARRAY[1]', the second piece in - 'ARRAY[2]', and so forth. The string value of the third argument, - FIELDSEP, is a regexp describing where to split STRING (much as - 'FS' can be a regexp describing where to split input records). If - FIELDSEP is omitted, the value of 'FS' is used. 'split()' returns - the number of elements created. SEPS is a 'gawk' extension, with - 'SEPS[I]' being the separator string between 'ARRAY[I]' and - 'ARRAY[I+1]'. If FIELDSEP is a single space, then any leading - whitespace goes into 'SEPS[0]' and any trailing whitespace goes - into 'SEPS[N]', where N is the return value of 'split()' (i.e., the - number of elements in ARRAY). - - The 'split()' function splits strings into pieces in a manner - similar to the way input lines are split into fields. For example: - - split("cul-de-sac", a, "-", seps) - - splits the string '"cul-de-sac"' into three fields using '-' as the - separator. It sets the contents of the array 'a' as follows: - - a[1] = "cul" - a[2] = "de" - a[3] = "sac" - - and sets the contents of the array 'seps' as follows: - - seps[1] = "-" - seps[2] = "-" - - The value returned by this call to 'split()' is three. - - As with input field-splitting, when the value of FIELDSEP is '" "', - leading and trailing whitespace is ignored in values assigned to - the elements of ARRAY but not in SEPS, and the elements are - separated by runs of whitespace. Also, as with input field - splitting, if FIELDSEP is the null string, each individual - character in the string is split into its own array element. - (c.e.) - - Note, however, that 'RS' has no effect on the way 'split()' works. - Even though 'RS = ""' causes the newline character to also be an - input field separator, this does not affect how 'split()' splits - strings. - - Modern implementations of 'awk', including 'gawk', allow the third - argument to be a regexp constant ('/'...'/') as well as a string. - (d.c.) The POSIX standard allows this as well. *Note Computed - Regexps:: for a discussion of the difference between using a string - constant or a regexp constant, and the implications for writing - your program correctly. - - Before splitting the string, 'split()' deletes any previously - existing elements in the arrays ARRAY and SEPS. - - If STRING is null, the array has no elements. (So this is a - portable way to delete an entire array with one statement. *Note - Delete::.) - - If STRING does not match FIELDSEP at all (but is not null), ARRAY - has one element only. The value of that element is the original - STRING. - - In POSIX mode (*note Options::), the fourth argument is not - allowed. - -'sprintf(FORMAT, EXPRESSION1, ...)' - Return (without printing) the string that 'printf' would have - printed out with the same arguments (*note Printf::). For example: - - pival = sprintf("pi = %.2f (approx.)", 22/7) - - assigns the string 'pi = 3.14 (approx.)' to the variable 'pival'. - -'strtonum(STR) #' - Examine STR and return its numeric value. If STR begins with a - leading '0', 'strtonum()' assumes that STR is an octal number. If - STR begins with a leading '0x' or '0X', 'strtonum()' assumes that - STR is a hexadecimal number. For example: - - $ echo 0x11 | - > gawk '{ printf "%d\n", strtonum($1) }' - -| 17 - - Using the 'strtonum()' function is _not_ the same as adding zero to - a string value; the automatic coercion of strings to numbers works - only for decimal data, not for octal or hexadecimal.(1) - - Note also that 'strtonum()' uses the current locale's decimal point - for recognizing numbers (*note Locales::). - -'sub(REGEXP, REPLACEMENT' [', TARGET']')' - Search TARGET, which is treated as a string, for the leftmost, - longest substring matched by the regular expression REGEXP. Modify - the entire string by replacing the matched text with REPLACEMENT. - The modified string becomes the new value of TARGET. Return the - number of substitutions made (zero or one). - - The REGEXP argument may be either a regexp constant ('/'...'/') or - a string constant ('"'...'"'). In the latter case, the string is - treated as a regexp to be matched. *Note Computed Regexps:: for a - discussion of the difference between the two forms, and the - implications for writing your program correctly. - - This function is peculiar because TARGET is not simply used to - compute a value, and not just any expression will do--it must be a - variable, field, or array element so that 'sub()' can store a - modified value there. If this argument is omitted, then the - default is to use and alter '$0'.(2) For example: - - str = "water, water, everywhere" - sub(/at/, "ith", str) - - sets 'str' to 'wither, water, everywhere', by replacing the - leftmost longest occurrence of 'at' with 'ith'. - - If the special character '&' appears in REPLACEMENT, it stands for - the precise substring that was matched by REGEXP. (If the regexp - can match more than one string, then this precise substring may - vary.) For example: - - { sub(/candidate/, "& and his wife"); print } - - changes the first occurrence of 'candidate' to 'candidate and his - wife' on each input line. Here is another example: - - $ awk 'BEGIN { - > str = "daabaaa" - > sub(/a+/, "C&C", str) - > print str - > }' - -| dCaaCbaaa - - This shows how '&' can represent a nonconstant string and also - illustrates the "leftmost, longest" rule in regexp matching (*note - Leftmost Longest::). - - The effect of this special character ('&') can be turned off by - putting a backslash before it in the string. As usual, to insert - one backslash in the string, you must write two backslashes. - Therefore, write '\\&' in a string constant to include a literal - '&' in the replacement. For example, the following shows how to - replace the first '|' on each line with an '&': - - { sub(/\|/, "\\&"); print } - - As mentioned, the third argument to 'sub()' must be a variable, - field, or array element. Some versions of 'awk' allow the third - argument to be an expression that is not an lvalue. In such a - case, 'sub()' still searches for the pattern and returns zero or - one, but the result of the substitution (if any) is thrown away - because there is no place to put it. Such versions of 'awk' accept - expressions like the following: - - sub(/USA/, "United States", "the USA and Canada") - - For historical compatibility, 'gawk' accepts such erroneous code. - However, using any other nonchangeable object as the third - parameter causes a fatal error and your program will not run. - - Finally, if the REGEXP is not a regexp constant, it is converted - into a string, and then the value of that string is treated as the - regexp to match. - -'substr(STRING, START' [', LENGTH' ]')' - Return a LENGTH-character-long substring of STRING, starting at - character number START. The first character of a string is - character number one.(3) For example, 'substr("washington", 5, 3)' - returns '"ing"'. - - If LENGTH is not present, 'substr()' returns the whole suffix of - STRING that begins at character number START. For example, - 'substr("washington", 5)' returns '"ington"'. The whole suffix is - also returned if LENGTH is greater than the number of characters - remaining in the string, counting from character START. - - If START is less than one, 'substr()' treats it as if it was one. - (POSIX doesn't specify what to do in this case: BWK 'awk' acts this - way, and therefore 'gawk' does too.) If START is greater than the - number of characters in the string, 'substr()' returns the null - string. Similarly, if LENGTH is present but less than or equal to - zero, the null string is returned. - - The string returned by 'substr()' _cannot_ be assigned. Thus, it - is a mistake to attempt to change a portion of a string, as shown - in the following example: - - string = "abcdef" - # try to get "abCDEf", won't work - substr(string, 3, 3) = "CDE" - - It is also a mistake to use 'substr()' as the third argument of - 'sub()' or 'gsub()': - - gsub(/xyz/, "pdq", substr($0, 5, 20)) # WRONG - - (Some commercial versions of 'awk' treat 'substr()' as assignable, - but doing so is not portable.) - - If you need to replace bits and pieces of a string, combine - 'substr()' with string concatenation, in the following manner: - - string = "abcdef" - ... - string = substr(string, 1, 2) "CDE" substr(string, 6) - -'tolower(STRING)' - Return a copy of STRING, with each uppercase character in the - string replaced with its corresponding lowercase character. - Nonalphabetic characters are left unchanged. For example, - 'tolower("MiXeD cAsE 123")' returns '"mixed case 123"'. - -'toupper(STRING)' - Return a copy of STRING, with each lowercase character in the - string replaced with its corresponding uppercase character. - Nonalphabetic characters are left unchanged. For example, - 'toupper("MiXeD cAsE 123")' returns '"MIXED CASE 123"'. - - Matching the Null String - - In 'awk', the '*' operator can match the null string. This is -particularly important for the 'sub()', 'gsub()', and 'gensub()' -functions. For example: - - $ echo abc | awk '{ gsub(/m*/, "X"); print }' - -| XaXbXcX - -Although this makes a certain amount of sense, it can be surprising. - - ---------- Footnotes ---------- - - (1) Unless you use the '--non-decimal-data' option, which isn't -recommended. *Note Nondecimal Data:: for more information. - - (2) Note that this means that the record will first be regenerated -using the value of 'OFS' if any fields have been changed, and that the -fields will be updated after the substitution, even if the operation is -a "no-op" such as 'sub(/^/, "")'. - - (3) This is different from C and C++, in which the first character is -number zero. - - -File: gawk.info, Node: Gory Details, Up: String Functions - -9.1.3.1 More about '\' and '&' with 'sub()', 'gsub()', and 'gensub()' -..................................................................... - - CAUTION: This subsubsection has been reported to cause headaches. - You might want to skip it upon first reading. - - When using 'sub()', 'gsub()', or 'gensub()', and trying to get -literal backslashes and ampersands into the replacement text, you need -to remember that there are several levels of "escape processing" going -on. - - First, there is the "lexical" level, which is when 'awk' reads your -program and builds an internal copy of it to execute. Then there is the -runtime level, which is when 'awk' actually scans the replacement string -to determine what to generate. - - At both levels, 'awk' looks for a defined set of characters that can -come after a backslash. At the lexical level, it looks for the escape -sequences listed in *note Escape Sequences::. Thus, for every '\' that -'awk' processes at the runtime level, you must type two backslashes at -the lexical level. When a character that is not valid for an escape -sequence follows the '\', BWK 'awk' and 'gawk' both simply remove the -initial '\' and put the next character into the string. Thus, for -example, '"a\qb"' is treated as '"aqb"'. - - At the runtime level, the various functions handle sequences of '\' -and '&' differently. The situation is (sadly) somewhat complex. -Historically, the 'sub()' and 'gsub()' functions treated the -two-character sequence '\&' specially; this sequence was replaced in the -generated text with a single '&'. Any other '\' within the REPLACEMENT -string that did not precede an '&' was passed through unchanged. This -is illustrated in *note Table 9.1: table-sub-escapes. - - You type 'sub()' sees 'sub()' generates - ----- ------- ---------- - '\&' '&' The matched text - '\\&' '\&' A literal '&' - '\\\&' '\&' A literal '&' - '\\\\&' '\\&' A literal '\&' - '\\\\\&' '\\&' A literal '\&' - '\\\\\\&' '\\\&' A literal '\\&' - '\\q' '\q' A literal '\q' - -Table 9.1: Historical escape sequence processing for 'sub()' and -'gsub()' - -This table shows the lexical-level processing, where an odd number of -backslashes becomes an even number at the runtime level, as well as the -runtime processing done by 'sub()'. (For the sake of simplicity, the -rest of the following tables only show the case of even numbers of -backslashes entered at the lexical level.) - - The problem with the historical approach is that there is no way to -get a literal '\' followed by the matched text. - - Several editions of the POSIX standard attempted to fix this problem -but weren't successful. The details are irrelevant at this point in -time. - - At one point, the 'gawk' maintainer submitted proposed text for a -revised standard that reverts to rules that correspond more closely to -the original existing practice. The proposed rules have special cases -that make it possible to produce a '\' preceding the matched text. This -is shown in *note Table 9.2: table-sub-proposed. - - You type 'sub()' sees 'sub()' generates - ----- ------- ---------- - '\\\\\\&' '\\\&' A literal '\&' - '\\\\&' '\\&' A literal '\', followed by the matched text - '\\&' '\&' A literal '&' - '\\q' '\q' A literal '\q' - '\\\\' '\\' '\\' - -Table 9.2: 'gawk' rules for 'sub()' and backslash - - In a nutshell, at the runtime level, there are now three special -sequences of characters ('\\\&', '\\&', and '\&') whereas historically -there was only one. However, as in the historical case, any '\' that is -not part of one of these three sequences is not special and appears in -the output literally. - - 'gawk' 3.0 and 3.1 follow these rules for 'sub()' and 'gsub()'. The -POSIX standard took much longer to be revised than was expected. In -addition, the 'gawk' maintainer's proposal was lost during the -standardization process. The final rules are somewhat simpler. The -results are similar except for one case. - - The POSIX rules state that '\&' in the replacement string produces a -literal '&', '\\' produces a literal '\', and '\' followed by anything -else is not special; the '\' is placed straight into the output. These -rules are presented in *note Table 9.3: table-posix-sub. - - You type 'sub()' sees 'sub()' generates - ----- ------- ---------- - '\\\\\\&' '\\\&' A literal '\&' - '\\\\&' '\\&' A literal '\', followed by the matched text - '\\&' '\&' A literal '&' - '\\q' '\q' A literal '\q' - '\\\\' '\\' '\' - -Table 9.3: POSIX rules for 'sub()' and 'gsub()' - - The only case where the difference is noticeable is the last one: -'\\\\' is seen as '\\' and produces '\' instead of '\\'. - - Starting with version 3.1.4, 'gawk' followed the POSIX rules when -'--posix' was specified (*note Options::). Otherwise, it continued to -follow the proposed rules, as that had been its behavior for many years. - - When version 4.0.0 was released, the 'gawk' maintainer made the POSIX -rules the default, breaking well over a decade's worth of backward -compatibility.(1) Needless to say, this was a bad idea, and as of -version 4.0.1, 'gawk' resumed its historical behavior, and only follows -the POSIX rules when '--posix' is given. - - The rules for 'gensub()' are considerably simpler. At the runtime -level, whenever 'gawk' sees a '\', if the following character is a -digit, then the text that matched the corresponding parenthesized -subexpression is placed in the generated output. Otherwise, no matter -what character follows the '\', it appears in the generated text and the -'\' does not, as shown in *note Table 9.4: table-gensub-escapes. - - You type 'gensub()' sees 'gensub()' generates - ----- --------- ------------ - '&' '&' The matched text - '\\&' '\&' A literal '&' - '\\\\' '\\' A literal '\' - '\\\\&' '\\&' A literal '\', then the matched text - '\\\\\\&' '\\\&' A literal '\&' - '\\q' '\q' A literal 'q' - -Table 9.4: Escape sequence processing for 'gensub()' - - Because of the complexity of the lexical- and runtime-level -processing and the special cases for 'sub()' and 'gsub()', we recommend -the use of 'gawk' and 'gensub()' when you have to do substitutions. - - ---------- Footnotes ---------- - - (1) This was rather naive of him, despite there being a note in this -minor node indicating that the next major version would move to the -POSIX rules. - - -File: gawk.info, Node: I/O Functions, Next: Time Functions, Prev: String Functions, Up: Built-in - -9.1.4 Input/Output Functions ----------------------------- - -The following functions relate to input/output (I/O). Optional -parameters are enclosed in square brackets ([ ]): - -'close('FILENAME [',' HOW]')' - Close the file FILENAME for input or output. Alternatively, the - argument may be a shell command that was used for creating a - coprocess, or for redirecting to or from a pipe; then the coprocess - or pipe is closed. *Note Close Files And Pipes:: for more - information. - - When closing a coprocess, it is occasionally useful to first close - one end of the two-way pipe and then to close the other. This is - done by providing a second argument to 'close()'. This second - argument (HOW) should be one of the two string values '"to"' or - '"from"', indicating which end of the pipe to close. Case in the - string does not matter. *Note Two-way I/O::, which discusses this - feature in more detail and gives an example. - - Note that the second argument to 'close()' is a 'gawk' extension; - it is not available in compatibility mode (*note Options::). - -'fflush('[FILENAME]')' - Flush any buffered output associated with FILENAME, which is either - a file opened for writing or a shell command for redirecting output - to a pipe or coprocess. - - Many utility programs "buffer" their output (i.e., they save - information to write to a disk file or the screen in memory until - there is enough for it to be worthwhile to send the data to the - output device). This is often more efficient than writing every - little bit of information as soon as it is ready. However, - sometimes it is necessary to force a program to "flush" its buffers - (i.e., write the information to its destination, even if a buffer - is not full). This is the purpose of the 'fflush()' - function--'gawk' also buffers its output, and the 'fflush()' - function forces 'gawk' to flush its buffers. - - Brian Kernighan added 'fflush()' to his 'awk' in April 1992. For - two decades, it was a common extension. In December 2012, it was - accepted for inclusion into the POSIX standard. See the Austin - Group website (http://austingroupbugs.net/view.php?id=634). - - POSIX standardizes 'fflush()' as follows: if there is no argument, - or if the argument is the null string ('""'), then 'awk' flushes - the buffers for _all_ open output files and pipes. - - NOTE: Prior to version 4.0.2, 'gawk' would flush only the - standard output if there was no argument, and flush all output - files and pipes if the argument was the null string. This was - changed in order to be compatible with Brian Kernighan's - 'awk', in the hope that standardizing this feature in POSIX - would then be easier (which indeed proved to be the case). - - With 'gawk', you can use 'fflush("/dev/stdout")' if you wish - to flush only the standard output. - - 'fflush()' returns zero if the buffer is successfully flushed; - otherwise, it returns a nonzero value. ('gawk' returns -1.) In - the case where all buffers are flushed, the return value is zero - only if all buffers were flushed successfully. Otherwise, it is - -1, and 'gawk' warns about the problem FILENAME. - - 'gawk' also issues a warning message if you attempt to flush a file - or pipe that was opened for reading (such as with 'getline'), or if - FILENAME is not an open file, pipe, or coprocess. In such a case, - 'fflush()' returns -1, as well. - - Interactive Versus Noninteractive Buffering - - As a side point, buffering issues can be even more confusing if - your program is "interactive" (i.e., communicating with a user - sitting at a keyboard).(1) - - Interactive programs generally "line buffer" their output (i.e., - they write out every line). Noninteractive programs wait until - they have a full buffer, which may be many lines of output. Here - is an example of the difference: - - $ awk '{ print $1 + $2 }' - 1 1 - -| 2 - 2 3 - -| 5 - Ctrl-d - - Each line of output is printed immediately. Compare that behavior - with this example: - - $ awk '{ print $1 + $2 }' | cat - 1 1 - 2 3 - Ctrl-d - -| 2 - -| 5 - - Here, no output is printed until after the 'Ctrl-d' is typed, - because it is all buffered and sent down the pipe to 'cat' in one - shot. - -'system(COMMAND)' - Execute the operating system command COMMAND and then return to the - 'awk' program. Return COMMAND's exit status (see further on). - - For example, if the following fragment of code is put in your 'awk' - program: - - END { - system("date | mail -s 'awk run done' root") - } - - the system administrator is sent mail when the 'awk' program - finishes processing input and begins its end-of-input processing. - - Note that redirecting 'print' or 'printf' into a pipe is often - enough to accomplish your task. If you need to run many commands, - it is more efficient to simply print them down a pipeline to the - shell: - - while (MORE STUFF TO DO) - print COMMAND | "/bin/sh" - close("/bin/sh") - - However, if your 'awk' program is interactive, 'system()' is useful - for running large self-contained programs, such as a shell or an - editor. Some operating systems cannot implement the 'system()' - function. 'system()' causes a fatal error if it is not supported. - - NOTE: When '--sandbox' is specified, the 'system()' function - is disabled (*note Options::). - - On POSIX systems, a command's exit status is a 16-bit number. The - exit value passed to the C 'exit()' function is held in the - high-order eight bits. The low-order bits indicate if the process - was killed by a signal (bit 7) and if so, the guilty signal number - (bits 0-6). - - Traditionally, 'awk''s 'system()' function has simply returned the - exit status value divided by 256. In the normal case this gives - the exit status but in the case of death-by-signal it yields a - fractional floating-point value.(2) POSIX states that 'awk''s - 'system()' should return the full 16-bit value. - - 'gawk' steers a middle ground. The return values are summarized in - *note Table 9.5: table-system-return-values. - - Situation Return value from 'system()' - -------------------------------------------------------------------------- - '--traditional' C 'system()''s value divided by 256 - '--posix' C 'system()''s value - Normal exit of command Command's exit status - Death by signal of command 256 + number of murderous signal - Death by signal of command 512 + number of murderous signal - with core dump - Some kind of error -1 - - Table 9.5: Return values from 'system()' - - Controlling Output Buffering with 'system()' - - The 'fflush()' function provides explicit control over output -buffering for individual files and pipes. However, its use is not -portable to many older 'awk' implementations. An alternative method to -flush output buffers is to call 'system()' with a null string as its -argument: - - system("") # flush output - -'gawk' treats this use of the 'system()' function as a special case and -is smart enough not to run a shell (or other command interpreter) with -the empty command. Therefore, with 'gawk', this idiom is not only -useful, it is also efficient. Although this method should work with -other 'awk' implementations, it does not necessarily avoid starting an -unnecessary shell. (Other implementations may only flush the buffer -associated with the standard output and not necessarily all buffered -output.) - - If you think about what a programmer expects, it makes sense that -'system()' should flush any pending output. The following program: - - BEGIN { - print "first print" - system("echo system echo") - print "second print" - } - -must print: - - first print - system echo - second print - -and not: - - system echo - first print - second print - - If 'awk' did not flush its buffers before calling 'system()', you -would see the latter (undesirable) output. - - ---------- Footnotes ---------- - - (1) A program is interactive if the standard output is connected to a -terminal device. On modern systems, this means your keyboard and -screen. - - (2) In private correspondence, Dr. Kernighan has indicated to me that -the way this was done was probably a mistake. - - -File: gawk.info, Node: Time Functions, Next: Bitwise Functions, Prev: I/O Functions, Up: Built-in - -9.1.5 Time Functions --------------------- - -'awk' programs are commonly used to process log files containing -timestamp information, indicating when a particular log record was -written. Many programs log their timestamps in the form returned by the -'time()' system call, which is the number of seconds since a particular -epoch. On POSIX-compliant systems, it is the number of seconds since -1970-01-01 00:00:00 UTC, not counting leap seconds.(1) All known -POSIX-compliant systems support timestamps from 0 through 2^31 - 1, -which is sufficient to represent times through 2038-01-19 03:14:07 UTC. -Many systems support a wider range of timestamps, including negative -timestamps that represent times before the epoch. - - In order to make it easier to process such log files and to produce -useful reports, 'gawk' provides the following functions for working with -timestamps. They are 'gawk' extensions; they are not specified in the -POSIX standard.(2) However, recent versions of 'mawk' (*note Other -Versions::) also support these functions. Optional parameters are -enclosed in square brackets ([ ]): - -'mktime(DATESPEC)' - Turn DATESPEC into a timestamp in the same form as is returned by - 'systime()'. It is similar to the function of the same name in ISO - C. The argument, DATESPEC, is a string of the form - '"YYYY MM DD HH MM SS [DST]"'. The string consists of six or seven - numbers representing, respectively, the full year including - century, the month from 1 to 12, the day of the month from 1 to 31, - the hour of the day from 0 to 23, the minute from 0 to 59, the - second from 0 to 60,(3) and an optional daylight-savings flag. - - The values of these numbers need not be within the ranges - specified; for example, an hour of -1 means 1 hour before midnight. - The origin-zero Gregorian calendar is assumed, with year 0 - preceding year 1 and year -1 preceding year 0. The time is assumed - to be in the local time zone. If the daylight-savings flag is - positive, the time is assumed to be daylight savings time; if zero, - the time is assumed to be standard time; and if negative (the - default), 'mktime()' attempts to determine whether daylight savings - time is in effect for the specified time. - - If DATESPEC does not contain enough elements or if the resulting - time is out of range, 'mktime()' returns -1. - -'strftime('[FORMAT [',' TIMESTAMP [',' UTC-FLAG] ] ]')' - Format the time specified by TIMESTAMP based on the contents of the - FORMAT string and return the result. It is similar to the function - of the same name in ISO C. If UTC-FLAG is present and is either - nonzero or non-null, the value is formatted as UTC (Coordinated - Universal Time, formerly GMT or Greenwich Mean Time). Otherwise, - the value is formatted for the local time zone. The TIMESTAMP is - in the same format as the value returned by the 'systime()' - function. If no TIMESTAMP argument is supplied, 'gawk' uses the - current time of day as the timestamp. Without a FORMAT argument, - 'strftime()' uses the value of 'PROCINFO["strftime"]' as the format - string (*note Built-in Variables::). The default string value is - '"%a %b %e %H:%M:%S %Z %Y"'. This format string produces output - that is equivalent to that of the 'date' utility. You can assign a - new value to 'PROCINFO["strftime"]' to change the default format; - see the following list for the various format directives. - -'systime()' - Return the current time as the number of seconds since the system - epoch. On POSIX systems, this is the number of seconds since - 1970-01-01 00:00:00 UTC, not counting leap seconds. It may be a - different number on other systems. - - The 'systime()' function allows you to compare a timestamp from a log -file with the current time of day. In particular, it is easy to -determine how long ago a particular record was logged. It also allows -you to produce log records using the "seconds since the epoch" format. - - The 'mktime()' function allows you to convert a textual -representation of a date and time into a timestamp. This makes it easy -to do before/after comparisons of dates and times, particularly when -dealing with date and time data coming from an external source, such as -a log file. - - The 'strftime()' function allows you to easily turn a timestamp into -human-readable information. It is similar in nature to the 'sprintf()' -function (*note String Functions::), in that it copies nonformat -specification characters verbatim to the returned string, while -substituting date and time values for format specifications in the -FORMAT string. - - 'strftime()' is guaranteed by the 1999 ISO C standard(4) to support -the following date format specifications: - -'%a' - The locale's abbreviated weekday name. - -'%A' - The locale's full weekday name. - -'%b' - The locale's abbreviated month name. - -'%B' - The locale's full month name. - -'%c' - The locale's "appropriate" date and time representation. (This is - '%A %B %d %T %Y' in the '"C"' locale.) - -'%C' - The century part of the current year. This is the year divided by - 100 and truncated to the next lower integer. - -'%d' - The day of the month as a decimal number (01-31). - -'%D' - Equivalent to specifying '%m/%d/%y'. - -'%e' - The day of the month, padded with a space if it is only one digit. - -'%F' - Equivalent to specifying '%Y-%m-%d'. This is the ISO 8601 date - format. - -'%g' - The year modulo 100 of the ISO 8601 week number, as a decimal - number (00-99). For example, January 1, 2012, is in week 53 of - 2011. Thus, the year of its ISO 8601 week number is 2011, even - though its year is 2012. Similarly, December 31, 2012, is in week - 1 of 2013. Thus, the year of its ISO week number is 2013, even - though its year is 2012. - -'%G' - The full year of the ISO week number, as a decimal number. - -'%h' - Equivalent to '%b'. - -'%H' - The hour (24-hour clock) as a decimal number (00-23). - -'%I' - The hour (12-hour clock) as a decimal number (01-12). - -'%j' - The day of the year as a decimal number (001-366). - -'%m' - The month as a decimal number (01-12). - -'%M' - The minute as a decimal number (00-59). - -'%n' - A newline character (ASCII LF). - -'%p' - The locale's equivalent of the AM/PM designations associated with a - 12-hour clock. - -'%r' - The locale's 12-hour clock time. (This is '%I:%M:%S %p' in the - '"C"' locale.) - -'%R' - Equivalent to specifying '%H:%M'. - -'%S' - The second as a decimal number (00-60). - -'%t' - A TAB character. - -'%T' - Equivalent to specifying '%H:%M:%S'. - -'%u' - The weekday as a decimal number (1-7). Monday is day one. - -'%U' - The week number of the year (with the first Sunday as the first day - of week one) as a decimal number (00-53). - -'%V' - The week number of the year (with the first Monday as the first day - of week one) as a decimal number (01-53). The method for - determining the week number is as specified by ISO 8601. (To wit: - if the week containing January 1 has four or more days in the new - year, then it is week one; otherwise it is the last week [52 or 53] - of the previous year and the next week is week one.) - -'%w' - The weekday as a decimal number (0-6). Sunday is day zero. - -'%W' - The week number of the year (with the first Monday as the first day - of week one) as a decimal number (00-53). - -'%x' - The locale's "appropriate" date representation. (This is '%A %B %d - %Y' in the '"C"' locale.) - -'%X' - The locale's "appropriate" time representation. (This is '%T' in - the '"C"' locale.) - -'%y' - The year modulo 100 as a decimal number (00-99). - -'%Y' - The full year as a decimal number (e.g., 2015). - -'%z' - The time zone offset in a '+HHMM' format (e.g., the format - necessary to produce RFC 822/RFC 1036 date headers). - -'%Z' - The time zone name or abbreviation; no characters if no time zone - is determinable. - -'%Ec %EC %Ex %EX %Ey %EY %Od %Oe %OH' -'%OI %Om %OM %OS %Ou %OU %OV %Ow %OW %Oy' - "Alternative representations" for the specifications that use only - the second letter ('%c', '%C', and so on).(5) (These facilitate - compliance with the POSIX 'date' utility.) - -'%%' - A literal '%'. - - If a conversion specifier is not one of those just listed, the -behavior is undefined.(6) - - For systems that are not yet fully standards-compliant, 'gawk' -supplies a copy of 'strftime()' from the GNU C Library. It supports all -of the just-listed format specifications. If that version is used to -compile 'gawk' (*note Installation::), then the following additional -format specifications are available: - -'%k' - The hour (24-hour clock) as a decimal number (0-23). Single-digit - numbers are padded with a space. - -'%l' - The hour (12-hour clock) as a decimal number (1-12). Single-digit - numbers are padded with a space. - -'%s' - The time as a decimal timestamp in seconds since the epoch. - - Additionally, the alternative representations are recognized but -their normal representations are used. - - The following example is an 'awk' implementation of the POSIX 'date' -utility. Normally, the 'date' utility prints the current date and time -of day in a well-known format. However, if you provide an argument to -it that begins with a '+', 'date' copies nonformat specifier characters -to the standard output and interprets the current time according to the -format specifiers in the string. For example: - - $ date '+Today is %A, %B %d, %Y.' - -| Today is Monday, September 22, 2014. - - Here is the 'gawk' version of the 'date' utility. It has a shell -"wrapper" to handle the '-u' option, which requires that 'date' run as -if the time zone is set to UTC: - - #! /bin/sh - # - # date --- approximate the POSIX 'date' command - - case $1 in - -u) TZ=UTC0 # use UTC - export TZ - shift ;; - esac - - gawk 'BEGIN { - format = PROCINFO["strftime"] - exitval = 0 - - if (ARGC > 2) - exitval = 1 - else if (ARGC == 2) { - format = ARGV[1] - if (format ~ /^\+/) - format = substr(format, 2) # remove leading + - } - print strftime(format) - exit exitval - }' "$@" - - ---------- Footnotes ---------- - - (1) *Note Glossary::, especially the entries "Epoch" and "UTC." - - (2) The GNU 'date' utility can also do many of the things described -here. Its use may be preferable for simple time-related operations in -shell scripts. - - (3) Occasionally there are minutes in a year with a leap second, -which is why the seconds can go up to 60. - - (4) Unfortunately, not every system's 'strftime()' necessarily -supports all of the conversions listed here. - - (5) If you don't understand any of this, don't worry about it; these -facilities are meant to make it easier to "internationalize" programs. -Other internationalization features are described in *note -Internationalization::. - - (6) This is because ISO C leaves the behavior of the C version of -'strftime()' undefined and 'gawk' uses the system's version of -'strftime()' if it's there. Typically, the conversion specifier either -does not appear in the returned string or appears literally. - - -File: gawk.info, Node: Bitwise Functions, Next: Type Functions, Prev: Time Functions, Up: Built-in - -9.1.6 Bit-Manipulation Functions --------------------------------- - - I can explain it for you, but I can't understand it for you. - -- _Anonymous_ - - Many languages provide the ability to perform "bitwise" operations on -two integer numbers. In other words, the operation is performed on each -successive pair of bits in the operands. Three common operations are -bitwise AND, OR, and XOR. The operations are described in *note Table -9.6: table-bitwise-ops. - - Bit operator - | AND | OR | XOR - |--+--+--+--+--+-- - Operands | 0 | 1 | 0 | 1 | 0 | 1 - -------+--+--+--+--+--+-- - 0 | 0 0 | 0 1 | 0 1 - 1 | 0 1 | 1 1 | 1 0 - -Table 9.6: Bitwise operations - - As you can see, the result of an AND operation is 1 only when _both_ -bits are 1. The result of an OR operation is 1 if _either_ bit is 1. -The result of an XOR operation is 1 if either bit is 1, but not both. -The next operation is the "complement"; the complement of 1 is 0 and the -complement of 0 is 1. Thus, this operation "flips" all the bits of a -given value. - - Finally, two other common operations are to shift the bits left or -right. For example, if you have a bit string '10111001' and you shift -it right by three bits, you end up with '00010111'.(1) If you start -over again with '10111001' and shift it left by three bits, you end up -with '11001000'. The following list describes 'gawk''s built-in -functions that implement the bitwise operations. Optional parameters -are enclosed in square brackets ([ ]): - -'and(V1, V2 [, ...])' - Return the bitwise AND of the arguments. There must be at least - two. - -'compl(VAL)' - Return the bitwise complement of VAL. - -'lshift(VAL, COUNT)' - Return the value of VAL, shifted left by COUNT bits. - -'or(V1, V2 [, ...])' - Return the bitwise OR of the arguments. There must be at least - two. - -'rshift(VAL, COUNT)' - Return the value of VAL, shifted right by COUNT bits. - -'xor(V1, V2 [, ...])' - Return the bitwise XOR of the arguments. There must be at least - two. - - For all of these functions, first the double-precision floating-point -value is converted to the widest C unsigned integer type, then the -bitwise operation is performed. If the result cannot be represented -exactly as a C 'double', leading nonzero bits are removed one by one -until it can be represented exactly. The result is then converted back -into a C 'double'. (If you don't understand this paragraph, don't worry -about it.) - - Here is a user-defined function (*note User-defined::) that -illustrates the use of these functions: - - # bits2str --- turn a byte into readable ones and zeros - - function bits2str(bits, data, mask) - { - if (bits == 0) - return "0" - - mask = 1 - for (; bits != 0; bits = rshift(bits, 1)) - data = (and(bits, mask) ? "1" : "0") data - - while ((length(data) % 8) != 0) - data = "0" data - - return data - } - - BEGIN { - printf "123 = %s\n", bits2str(123) - printf "0123 = %s\n", bits2str(0123) - printf "0x99 = %s\n", bits2str(0x99) - comp = compl(0x99) - printf "compl(0x99) = %#x = %s\n", comp, bits2str(comp) - shift = lshift(0x99, 2) - printf "lshift(0x99, 2) = %#x = %s\n", shift, bits2str(shift) - shift = rshift(0x99, 2) - printf "rshift(0x99, 2) = %#x = %s\n", shift, bits2str(shift) - } - -This program produces the following output when run: - - $ gawk -f testbits.awk - -| 123 = 01111011 - -| 0123 = 01010011 - -| 0x99 = 10011001 - -| compl(0x99) = 0x3fffffffffff66 = 00111111111111111111111111111111111111111111111101100110 - -| lshift(0x99, 2) = 0x264 = 0000001001100100 - -| rshift(0x99, 2) = 0x26 = 00100110 - - The 'bits2str()' function turns a binary number into a string. -Initializing 'mask' to one creates a binary value where the rightmost -bit is set to one. Using this mask, the function repeatedly checks the -rightmost bit. ANDing the mask with the value indicates whether the -rightmost bit is one or not. If so, a '"1"' is concatenated onto the -front of the string. Otherwise, a '"0"' is added. The value is then -shifted right by one bit and the loop continues until there are no more -one bits. - - If the initial value is zero, it returns a simple '"0"'. Otherwise, -at the end, it pads the value with zeros to represent multiples of 8-bit -quantities. This is typical in modern computers. - - The main code in the 'BEGIN' rule shows the difference between the -decimal and octal values for the same numbers (*note -Nondecimal-numbers::), and then demonstrates the results of the -'compl()', 'lshift()', and 'rshift()' functions. - - ---------- Footnotes ---------- - - (1) This example shows that zeros come in on the left side. For -'gawk', this is always true, but in some languages, it's possible to -have the left side fill with ones. - - -File: gawk.info, Node: Type Functions, Next: I18N Functions, Prev: Bitwise Functions, Up: Built-in - -9.1.7 Getting Type Information ------------------------------- - -'gawk' provides two functions that lets you distinguish the type of a -variable. This is necessary for writing code that traverses every -element of an array of arrays (*note Arrays of Arrays::), and in other -contexts. - -'isarray(X)' - Return a true value if X is an array. Otherwise, return false. - -'typeof(X)' - Return one of the following strings, depending upon the type of X: - - '"array"' - X is an array. - - '"number"' - X is a number. - - '"string"' - X is a string. - - '"strnum"' - X is a string that might be a number, such as a field or the - result of calling 'split()'. (I.e., X has the STRNUM - attribute; *note Variable Typing::.) - - '"unassigned"' - X is a scalar variable that has not been assigned a value yet. - For example: - - BEGIN { - a[1] # creates a[1] but it has no assigned value - print typeof(a[1]) # scalar_u - } - - '"untyped"' - X has not yet been used yet at all; it can become a scalar or - an array. For example: - - BEGIN { - print typeof(x) # x never used --> untyped - mk_arr(x) - print typeof(x) # x now an array --> array - } - - function mk_arr(a) { a[1] = 1 } - - 'isarray()' is meant for use in two circumstances. The first is when -traversing a multidimensional array: you can test if an element is -itself an array or not. The second is inside the body of a user-defined -function (not discussed yet; *note User-defined::), to test if a -parameter is an array or not. - - NOTE: Using 'isarray()' at the global level to test variables makes - no sense. Because you are the one writing the program, you are - supposed to know if your variables are arrays or not. And in fact, - due to the way 'gawk' works, if you pass the name of a variable - that has not been previously used to 'isarray()', 'gawk' ends up - turning it into a scalar. - - The 'typeof()' function is general; it allows you to determine if a -variable or function parameter is a scalar, an array. - - 'isarray()' is deprecated; you should use 'typeof()' instead. You -should replace any existing uses of 'isarray(var)' in your code with -'typeof(var) == "array"'. - - -File: gawk.info, Node: I18N Functions, Prev: Type Functions, Up: Built-in - -9.1.8 String-Translation Functions ----------------------------------- - -'gawk' provides facilities for internationalizing 'awk' programs. These -include the functions described in the following list. The descriptions -here are purposely brief. *Note Internationalization::, for the full -story. Optional parameters are enclosed in square brackets ([ ]): - -'bindtextdomain(DIRECTORY' [',' DOMAIN]')' - Set the directory in which 'gawk' will look for message translation - files, in case they will not or cannot be placed in the "standard" - locations (e.g., during testing). It returns the directory in - which DOMAIN is "bound." - - The default DOMAIN is the value of 'TEXTDOMAIN'. If DIRECTORY is - the null string ('""'), then 'bindtextdomain()' returns the current - binding for the given DOMAIN. - -'dcgettext(STRING' [',' DOMAIN [',' CATEGORY] ]')' - Return the translation of STRING in text domain DOMAIN for locale - category CATEGORY. The default value for DOMAIN is the current - value of 'TEXTDOMAIN'. The default value for CATEGORY is - '"LC_MESSAGES"'. - -'dcngettext(STRING1, STRING2, NUMBER' [',' DOMAIN [',' CATEGORY] ]')' - Return the plural form used for NUMBER of the translation of - STRING1 and STRING2 in text domain DOMAIN for locale category - CATEGORY. STRING1 is the English singular variant of a message, - and STRING2 is the English plural variant of the same message. The - default value for DOMAIN is the current value of 'TEXTDOMAIN'. The - default value for CATEGORY is '"LC_MESSAGES"'. - - -File: gawk.info, Node: User-defined, Next: Indirect Calls, Prev: Built-in, Up: Functions - -9.2 User-Defined Functions -========================== - -Complicated 'awk' programs can often be simplified by defining your own -functions. User-defined functions can be called just like built-in ones -(*note Function Calls::), but it is up to you to define them (i.e., to -tell 'awk' what they should do). - -* Menu: - -* Definition Syntax:: How to write definitions and what they mean. -* Function Example:: An example function definition and what it - does. -* Function Caveats:: Things to watch out for. -* Return Statement:: Specifying the value a function returns. -* Dynamic Typing:: How variable types can change at runtime. - - -File: gawk.info, Node: Definition Syntax, Next: Function Example, Up: User-defined - -9.2.1 Function Definition Syntax --------------------------------- - - It's entirely fair to say that the awk syntax for local variable - definitions is appallingly awful. - -- _Brian Kernighan_ - - Definitions of functions can appear anywhere between the rules of an -'awk' program. Thus, the general form of an 'awk' program is extended -to include sequences of rules _and_ user-defined function definitions. -There is no need to put the definition of a function before all uses of -the function. This is because 'awk' reads the entire program before -starting to execute any of it. - - The definition of a function named NAME looks like this: - - 'function' NAME'('[PARAMETER-LIST]')' - '{' - BODY-OF-FUNCTION - '}' - -Here, NAME is the name of the function to define. A valid function name -is like a valid variable name: a sequence of letters, digits, and -underscores that doesn't start with a digit. Here too, only the 52 -upper- and lowercase English letters may be used in a function name. -Within a single 'awk' program, any particular name can only be used as a -variable, array, or function. - - PARAMETER-LIST is an optional list of the function's arguments and -local variable names, separated by commas. When the function is called, -the argument names are used to hold the argument values given in the -call. - - A function cannot have two parameters with the same name, nor may it -have a parameter with the same name as the function itself. - - CAUTION: According to the POSIX standard, function parameters - cannot have the same name as one of the special predefined - variables (*note Built-in Variables::), nor may a function - parameter have the same name as another function. - - Not all versions of 'awk' enforce these restrictions. 'gawk' - always enforces the first restriction. With '--posix' (*note - Options::), it also enforces the second restriction. - - Local variables act like the empty string if referenced where a -string value is required, and like zero if referenced where a numeric -value is required. This is the same as the behavior of regular -variables that have never been assigned a value. (There is more to -understand about local variables; *note Dynamic Typing::.) - - The BODY-OF-FUNCTION consists of 'awk' statements. It is the most -important part of the definition, because it says what the function -should actually _do_. The argument names exist to give the body a way -to talk about the arguments; local variables exist to give the body -places to keep temporary values. - - Argument names are not distinguished syntactically from local -variable names. Instead, the number of arguments supplied when the -function is called determines how many argument variables there are. -Thus, if three argument values are given, the first three names in -PARAMETER-LIST are arguments and the rest are local variables. - - It follows that if the number of arguments is not the same in all -calls to the function, some of the names in PARAMETER-LIST may be -arguments on some occasions and local variables on others. Another way -to think of this is that omitted arguments default to the null string. - - Usually when you write a function, you know how many names you intend -to use for arguments and how many you intend to use as local variables. -It is conventional to place some extra space between the arguments and -the local variables, in order to document how your function is supposed -to be used. - - During execution of the function body, the arguments and local -variable values hide, or "shadow", any variables of the same names used -in the rest of the program. The shadowed variables are not accessible -in the function definition, because there is no way to name them while -their names have been taken away for the arguments and local variables. -All other variables used in the 'awk' program can be referenced or set -normally in the function's body. - - The arguments and local variables last only as long as the function -body is executing. Once the body finishes, you can once again access -the variables that were shadowed while the function was running. - - The function body can contain expressions that call functions. They -can even call this function, either directly or by way of another -function. When this happens, we say the function is "recursive". The -act of a function calling itself is called "recursion". - - All the built-in functions return a value to their caller. -User-defined functions can do so also, using the 'return' statement, -which is described in detail in *note Return Statement::. Many of the -subsequent examples in this minor node use the 'return' statement. - - In many 'awk' implementations, including 'gawk', the keyword -'function' may be abbreviated 'func'. (c.e.) However, POSIX only -specifies the use of the keyword 'function'. This actually has some -practical implications. If 'gawk' is in POSIX-compatibility mode (*note -Options::), then the following statement does _not_ define a function: - - func foo() { a = sqrt($1) ; print a } - -Instead, it defines a rule that, for each record, concatenates the value -of the variable 'func' with the return value of the function 'foo'. If -the resulting string is non-null, the action is executed. This is -probably not what is desired. ('awk' accepts this input as -syntactically valid, because functions may be used before they are -defined in 'awk' programs.(1)) - - To ensure that your 'awk' programs are portable, always use the -keyword 'function' when defining a function. - - ---------- Footnotes ---------- - - (1) This program won't actually run, because 'foo()' is undefined. - - -File: gawk.info, Node: Function Example, Next: Function Caveats, Prev: Definition Syntax, Up: User-defined - -9.2.2 Function Definition Examples ----------------------------------- - -Here is an example of a user-defined function, called 'myprint()', that -takes a number and prints it in a specific format: - - function myprint(num) - { - printf "%6.3g\n", num - } - -To illustrate, here is an 'awk' rule that uses our 'myprint()' function: - - $3 > 0 { myprint($3) } - -This program prints, in our special format, all the third fields that -contain a positive number in our input. Therefore, when given the -following input: - - 1.2 3.4 5.6 7.8 - 9.10 11.12 -13.14 15.16 - 17.18 19.20 21.22 23.24 - -this program, using our function to format the results, prints: - - 5.6 - 21.2 - - This function deletes all the elements in an array (recall that the -extra whitespace signifies the start of the local variable list): - - function delarray(a, i) - { - for (i in a) - delete a[i] - } - - When working with arrays, it is often necessary to delete all the -elements in an array and start over with a new list of elements (*note -Delete::). Instead of having to repeat this loop everywhere that you -need to clear out an array, your program can just call 'delarray()'. -(This guarantees portability. The use of 'delete ARRAY' to delete the -contents of an entire array is a relatively recent(1) addition to the -POSIX standard.) - - The following is an example of a recursive function. It takes a -string as an input parameter and returns the string in reverse order. -Recursive functions must always have a test that stops the recursion. -In this case, the recursion terminates when the input string is already -empty: - - function rev(str) - { - if (str == "") - return "" - - return (rev(substr(str, 2)) substr(str, 1, 1)) - } - - If this function is in a file named 'rev.awk', it can be tested this -way: - - $ echo "Don't Panic!" | - > gawk -e '{ print rev($0) }' -f rev.awk - -| !cinaP t'noD - - The C 'ctime()' function takes a timestamp and returns it as a -string, formatted in a well-known fashion. The following example uses -the built-in 'strftime()' function (*note Time Functions::) to create an -'awk' version of 'ctime()': - - # ctime.awk - # - # awk version of C ctime(3) function - - function ctime(ts, format) - { - format = "%a %b %e %H:%M:%S %Z %Y" - - if (ts == 0) - ts = systime() # use current time as default - return strftime(format, ts) - } - - You might think that 'ctime()' could use 'PROCINFO["strftime"]' for -its format string. That would be a mistake, because 'ctime()' is -supposed to return the time formatted in a standard fashion, and -user-level code could have changed 'PROCINFO["strftime"]'. - - ---------- Footnotes ---------- - - (1) Late in 2012. - - -File: gawk.info, Node: Function Caveats, Next: Return Statement, Prev: Function Example, Up: User-defined - -9.2.3 Calling User-Defined Functions ------------------------------------- - -"Calling a function" means causing the function to run and do its job. -A function call is an expression and its value is the value returned by -the function. - -* Menu: - -* Calling A Function:: Don't use spaces. -* Variable Scope:: Controlling variable scope. -* Pass By Value/Reference:: Passing parameters. - - -File: gawk.info, Node: Calling A Function, Next: Variable Scope, Up: Function Caveats - -9.2.3.1 Writing a Function Call -............................... - -A function call consists of the function name followed by the arguments -in parentheses. 'awk' expressions are what you write in the call for -the arguments. Each time the call is executed, these expressions are -evaluated, and the values become the actual arguments. For example, -here is a call to 'foo()' with three arguments (the first being a string -concatenation): - - foo(x y, "lose", 4 * z) - - CAUTION: Whitespace characters (spaces and TABs) are not allowed - between the function name and the opening parenthesis of the - argument list. If you write whitespace by mistake, 'awk' might - think that you mean to concatenate a variable with an expression in - parentheses. However, it notices that you used a function name and - not a variable name, and reports an error. - - -File: gawk.info, Node: Variable Scope, Next: Pass By Value/Reference, Prev: Calling A Function, Up: Function Caveats - -9.2.3.2 Controlling Variable Scope -.................................. - -Unlike in many languages, there is no way to make a variable local to a -'{' ... '}' block in 'awk', but you can make a variable local to a -function. It is good practice to do so whenever a variable is needed -only in that function. - - To make a variable local to a function, simply declare the variable -as an argument after the actual function arguments (*note Definition -Syntax::). Look at the following example, where variable 'i' is a -global variable used by both functions 'foo()' and 'bar()': - - function bar() - { - for (i = 0; i < 3; i++) - print "bar's i=" i - } - - function foo(j) - { - i = j + 1 - print "foo's i=" i - bar() - print "foo's i=" i - } - - BEGIN { - i = 10 - print "top's i=" i - foo(0) - print "top's i=" i - } - - Running this script produces the following, because the 'i' in -functions 'foo()' and 'bar()' and at the top level refer to the same -variable instance: - - top's i=10 - foo's i=1 - bar's i=0 - bar's i=1 - bar's i=2 - foo's i=3 - top's i=3 - - If you want 'i' to be local to both 'foo()' and 'bar()', do as -follows (the extra space before 'i' is a coding convention to indicate -that 'i' is a local variable, not an argument): - - function bar( i) - { - for (i = 0; i < 3; i++) - print "bar's i=" i - } - - function foo(j, i) - { - i = j + 1 - print "foo's i=" i - bar() - print "foo's i=" i - } - - BEGIN { - i = 10 - print "top's i=" i - foo(0) - print "top's i=" i - } - - Running the corrected script produces the following: - - top's i=10 - foo's i=1 - bar's i=0 - bar's i=1 - bar's i=2 - foo's i=1 - top's i=10 - - Besides scalar values (strings and numbers), you may also have local -arrays. By using a parameter name as an array, 'awk' treats it as an -array, and it is local to the function. In addition, recursive calls -create new arrays. Consider this example: - - function some_func(p1, a) - { - if (p1++ > 3) - return - - a[p1] = p1 - - some_func(p1) - - printf("At level %d, index %d %s found in a\n", - p1, (p1 - 1), (p1 - 1) in a ? "is" : "is not") - printf("At level %d, index %d %s found in a\n", - p1, p1, p1 in a ? "is" : "is not") - print "" - } - - BEGIN { - some_func(1) - } - - When run, this program produces the following output: - - At level 4, index 3 is not found in a - At level 4, index 4 is found in a - - At level 3, index 2 is not found in a - At level 3, index 3 is found in a - - At level 2, index 1 is not found in a - At level 2, index 2 is found in a - - -File: gawk.info, Node: Pass By Value/Reference, Prev: Variable Scope, Up: Function Caveats - -9.2.3.3 Passing Function Arguments by Value Or by Reference -........................................................... - -In 'awk', when you declare a function, there is no way to declare -explicitly whether the arguments are passed "by value" or "by -reference". - - Instead, the passing convention is determined at runtime when the -function is called, according to the following rule: if the argument is -an array variable, then it is passed by reference. Otherwise, the -argument is passed by value. - - Passing an argument by value means that when a function is called, it -is given a _copy_ of the value of this argument. The caller may use a -variable as the expression for the argument, but the called function -does not know this--it only knows what value the argument had. For -example, if you write the following code: - - foo = "bar" - z = myfunc(foo) - -then you should not think of the argument to 'myfunc()' as being "the -variable 'foo'." Instead, think of the argument as the string value -'"bar"'. If the function 'myfunc()' alters the values of its local -variables, this has no effect on any other variables. Thus, if -'myfunc()' does this: - - function myfunc(str) - { - print str - str = "zzz" - print str - } - -to change its first argument variable 'str', it does _not_ change the -value of 'foo' in the caller. The role of 'foo' in calling 'myfunc()' -ended when its value ('"bar"') was computed. If 'str' also exists -outside of 'myfunc()', the function body cannot alter this outer value, -because it is shadowed during the execution of 'myfunc()' and cannot be -seen or changed from there. - - However, when arrays are the parameters to functions, they are _not_ -copied. Instead, the array itself is made available for direct -manipulation by the function. This is usually termed "call by -reference". Changes made to an array parameter inside the body of a -function _are_ visible outside that function. - - NOTE: Changing an array parameter inside a function can be very - dangerous if you do not watch what you are doing. For example: - - function changeit(array, ind, nvalue) - { - array[ind] = nvalue - } - - BEGIN { - a[1] = 1; a[2] = 2; a[3] = 3 - changeit(a, 2, "two") - printf "a[1] = %s, a[2] = %s, a[3] = %s\n", - a[1], a[2], a[3] - } - - prints 'a[1] = 1, a[2] = two, a[3] = 3', because 'changeit()' - stores '"two"' in the second element of 'a'. - - Some 'awk' implementations allow you to call a function that has not -been defined. They only report a problem at runtime, when the program -actually tries to call the function. For example: - - BEGIN { - if (0) - foo() - else - bar() - } - function bar() { ... } - # note that `foo' is not defined - -Because the 'if' statement will never be true, it is not really a -problem that 'foo()' has not been defined. Usually, though, it is a -problem if a program calls an undefined function. - - If '--lint' is specified (*note Options::), 'gawk' reports calls to -undefined functions. - - Some 'awk' implementations generate a runtime error if you use either -the 'next' statement or the 'nextfile' statement (*note Next -Statement::, and *note Nextfile Statement::) inside a user-defined -function. 'gawk' does not have this limitation. - - -File: gawk.info, Node: Return Statement, Next: Dynamic Typing, Prev: Function Caveats, Up: User-defined - -9.2.4 The 'return' Statement ----------------------------- - -As seen in several earlier examples, the body of a user-defined function -can contain a 'return' statement. This statement returns control to the -calling part of the 'awk' program. It can also be used to return a -value for use in the rest of the 'awk' program. It looks like this: - - 'return' [EXPRESSION] - - The EXPRESSION part is optional. Due most likely to an oversight, -POSIX does not define what the return value is if you omit the -EXPRESSION. Technically speaking, this makes the returned value -undefined, and therefore, unpredictable. In practice, though, all -versions of 'awk' simply return the null string, which acts like zero if -used in a numeric context. - - A 'return' statement without an EXPRESSION is assumed at the end of -every function definition. So, if control reaches the end of the -function body, then technically the function returns an unpredictable -value. In practice, it returns the empty string. 'awk' does _not_ warn -you if you use the return value of such a function. - - Sometimes, you want to write a function for what it does, not for -what it returns. Such a function corresponds to a 'void' function in C, -C++, or Java, or to a 'procedure' in Ada. Thus, it may be appropriate -to not return any value; simply bear in mind that you should not be -using the return value of such a function. - - The following is an example of a user-defined function that returns a -value for the largest number among the elements of an array: - - function maxelt(vec, i, ret) - { - for (i in vec) { - if (ret == "" || vec[i] > ret) - ret = vec[i] - } - return ret - } - -You call 'maxelt()' with one argument, which is an array name. The -local variables 'i' and 'ret' are not intended to be arguments; there is -nothing to stop you from passing more than one argument to 'maxelt()' -but the results would be strange. The extra space before 'i' in the -function parameter list indicates that 'i' and 'ret' are local -variables. You should follow this convention when defining functions. - - The following program uses the 'maxelt()' function. It loads an -array, calls 'maxelt()', and then reports the maximum number in that -array: - - function maxelt(vec, i, ret) - { - for (i in vec) { - if (ret == "" || vec[i] > ret) - ret = vec[i] - } - return ret - } - - # Load all fields of each record into nums. - { - for(i = 1; i <= NF; i++) - nums[NR, i] = $i - } - - END { - print maxelt(nums) - } - - Given the following input: - - 1 5 23 8 16 - 44 3 5 2 8 26 - 256 291 1396 2962 100 - -6 467 998 1101 - 99385 11 0 225 - -the program reports (predictably) that 99,385 is the largest value in -the array. - - -File: gawk.info, Node: Dynamic Typing, Prev: Return Statement, Up: User-defined - -9.2.5 Functions and Their Effects on Variable Typing ----------------------------------------------------- - -'awk' is a very fluid language. It is possible that 'awk' can't tell if -an identifier represents a scalar variable or an array until runtime. -Here is an annotated sample program: - - function foo(a) - { - a[1] = 1 # parameter is an array - } - - BEGIN { - b = 1 - foo(b) # invalid: fatal type mismatch - - foo(x) # x uninitialized, becomes an array dynamically - x = 1 # now not allowed, runtime error - } - - In this example, the first call to 'foo()' generates a fatal error, -so 'awk' will not report the second error. If you comment out that -call, though, then 'awk' does report the second error. - - Usually, such things aren't a big issue, but it's worth being aware -of them. - - -File: gawk.info, Node: Indirect Calls, Next: Functions Summary, Prev: User-defined, Up: Functions - -9.3 Indirect Function Calls -=========================== - -This section describes an advanced, 'gawk'-specific extension. - - Often, you may wish to defer the choice of function to call until -runtime. For example, you may have different kinds of records, each of -which should be processed differently. - - Normally, you would have to use a series of 'if'-'else' statements to -decide which function to call. By using "indirect" function calls, you -can specify the name of the function to call as a string variable, and -then call the function. Let's look at an example. - - Suppose you have a file with your test scores for the classes you are -taking, and you wish to get the sum and the average of your test scores. -The first field is the class name. The following fields are the -functions to call to process the data, up to a "marker" field 'data:'. -Following the marker, to the end of the record, are the various numeric -test scores. - - Here is the initial file: - - Biology_101 sum average data: 87.0 92.4 78.5 94.9 - Chemistry_305 sum average data: 75.2 98.3 94.7 88.2 - English_401 sum average data: 100.0 95.6 87.1 93.4 - - To process the data, you might write initially: - - { - class = $1 - for (i = 2; $i != "data:"; i++) { - if ($i == "sum") - sum() # processes the whole record - else if ($i == "average") - average() - ... # and so on - } - } - -This style of programming works, but can be awkward. With "indirect" -function calls, you tell 'gawk' to use the _value_ of a variable as the -_name_ of the function to call. - - The syntax is similar to that of a regular function call: an -identifier immediately followed by an opening parenthesis, any -arguments, and then a closing parenthesis, with the addition of a -leading '@' character: - - the_func = "sum" - result = @the_func() # calls the sum() function - - Here is a full program that processes the previously shown data, -using indirect function calls: - - # indirectcall.awk --- Demonstrate indirect function calls - - # average --- return the average of the values in fields $first - $last - - function average(first, last, sum, i) - { - sum = 0; - for (i = first; i <= last; i++) - sum += $i - - return sum / (last - first + 1) - } - - # sum --- return the sum of the values in fields $first - $last - - function sum(first, last, ret, i) - { - ret = 0; - for (i = first; i <= last; i++) - ret += $i - - return ret - } - - These two functions expect to work on fields; thus, the parameters -'first' and 'last' indicate where in the fields to start and end. -Otherwise, they perform the expected computations and are not unusual: - - # For each record, print the class name and the requested statistics - { - class_name = $1 - gsub(/_/, " ", class_name) # Replace _ with spaces - - # find start - for (i = 1; i <= NF; i++) { - if ($i == "data:") { - start = i + 1 - break - } - } - - printf("%s:\n", class_name) - for (i = 2; $i != "data:"; i++) { - the_function = $i - printf("\t%s: <%s>\n", $i, @the_function(start, NF) "") - } - print "" - } - - This is the main processing for each record. It prints the class -name (with underscores replaced with spaces). It then finds the start -of the actual data, saving it in 'start'. The last part of the code -loops through each function name (from '$2' up to the marker, 'data:'), -calling the function named by the field. The indirect function call -itself occurs as a parameter in the call to 'printf'. (The 'printf' -format string uses '%s' as the format specifier so that we can use -functions that return strings, as well as numbers. Note that the result -from the indirect call is concatenated with the empty string, in order -to force it to be a string value.) - - Here is the result of running the program: - - $ gawk -f indirectcall.awk class_data1 - -| Biology 101: - -| sum: <352.8> - -| average: <88.2> - -| - -| Chemistry 305: - -| sum: <356.4> - -| average: <89.1> - -| - -| English 401: - -| sum: <376.1> - -| average: <94.025> - - The ability to use indirect function calls is more powerful than you -may think at first. The C and C++ languages provide "function -pointers," which are a mechanism for calling a function chosen at -runtime. One of the most well-known uses of this ability is the C -'qsort()' function, which sorts an array using the famous "quicksort" -algorithm (see the Wikipedia article -(http://en.wikipedia.org/wiki/Quicksort) for more information). To use -this function, you supply a pointer to a comparison function. This -mechanism allows you to sort arbitrary data in an arbitrary fashion. - - We can do something similar using 'gawk', like this: - - # quicksort.awk --- Quicksort algorithm, with user-supplied - # comparison function - - # quicksort --- C.A.R. Hoare's quicksort algorithm. See Wikipedia - # or almost any algorithms or computer science text. - - function quicksort(data, left, right, less_than, i, last) - { - if (left >= right) # do nothing if array contains fewer - return # than two elements - - quicksort_swap(data, left, int((left + right) / 2)) - last = left - for (i = left + 1; i <= right; i++) - if (@less_than(data[i], data[left])) - quicksort_swap(data, ++last, i) - quicksort_swap(data, left, last) - quicksort(data, left, last - 1, less_than) - quicksort(data, last + 1, right, less_than) - } - - # quicksort_swap --- helper function for quicksort, should really be inline - - function quicksort_swap(data, i, j, temp) - { - temp = data[i] - data[i] = data[j] - data[j] = temp - } - - The 'quicksort()' function receives the 'data' array, the starting -and ending indices to sort ('left' and 'right'), and the name of a -function that performs a "less than" comparison. It then implements the -quicksort algorithm. - - To make use of the sorting function, we return to our previous -example. The first thing to do is write some comparison functions: - - # num_lt --- do a numeric less than comparison - - function num_lt(left, right) - { - return ((left + 0) < (right + 0)) - } - - # num_ge --- do a numeric greater than or equal to comparison - - function num_ge(left, right) - { - return ((left + 0) >= (right + 0)) - } - - The 'num_ge()' function is needed to perform a descending sort; when -used to perform a "less than" test, it actually does the opposite -(greater than or equal to), which yields data sorted in descending -order. - - Next comes a sorting function. It is parameterized with the starting -and ending field numbers and the comparison function. It builds an -array with the data and calls 'quicksort()' appropriately, and then -formats the results as a single string: - - # do_sort --- sort the data according to `compare' - # and return it as a string - - function do_sort(first, last, compare, data, i, retval) - { - delete data - for (i = 1; first <= last; first++) { - data[i] = $first - i++ - } - - quicksort(data, 1, i-1, compare) - - retval = data[1] - for (i = 2; i in data; i++) - retval = retval " " data[i] - - return retval - } - - Finally, the two sorting functions call 'do_sort()', passing in the -names of the two comparison functions: - - # sort --- sort the data in ascending order and return it as a string - - function sort(first, last) - { - return do_sort(first, last, "num_lt") - } - - # rsort --- sort the data in descending order and return it as a string - - function rsort(first, last) - { - return do_sort(first, last, "num_ge") - } - - Here is an extended version of the data file: - - Biology_101 sum average sort rsort data: 87.0 92.4 78.5 94.9 - Chemistry_305 sum average sort rsort data: 75.2 98.3 94.7 88.2 - English_401 sum average sort rsort data: 100.0 95.6 87.1 93.4 - - Finally, here are the results when the enhanced program is run: - - $ gawk -f quicksort.awk -f indirectcall.awk class_data2 - -| Biology 101: - -| sum: <352.8> - -| average: <88.2> - -| sort: <78.5 87.0 92.4 94.9> - -| rsort: <94.9 92.4 87.0 78.5> - -| - -| Chemistry 305: - -| sum: <356.4> - -| average: <89.1> - -| sort: <75.2 88.2 94.7 98.3> - -| rsort: <98.3 94.7 88.2 75.2> - -| - -| English 401: - -| sum: <376.1> - -| average: <94.025> - -| sort: <87.1 93.4 95.6 100.0> - -| rsort: <100.0 95.6 93.4 87.1> - - Another example where indirect functions calls are useful can be -found in processing arrays. This is described in *note Walking -Arrays::. - - Remember that you must supply a leading '@' in front of an indirect -function call. - - Starting with version 4.1.2 of 'gawk', indirect function calls may -also be used with built-in functions and with extension functions (*note -Dynamic Extensions::). There are some limitations when calling built-in -functions indirectly, as follows. - - * You cannot pass a regular expression constant to a built-in - function through an indirect function call.(1) This applies to the - 'sub()', 'gsub()', 'gensub()', 'match()', 'split()' and - 'patsplit()' functions. - - * If calling 'sub()' or 'gsub()', you may only pass two arguments, - since those functions are unusual in that they update their third - argument. This means that '$0' will be updated. - - 'gawk' does its best to make indirect function calls efficient. For -example, in the following case: - - for (i = 1; i <= n; i++) - @the_func() - -'gawk' looks up the actual function to call only once. - - ---------- Footnotes ---------- - - (1) This may change in a future version; recheck the documentation -that comes with your version of 'gawk' to see if it has. - - -File: gawk.info, Node: Functions Summary, Prev: Indirect Calls, Up: Functions - -9.4 Summary -=========== - - * 'awk' provides built-in functions and lets you define your own - functions. - - * POSIX 'awk' provides three kinds of built-in functions: numeric, - string, and I/O. 'gawk' provides functions that sort arrays, work - with values representing time, do bit manipulation, determine - variable type (array versus scalar), and internationalize and - localize programs. 'gawk' also provides several extensions to some - of standard functions, typically in the form of additional - arguments. - - * Functions accept zero or more arguments and return a value. The - expressions that provide the argument values are completely - evaluated before the function is called. Order of evaluation is - not defined. The return value can be ignored. - - * The handling of backslash in 'sub()' and 'gsub()' is not simple. - It is more straightforward in 'gawk''s 'gensub()' function, but - that function still requires care in its use. - - * User-defined functions provide important capabilities but come with - some syntactic inelegancies. In a function call, there cannot be - any space between the function name and the opening left - parenthesis of the argument list. Also, there is no provision for - local variables, so the convention is to add extra parameters, and - to separate them visually from the real parameters by extra - whitespace. - - * User-defined functions may call other user-defined (and built-in) - functions and may call themselves recursively. Function parameters - "hide" any global variables of the same names. You cannot use the - name of a reserved variable (such as 'ARGC') as the name of a - parameter in user-defined functions. - - * Scalar values are passed to user-defined functions by value. Array - parameters are passed by reference; any changes made by the - function to array parameters are thus visible after the function - has returned. - - * Use the 'return' statement to return from a user-defined function. - An optional expression becomes the function's return value. Only - scalar values may be returned by a function. - - * If a variable that has never been used is passed to a user-defined - function, how that function treats the variable can set its nature: - either scalar or array. - - * 'gawk' provides indirect function calls using a special syntax. By - setting a variable to the name of a function, you can determine at - runtime what function will be called at that point in the program. - This is equivalent to function pointers in C and C++. - - -File: gawk.info, Node: Library Functions, Next: Sample Programs, Prev: Functions, Up: Top - -10 A Library of 'awk' Functions -******************************* - -*note User-defined:: describes how to write your own 'awk' functions. -Writing functions is important, because it allows you to encapsulate -algorithms and program tasks in a single place. It simplifies -programming, making program development more manageable and making -programs more readable. - - In their seminal 1976 book, 'Software Tools',(1) Brian Kernighan and -P.J. Plauger wrote: - - Good Programming is not learned from generalities, but by seeing - how significant programs can be made clean, easy to read, easy to - maintain and modify, human-engineered, efficient and reliable, by - the application of common sense and good programming practices. - Careful study and imitation of good programs leads to better - writing. - - In fact, they felt this idea was so important that they placed this -statement on the cover of their book. Because we believe strongly that -their statement is correct, this major node and *note Sample Programs::, -provide a good-sized body of code for you to read and, we hope, to learn -from. - - This major node presents a library of useful 'awk' functions. Many -of the sample programs presented later in this Info file use these -functions. The functions are presented here in a progression from -simple to complex. - - *note Extract Program:: presents a program that you can use to -extract the source code for these example library functions and programs -from the Texinfo source for this Info file. (This has already been done -as part of the 'gawk' distribution.) - - If you have written one or more useful, general-purpose 'awk' -functions and would like to contribute them to the 'awk' user community, -see *note How To Contribute::, for more information. - - The programs in this major node and in *note Sample Programs::, -freely use 'gawk'-specific features. Rewriting these programs for -different implementations of 'awk' is pretty straightforward: - - * Diagnostic error messages are sent to '/dev/stderr'. Use '| "cat - 1>&2"' instead of '> "/dev/stderr"' if your system does not have a - '/dev/stderr', or if you cannot use 'gawk'. - - * A number of programs use 'nextfile' (*note Nextfile Statement::) to - skip any remaining input in the input file. - - * Finally, some of the programs choose to ignore upper- and lowercase - distinctions in their input. They do so by assigning one to - 'IGNORECASE'. You can achieve almost the same effect(2) by adding - the following rule to the beginning of the program: - - # ignore case - { $0 = tolower($0) } - - Also, verify that all regexp and string constants used in - comparisons use only lowercase letters. - -* Menu: - -* Library Names:: How to best name private global variables in - library functions. -* General Functions:: Functions that are of general use. -* Data File Management:: Functions for managing command-line data - files. -* Getopt Function:: A function for processing command-line - arguments. -* Passwd Functions:: Functions for getting user information. -* Group Functions:: Functions for getting group information. -* Walking Arrays:: A function to walk arrays of arrays. -* Library Functions Summary:: Summary of library functions. -* Library Exercises:: Exercises. - - ---------- Footnotes ---------- - - (1) Sadly, over 35 years later, many of the lessons taught by this -book have yet to be learned by a vast number of practicing programmers. - - (2) The effects are not identical. Output of the transformed record -will be in all lowercase, while 'IGNORECASE' preserves the original -contents of the input record. - - -File: gawk.info, Node: Library Names, Next: General Functions, Up: Library Functions - -10.1 Naming Library Function Global Variables -============================================= - -Due to the way the 'awk' language evolved, variables are either "global" -(usable by the entire program) or "local" (usable just by a specific -function). There is no intermediate state analogous to 'static' -variables in C. - - Library functions often need to have global variables that they can -use to preserve state information between calls to the function--for -example, 'getopt()''s variable '_opti' (*note Getopt Function::). Such -variables are called "private", as the only functions that need to use -them are the ones in the library. - - When writing a library function, you should try to choose names for -your private variables that will not conflict with any variables used by -either another library function or a user's main program. For example, -a name like 'i' or 'j' is not a good choice, because user programs often -use variable names like these for their own purposes. - - The example programs shown in this major node all start the names of -their private variables with an underscore ('_'). Users generally don't -use leading underscores in their variable names, so this convention -immediately decreases the chances that the variable names will be -accidentally shared with the user's program. - - In addition, several of the library functions use a prefix that helps -indicate what function or set of functions use the variables--for -example, '_pw_byname()' in the user database routines (*note Passwd -Functions::). This convention is recommended, as it even further -decreases the chance of inadvertent conflict among variable names. Note -that this convention is used equally well for variable names and for -private function names.(1) - - As a final note on variable naming, if a function makes global -variables available for use by a main program, it is a good convention -to start those variables' names with a capital letter--for example, -'getopt()''s 'Opterr' and 'Optind' variables (*note Getopt Function::). -The leading capital letter indicates that it is global, while the fact -that the variable name is not all capital letters indicates that the -variable is not one of 'awk''s predefined variables, such as 'FS'. - - It is also important that _all_ variables in library functions that -do not need to save state are, in fact, declared local.(2) If this is -not done, the variables could accidentally be used in the user's -program, leading to bugs that are very difficult to track down: - - function lib_func(x, y, l1, l2) - { - ... - # some_var should be local but by oversight is not - USE VARIABLE some_var - ... - } - - A different convention, common in the Tcl community, is to use a -single associative array to hold the values needed by the library -function(s), or "package." This significantly decreases the number of -actual global names in use. For example, the functions described in -*note Passwd Functions:: might have used array elements -'PW_data["inited"]', 'PW_data["total"]', 'PW_data["count"]', and -'PW_data["awklib"]', instead of '_pw_inited', '_pw_awklib', '_pw_total', -and '_pw_count'. - - The conventions presented in this minor node are exactly that: -conventions. You are not required to write your programs this way--we -merely recommend that you do so. - - ---------- Footnotes ---------- - - (1) Although all the library routines could have been rewritten to -use this convention, this was not done, in order to show how our own -'awk' programming style has evolved and to provide some basis for this -discussion. - - (2) 'gawk''s '--dump-variables' command-line option is useful for -verifying this. - - -File: gawk.info, Node: General Functions, Next: Data File Management, Prev: Library Names, Up: Library Functions - -10.2 General Programming -======================== - -This minor node presents a number of functions that are of general -programming use. - -* Menu: - -* Strtonum Function:: A replacement for the built-in - 'strtonum()' function. -* Assert Function:: A function for assertions in 'awk' - programs. -* Round Function:: A function for rounding if 'sprintf()' - does not do it correctly. -* Cliff Random Function:: The Cliff Random Number Generator. -* Ordinal Functions:: Functions for using characters as numbers and - vice versa. -* Join Function:: A function to join an array into a string. -* Getlocaltime Function:: A function to get formatted times. -* Readfile Function:: A function to read an entire file at once. -* Shell Quoting:: A function to quote strings for the shell. - - -File: gawk.info, Node: Strtonum Function, Next: Assert Function, Up: General Functions - -10.2.1 Converting Strings to Numbers ------------------------------------- - -The 'strtonum()' function (*note String Functions::) is a 'gawk' -extension. The following function provides an implementation for other -versions of 'awk': - - # mystrtonum --- convert string to number - - function mystrtonum(str, ret, n, i, k, c) - { - if (str ~ /^0[0-7]*$/) { - # octal - n = length(str) - ret = 0 - for (i = 1; i <= n; i++) { - c = substr(str, i, 1) - # index() returns 0 if c not in string, - # includes c == "0" - k = index("1234567", c) - - ret = ret * 8 + k - } - } else if (str ~ /^0[xX][[:xdigit:]]+$/) { - # hexadecimal - str = substr(str, 3) # lop off leading 0x - n = length(str) - ret = 0 - for (i = 1; i <= n; i++) { - c = substr(str, i, 1) - c = tolower(c) - # index() returns 0 if c not in string, - # includes c == "0" - k = index("123456789abcdef", c) - - ret = ret * 16 + k - } - } else if (str ~ \ - /^[-+]?([0-9]+([.][0-9]*([Ee][0-9]+)?)?|([.][0-9]+([Ee][-+]?[0-9]+)?))$/) { - # decimal number, possibly floating point - ret = str + 0 - } else - ret = "NOT-A-NUMBER" - - return ret - } - - # BEGIN { # gawk test harness - # a[1] = "25" - # a[2] = ".31" - # a[3] = "0123" - # a[4] = "0xdeadBEEF" - # a[5] = "123.45" - # a[6] = "1.e3" - # a[7] = "1.32" - # a[8] = "1.32E2" - # - # for (i = 1; i in a; i++) - # print a[i], strtonum(a[i]), mystrtonum(a[i]) - # } - - The function first looks for C-style octal numbers (base 8). If the -input string matches a regular expression describing octal numbers, then -'mystrtonum()' loops through each character in the string. It sets 'k' -to the index in '"1234567"' of the current octal digit. The return -value will either be the same number as the digit, or zero if the -character is not there, which will be true for a '0'. This is safe, -because the regexp test in the 'if' ensures that only octal values are -converted. - - Similar logic applies to the code that checks for and converts a -hexadecimal value, which starts with '0x' or '0X'. The use of -'tolower()' simplifies the computation for finding the correct numeric -value for each hexadecimal digit. - - Finally, if the string matches the (rather complicated) regexp for a -regular decimal integer or floating-point number, the computation 'ret = -str + 0' lets 'awk' convert the value to a number. - - A commented-out test program is included, so that the function can be -tested with 'gawk' and the results compared to the built-in 'strtonum()' -function. - - -File: gawk.info, Node: Assert Function, Next: Round Function, Prev: Strtonum Function, Up: General Functions - -10.2.2 Assertions ------------------ - -When writing large programs, it is often useful to know that a condition -or set of conditions is true. Before proceeding with a particular -computation, you make a statement about what you believe to be the case. -Such a statement is known as an "assertion". The C language provides an -'<assert.h>' header file and corresponding 'assert()' macro that a -programmer can use to make assertions. If an assertion fails, the -'assert()' macro arranges to print a diagnostic message describing the -condition that should have been true but was not, and then it kills the -program. In C, using 'assert()' looks this: - - #include <assert.h> - - int myfunc(int a, double b) - { - assert(a <= 5 && b >= 17.1); - ... - } - - If the assertion fails, the program prints a message similar to this: - - prog.c:5: assertion failed: a <= 5 && b >= 17.1 - - The C language makes it possible to turn the condition into a string -for use in printing the diagnostic message. This is not possible in -'awk', so this 'assert()' function also requires a string version of the -condition that is being tested. Following is the function: - - # assert --- assert that a condition is true. Otherwise, exit. - - function assert(condition, string) - { - if (! condition) { - printf("%s:%d: assertion failed: %s\n", - FILENAME, FNR, string) > "/dev/stderr" - _assert_exit = 1 - exit 1 - } - } - - END { - if (_assert_exit) - exit 1 - } - - The 'assert()' function tests the 'condition' parameter. If it is -false, it prints a message to standard error, using the 'string' -parameter to describe the failed condition. It then sets the variable -'_assert_exit' to one and executes the 'exit' statement. The 'exit' -statement jumps to the 'END' rule. If the 'END' rule finds -'_assert_exit' to be true, it exits immediately. - - The purpose of the test in the 'END' rule is to keep any other 'END' -rules from running. When an assertion fails, the program should exit -immediately. If no assertions fail, then '_assert_exit' is still false -when the 'END' rule is run normally, and the rest of the program's 'END' -rules execute. For all of this to work correctly, 'assert.awk' must be -the first source file read by 'awk'. The function can be used in a -program in the following way: - - function myfunc(a, b) - { - assert(a <= 5 && b >= 17.1, "a <= 5 && b >= 17.1") - ... - } - -If the assertion fails, you see a message similar to the following: - - mydata:1357: assertion failed: a <= 5 && b >= 17.1 - - There is a small problem with this version of 'assert()'. An 'END' -rule is automatically added to the program calling 'assert()'. -Normally, if a program consists of just a 'BEGIN' rule, the input files -and/or standard input are not read. However, now that the program has -an 'END' rule, 'awk' attempts to read the input data files or standard -input (*note Using BEGIN/END::), most likely causing the program to hang -as it waits for input. - - There is a simple workaround to this: make sure that such a 'BEGIN' -rule always ends with an 'exit' statement. - - -File: gawk.info, Node: Round Function, Next: Cliff Random Function, Prev: Assert Function, Up: General Functions - -10.2.3 Rounding Numbers ------------------------ - -The way 'printf' and 'sprintf()' (*note Printf::) perform rounding often -depends upon the system's C 'sprintf()' subroutine. On many machines, -'sprintf()' rounding is "unbiased", which means it doesn't always round -a trailing .5 up, contrary to naive expectations. In unbiased rounding, -.5 rounds to even, rather than always up, so 1.5 rounds to 2 but 4.5 -rounds to 4. This means that if you are using a format that does -rounding (e.g., '"%.0f"'), you should check what your system does. The -following function does traditional rounding; it might be useful if your -'awk''s 'printf' does unbiased rounding: - - # round.awk --- do normal rounding - - function round(x, ival, aval, fraction) - { - ival = int(x) # integer part, int() truncates - - # see if fractional part - if (ival == x) # no fraction - return ival # ensure no decimals - - if (x < 0) { - aval = -x # absolute value - ival = int(aval) - fraction = aval - ival - if (fraction >= .5) - return int(x) - 1 # -2.5 --> -3 - else - return int(x) # -2.3 --> -2 - } else { - fraction = x - ival - if (fraction >= .5) - return ival + 1 - else - return ival - } - } - - # test harness - # { print $0, round($0) } - - -File: gawk.info, Node: Cliff Random Function, Next: Ordinal Functions, Prev: Round Function, Up: General Functions - -10.2.4 The Cliff Random Number Generator ----------------------------------------- - -The Cliff random number generator -(http://mathworld.wolfram.com/CliffRandomNumberGenerator.html) is a very -simple random number generator that "passes the noise sphere test for -randomness by showing no structure." It is easily programmed, in less -than 10 lines of 'awk' code: - - # cliff_rand.awk --- generate Cliff random numbers - - BEGIN { _cliff_seed = 0.1 } - - function cliff_rand() - { - _cliff_seed = (100 * log(_cliff_seed)) % 1 - if (_cliff_seed < 0) - _cliff_seed = - _cliff_seed - return _cliff_seed - } - - This algorithm requires an initial "seed" of 0.1. Each new value -uses the current seed as input for the calculation. If the built-in -'rand()' function (*note Numeric Functions::) isn't random enough, you -might try using this function instead. - - -File: gawk.info, Node: Ordinal Functions, Next: Join Function, Prev: Cliff Random Function, Up: General Functions - -10.2.5 Translating Between Characters and Numbers -------------------------------------------------- - -One commercial implementation of 'awk' supplies a built-in function, -'ord()', which takes a character and returns the numeric value for that -character in the machine's character set. If the string passed to -'ord()' has more than one character, only the first one is used. - - The inverse of this function is 'chr()' (from the function of the -same name in Pascal), which takes a number and returns the corresponding -character. Both functions are written very nicely in 'awk'; there is no -real reason to build them into the 'awk' interpreter: - - # ord.awk --- do ord and chr - - # Global identifiers: - # _ord_: numerical values indexed by characters - # _ord_init: function to initialize _ord_ - - BEGIN { _ord_init() } - - function _ord_init( low, high, i, t) - { - low = sprintf("%c", 7) # BEL is ascii 7 - if (low == "\a") { # regular ascii - low = 0 - high = 127 - } else if (sprintf("%c", 128 + 7) == "\a") { - # ascii, mark parity - low = 128 - high = 255 - } else { # ebcdic(!) - low = 0 - high = 255 - } - - for (i = low; i <= high; i++) { - t = sprintf("%c", i) - _ord_[t] = i - } - } - - Some explanation of the numbers used by '_ord_init()' is worthwhile. -The most prominent character set in use today is ASCII.(1) Although an -8-bit byte can hold 256 distinct values (from 0 to 255), ASCII only -defines characters that use the values from 0 to 127.(2) In the now -distant past, at least one minicomputer manufacturer used ASCII, but -with mark parity, meaning that the leftmost bit in the byte is always 1. -This means that on those systems, characters have numeric values from -128 to 255. Finally, large mainframe systems use the EBCDIC character -set, which uses all 256 values. There are other character sets in use -on some older systems, but they are not really worth worrying about: - - function ord(str, c) - { - # only first character is of interest - c = substr(str, 1, 1) - return _ord_[c] - } - - function chr(c) - { - # force c to be numeric by adding 0 - return sprintf("%c", c + 0) - } - - #### test code #### - # BEGIN { - # for (;;) { - # printf("enter a character: ") - # if (getline var <= 0) - # break - # printf("ord(%s) = %d\n", var, ord(var)) - # } - # } - - An obvious improvement to these functions is to move the code for the -'_ord_init' function into the body of the 'BEGIN' rule. It was written -this way initially for ease of development. There is a "test program" -in a 'BEGIN' rule, to test the function. It is commented out for -production use. - - ---------- Footnotes ---------- - - (1) This is changing; many systems use Unicode, a very large -character set that includes ASCII as a subset. On systems with full -Unicode support, a character can occupy up to 32 bits, making simple -tests such as used here prohibitively expensive. - - (2) ASCII has been extended in many countries to use the values from -128 to 255 for country-specific characters. If your system uses these -extensions, you can simplify '_ord_init()' to loop from 0 to 255. - - -File: gawk.info, Node: Join Function, Next: Getlocaltime Function, Prev: Ordinal Functions, Up: General Functions - -10.2.6 Merging an Array into a String -------------------------------------- - -When doing string processing, it is often useful to be able to join all -the strings in an array into one long string. The following function, -'join()', accomplishes this task. It is used later in several of the -application programs (*note Sample Programs::). - - Good function design is important; this function needs to be general, -but it should also have a reasonable default behavior. It is called -with an array as well as the beginning and ending indices of the -elements in the array to be merged. This assumes that the array indices -are numeric--a reasonable assumption, as the array was likely created -with 'split()' (*note String Functions::): - - # join.awk --- join an array into a string - - function join(array, start, end, sep, result, i) - { - if (sep == "") - sep = " " - else if (sep == SUBSEP) # magic value - sep = "" - result = array[start] - for (i = start + 1; i <= end; i++) - result = result sep array[i] - return result - } - - An optional additional argument is the separator to use when joining -the strings back together. If the caller supplies a nonempty value, -'join()' uses it; if it is not supplied, it has a null value. In this -case, 'join()' uses a single space as a default separator for the -strings. If the value is equal to 'SUBSEP', then 'join()' joins the -strings with no separator between them. 'SUBSEP' serves as a "magic" -value to indicate that there should be no separation between the -component strings.(1) - - ---------- Footnotes ---------- - - (1) It would be nice if 'awk' had an assignment operator for -concatenation. The lack of an explicit operator for concatenation makes -string operations more difficult than they really need to be. - - -File: gawk.info, Node: Getlocaltime Function, Next: Readfile Function, Prev: Join Function, Up: General Functions - -10.2.7 Managing the Time of Day -------------------------------- - -The 'systime()' and 'strftime()' functions described in *note Time -Functions:: provide the minimum functionality necessary for dealing with -the time of day in human-readable form. Although 'strftime()' is -extensive, the control formats are not necessarily easy to remember or -intuitively obvious when reading a program. - - The following function, 'getlocaltime()', populates a user-supplied -array with preformatted time information. It returns a string with the -current time formatted in the same way as the 'date' utility: - - # getlocaltime.awk --- get the time of day in a usable format - - # Returns a string in the format of output of date(1) - # Populates the array argument time with individual values: - # time["second"] -- seconds (0 - 59) - # time["minute"] -- minutes (0 - 59) - # time["hour"] -- hours (0 - 23) - # time["althour"] -- hours (0 - 12) - # time["monthday"] -- day of month (1 - 31) - # time["month"] -- month of year (1 - 12) - # time["monthname"] -- name of the month - # time["shortmonth"] -- short name of the month - # time["year"] -- year modulo 100 (0 - 99) - # time["fullyear"] -- full year - # time["weekday"] -- day of week (Sunday = 0) - # time["altweekday"] -- day of week (Monday = 0) - # time["dayname"] -- name of weekday - # time["shortdayname"] -- short name of weekday - # time["yearday"] -- day of year (0 - 365) - # time["timezone"] -- abbreviation of timezone name - # time["ampm"] -- AM or PM designation - # time["weeknum"] -- week number, Sunday first day - # time["altweeknum"] -- week number, Monday first day - - function getlocaltime(time, ret, now, i) - { - # get time once, avoids unnecessary system calls - now = systime() - - # return date(1)-style output - ret = strftime("%a %b %e %H:%M:%S %Z %Y", now) - - # clear out target array - delete time - - # fill in values, force numeric values to be - # numeric by adding 0 - time["second"] = strftime("%S", now) + 0 - time["minute"] = strftime("%M", now) + 0 - time["hour"] = strftime("%H", now) + 0 - time["althour"] = strftime("%I", now) + 0 - time["monthday"] = strftime("%d", now) + 0 - time["month"] = strftime("%m", now) + 0 - time["monthname"] = strftime("%B", now) - time["shortmonth"] = strftime("%b", now) - time["year"] = strftime("%y", now) + 0 - time["fullyear"] = strftime("%Y", now) + 0 - time["weekday"] = strftime("%w", now) + 0 - time["altweekday"] = strftime("%u", now) + 0 - time["dayname"] = strftime("%A", now) - time["shortdayname"] = strftime("%a", now) - time["yearday"] = strftime("%j", now) + 0 - time["timezone"] = strftime("%Z", now) - time["ampm"] = strftime("%p", now) - time["weeknum"] = strftime("%U", now) + 0 - time["altweeknum"] = strftime("%W", now) + 0 - - return ret - } - - The string indices are easier to use and read than the various -formats required by 'strftime()'. The 'alarm' program presented in -*note Alarm Program:: uses this function. A more general design for the -'getlocaltime()' function would have allowed the user to supply an -optional timestamp value to use instead of the current time. - - -File: gawk.info, Node: Readfile Function, Next: Shell Quoting, Prev: Getlocaltime Function, Up: General Functions - -10.2.8 Reading a Whole File at Once ------------------------------------ - -Often, it is convenient to have the entire contents of a file available -in memory as a single string. A straightforward but naive way to do -that might be as follows: - - function readfile(file, tmp, contents) - { - if ((getline tmp < file) < 0) - return - - contents = tmp - while (getline tmp < file) > 0) - contents = contents RT tmp - - close(file) - return contents - } - - This function reads from 'file' one record at a time, building up the -full contents of the file in the local variable 'contents'. It works, -but is not necessarily efficient. - - The following function, based on a suggestion by Denis Shirokov, -reads the entire contents of the named file in one shot: - - # readfile.awk --- read an entire file at once - - function readfile(file, tmp, save_rs) - { - save_rs = RS - RS = "^$" - getline tmp < file - close(file) - RS = save_rs - - return tmp - } - - It works by setting 'RS' to '^$', a regular expression that will -never match if the file has contents. 'gawk' reads data from the file -into 'tmp', attempting to match 'RS'. The match fails after each read, -but fails quickly, such that 'gawk' fills 'tmp' with the entire contents -of the file. (*Note Records:: for information on 'RT' and 'RS'.) - - In the case that 'file' is empty, the return value is the null -string. Thus, calling code may use something like: - - contents = readfile("/some/path") - if (length(contents) == 0) - # file was empty ... - - This tests the result to see if it is empty or not. An equivalent -test would be 'contents == ""'. - - *Note Extension Sample Readfile:: for an extension function that also -reads an entire file into memory. - - -File: gawk.info, Node: Shell Quoting, Prev: Readfile Function, Up: General Functions - -10.2.9 Quoting Strings to Pass to the Shell -------------------------------------------- - -Michael Brennan offers the following programming pattern, which he uses -frequently: - - #! /bin/sh - - awkp=' - ... - ' - - INPUT_PROGRAM | awk "$awkp" | /bin/sh - - For example, a program of his named 'flac-edit' has this form: - - $ flac-edit -song="Whoope! That's Great" file.flac - - It generates the following output, which is to be piped to the shell -('/bin/sh'): - - chmod +w file.flac - metaflac --remove-tag=TITLE file.flac - LANG=en_US.88591 metaflac --set-tag=TITLE='Whoope! That'"'"'s Great' file.flac - chmod -w file.flac - - Note the need for shell quoting. The function 'shell_quote()' does -it. 'SINGLE' is the one-character string '"'"' and 'QSINGLE' is the -three-character string '"\"'\""': - - # shell_quote --- quote an argument for passing to the shell - - function shell_quote(s, # parameter - SINGLE, QSINGLE, i, X, n, ret) # locals - { - if (s == "") - return "\"\"" - - SINGLE = "\x27" # single quote - QSINGLE = "\"\x27\"" - n = split(s, X, SINGLE) - - ret = SINGLE X[1] SINGLE - for (i = 2; i <= n; i++) - ret = ret QSINGLE SINGLE X[i] SINGLE - - return ret - } - - -File: gawk.info, Node: Data File Management, Next: Getopt Function, Prev: General Functions, Up: Library Functions - -10.3 Data file Management -========================= - -This minor node presents functions that are useful for managing -command-line data files. - -* Menu: - -* Filetrans Function:: A function for handling data file transitions. -* Rewind Function:: A function for rereading the current file. -* File Checking:: Checking that data files are readable. -* Empty Files:: Checking for zero-length files. -* Ignoring Assigns:: Treating assignments as file names. - - -File: gawk.info, Node: Filetrans Function, Next: Rewind Function, Up: Data File Management - -10.3.1 Noting Data file Boundaries ----------------------------------- - -The 'BEGIN' and 'END' rules are each executed exactly once, at the -beginning and end of your 'awk' program, respectively (*note -BEGIN/END::). We (the 'gawk' authors) once had a user who mistakenly -thought that the 'BEGIN' rules were executed at the beginning of each -data file and the 'END' rules were executed at the end of each data -file. - - When informed that this was not the case, the user requested that we -add new special patterns to 'gawk', named 'BEGIN_FILE' and 'END_FILE', -that would have the desired behavior. He even supplied us the code to -do so. - - Adding these special patterns to 'gawk' wasn't necessary; the job can -be done cleanly in 'awk' itself, as illustrated by the following library -program. It arranges to call two user-supplied functions, 'beginfile()' -and 'endfile()', at the beginning and end of each data file. Besides -solving the problem in only nine(!) lines of code, it does so -_portably_; this works with any implementation of 'awk': - - # transfile.awk - # - # Give the user a hook for filename transitions - # - # The user must supply functions beginfile() and endfile() - # that each take the name of the file being started or - # finished, respectively. - - FILENAME != _oldfilename { - if (_oldfilename != "") - endfile(_oldfilename) - _oldfilename = FILENAME - beginfile(FILENAME) - } - - END { endfile(FILENAME) } - - This file must be loaded before the user's "main" program, so that -the rule it supplies is executed first. - - This rule relies on 'awk''s 'FILENAME' variable, which automatically -changes for each new data file. The current file name is saved in a -private variable, '_oldfilename'. If 'FILENAME' does not equal -'_oldfilename', then a new data file is being processed and it is -necessary to call 'endfile()' for the old file. Because 'endfile()' -should only be called if a file has been processed, the program first -checks to make sure that '_oldfilename' is not the null string. The -program then assigns the current file name to '_oldfilename' and calls -'beginfile()' for the file. Because, like all 'awk' variables, -'_oldfilename' is initialized to the null string, this rule executes -correctly even for the first data file. - - The program also supplies an 'END' rule to do the final processing -for the last file. Because this 'END' rule comes before any 'END' rules -supplied in the "main" program, 'endfile()' is called first. Once -again, the value of multiple 'BEGIN' and 'END' rules should be clear. - - If the same data file occurs twice in a row on the command line, then -'endfile()' and 'beginfile()' are not executed at the end of the first -pass and at the beginning of the second pass. The following version -solves the problem: - - # ftrans.awk --- handle datafile transitions - # - # user supplies beginfile() and endfile() functions - - FNR == 1 { - if (_filename_ != "") - endfile(_filename_) - _filename_ = FILENAME - beginfile(FILENAME) - } - - END { endfile(_filename_) } - - *note Wc Program:: shows how this library function can be used and -how it simplifies writing the main program. - - So Why Does 'gawk' Have 'BEGINFILE' and 'ENDFILE'? - - You are probably wondering, if 'beginfile()' and 'endfile()' -functions can do the job, why does 'gawk' have 'BEGINFILE' and 'ENDFILE' -patterns? - - Good question. Normally, if 'awk' cannot open a file, this causes an -immediate fatal error. In this case, there is no way for a user-defined -function to deal with the problem, as the mechanism for calling it -relies on the file being open and at the first record. Thus, the main -reason for 'BEGINFILE' is to give you a "hook" to catch files that -cannot be processed. 'ENDFILE' exists for symmetry, and because it -provides an easy way to do per-file cleanup processing. For more -information, refer to *note BEGINFILE/ENDFILE::. - - -File: gawk.info, Node: Rewind Function, Next: File Checking, Prev: Filetrans Function, Up: Data File Management - -10.3.2 Rereading the Current File ---------------------------------- - -Another request for a new built-in function was for a function that -would make it possible to reread the current file. The requesting user -didn't want to have to use 'getline' (*note Getline::) inside a loop. - - However, as long as you are not in the 'END' rule, it is quite easy -to arrange to immediately close the current input file and then start -over with it from the top. For lack of a better name, we'll call the -function 'rewind()': - - # rewind.awk --- rewind the current file and start over - - function rewind( i) - { - # shift remaining arguments up - for (i = ARGC; i > ARGIND; i--) - ARGV[i] = ARGV[i-1] - - # make sure gawk knows to keep going - ARGC++ - - # make current file next to get done - ARGV[ARGIND+1] = FILENAME - - # do it - nextfile - } - - The 'rewind()' function relies on the 'ARGIND' variable (*note -Auto-set::), which is specific to 'gawk'. It also relies on the -'nextfile' keyword (*note Nextfile Statement::). Because of this, you -should not call it from an 'ENDFILE' rule. (This isn't necessary -anyway, because 'gawk' goes to the next file as soon as an 'ENDFILE' -rule finishes!) - - You need to be careful calling 'rewind()'. You can end up causing -infinite recursion if you don't pay attention. Here is an example use: - - $ cat data - -| a - -| b - -| c - -| d - -| e - - $ cat test.awk - -| FNR == 3 && ! rewound { - -| rewound = 1 - -| rewind() - -| } - -| - -| { print FILENAME, FNR, $0 } - - $ gawk -f rewind.awk -f test.awk data - -| data 1 a - -| data 2 b - -| data 1 a - -| data 2 b - -| data 3 c - -| data 4 d - -| data 5 e - - -File: gawk.info, Node: File Checking, Next: Empty Files, Prev: Rewind Function, Up: Data File Management - -10.3.3 Checking for Readable Data files ---------------------------------------- - -Normally, if you give 'awk' a data file that isn't readable, it stops -with a fatal error. There are times when you might want to just ignore -such files and keep going.(1) You can do this by prepending the -following program to your 'awk' program: - - # readable.awk --- library file to skip over unreadable files - - BEGIN { - for (i = 1; i < ARGC; i++) { - if (ARGV[i] ~ /^[a-zA-Z_][a-zA-Z0-9_]*=.*/ \ - || ARGV[i] == "-" || ARGV[i] == "/dev/stdin") - continue # assignment or standard input - else if ((getline junk < ARGV[i]) < 0) # unreadable - delete ARGV[i] - else - close(ARGV[i]) - } - } - - This works, because the 'getline' won't be fatal. Removing the -element from 'ARGV' with 'delete' skips the file (because it's no longer -in the list). See also *note ARGC and ARGV::. - - Because 'awk' variable names only allow the English letters, the -regular expression check purposely does not use character classes such -as '[:alpha:]' and '[:alnum:]' (*note Bracket Expressions::). - - ---------- Footnotes ---------- - - (1) The 'BEGINFILE' special pattern (*note BEGINFILE/ENDFILE::) -provides an alternative mechanism for dealing with files that can't be -opened. However, the code here provides a portable solution. - - -File: gawk.info, Node: Empty Files, Next: Ignoring Assigns, Prev: File Checking, Up: Data File Management - -10.3.4 Checking for Zero-Length Files -------------------------------------- - -All known 'awk' implementations silently skip over zero-length files. -This is a by-product of 'awk''s implicit -read-a-record-and-match-against-the-rules loop: when 'awk' tries to read -a record from an empty file, it immediately receives an end-of-file -indication, closes the file, and proceeds on to the next command-line -data file, _without_ executing any user-level 'awk' program code. - - Using 'gawk''s 'ARGIND' variable (*note Built-in Variables::), it is -possible to detect when an empty data file has been skipped. Similar to -the library file presented in *note Filetrans Function::, the following -library file calls a function named 'zerofile()' that the user must -provide. The arguments passed are the file name and the position in -'ARGV' where it was found: - - # zerofile.awk --- library file to process empty input files - - BEGIN { Argind = 0 } - - ARGIND > Argind + 1 { - for (Argind++; Argind < ARGIND; Argind++) - zerofile(ARGV[Argind], Argind) - } - - ARGIND != Argind { Argind = ARGIND } - - END { - if (ARGIND > Argind) - for (Argind++; Argind <= ARGIND; Argind++) - zerofile(ARGV[Argind], Argind) - } - - The user-level variable 'Argind' allows the 'awk' program to track -its progress through 'ARGV'. Whenever the program detects that 'ARGIND' -is greater than 'Argind + 1', it means that one or more empty files were -skipped. The action then calls 'zerofile()' for each such file, -incrementing 'Argind' along the way. - - The 'Argind != ARGIND' rule simply keeps 'Argind' up to date in the -normal case. - - Finally, the 'END' rule catches the case of any empty files at the -end of the command-line arguments. Note that the test in the condition -of the 'for' loop uses the '<=' operator, not '<'. - - -File: gawk.info, Node: Ignoring Assigns, Prev: Empty Files, Up: Data File Management - -10.3.5 Treating Assignments as File names ------------------------------------------ - -Occasionally, you might not want 'awk' to process command-line variable -assignments (*note Assignment Options::). In particular, if you have a -file name that contains an '=' character, 'awk' treats the file name as -an assignment and does not process it. - - Some users have suggested an additional command-line option for -'gawk' to disable command-line assignments. However, some simple -programming with a library file does the trick: - - # noassign.awk --- library file to avoid the need for a - # special option that disables command-line assignments - - function disable_assigns(argc, argv, i) - { - for (i = 1; i < argc; i++) - if (argv[i] ~ /^[a-zA-Z_][a-zA-Z0-9_]*=.*/) - argv[i] = ("./" argv[i]) - } - - BEGIN { - if (No_command_assign) - disable_assigns(ARGC, ARGV) - } - - You then run your program this way: - - awk -v No_command_assign=1 -f noassign.awk -f yourprog.awk * - - The function works by looping through the arguments. It prepends -'./' to any argument that matches the form of a variable assignment, -turning that argument into a file name. - - The use of 'No_command_assign' allows you to disable command-line -assignments at invocation time, by giving the variable a true value. -When not set, it is initially zero (i.e., false), so the command-line -arguments are left alone. - - -File: gawk.info, Node: Getopt Function, Next: Passwd Functions, Prev: Data File Management, Up: Library Functions - -10.4 Processing Command-Line Options -==================================== - -Most utilities on POSIX-compatible systems take options on the command -line that can be used to change the way a program behaves. 'awk' is an -example of such a program (*note Options::). Often, options take -"arguments" (i.e., data that the program needs to correctly obey the -command-line option). For example, 'awk''s '-F' option requires a -string to use as the field separator. The first occurrence on the -command line of either '--' or a string that does not begin with '-' -ends the options. - - Modern Unix systems provide a C function named 'getopt()' for -processing command-line arguments. The programmer provides a string -describing the one-letter options. If an option requires an argument, -it is followed in the string with a colon. 'getopt()' is also passed -the count and values of the command-line arguments and is called in a -loop. 'getopt()' processes the command-line arguments for option -letters. Each time around the loop, it returns a single character -representing the next option letter that it finds, or '?' if it finds an -invalid option. When it returns -1, there are no options left on the -command line. - - When using 'getopt()', options that do not take arguments can be -grouped together. Furthermore, options that take arguments require that -the argument be present. The argument can immediately follow the option -letter, or it can be a separate command-line argument. - - Given a hypothetical program that takes three command-line options, -'-a', '-b', and '-c', where '-b' requires an argument, all of the -following are valid ways of invoking the program: - - prog -a -b foo -c data1 data2 data3 - prog -ac -bfoo -- data1 data2 data3 - prog -acbfoo data1 data2 data3 - - Notice that when the argument is grouped with its option, the rest of -the argument is considered to be the option's argument. In this -example, '-acbfoo' indicates that all of the '-a', '-b', and '-c' -options were supplied, and that 'foo' is the argument to the '-b' -option. - - 'getopt()' provides four external variables that the programmer can -use: - -'optind' - The index in the argument value array ('argv') where the first - nonoption command-line argument can be found. - -'optarg' - The string value of the argument to an option. - -'opterr' - Usually 'getopt()' prints an error message when it finds an invalid - option. Setting 'opterr' to zero disables this feature. (An - application might want to print its own error message.) - -'optopt' - The letter representing the command-line option. - - The following C fragment shows how 'getopt()' might process -command-line arguments for 'awk': - - int - main(int argc, char *argv[]) - { - ... - /* print our own message */ - opterr = 0; - while ((c = getopt(argc, argv, "v:f:F:W:")) != -1) { - switch (c) { - case 'f': /* file */ - ... - break; - case 'F': /* field separator */ - ... - break; - case 'v': /* variable assignment */ - ... - break; - case 'W': /* extension */ - ... - break; - case '?': - default: - usage(); - break; - } - } - ... - } - - As a side point, 'gawk' actually uses the GNU 'getopt_long()' -function to process both normal and GNU-style long options (*note -Options::). - - The abstraction provided by 'getopt()' is very useful and is quite -handy in 'awk' programs as well. Following is an 'awk' version of -'getopt()'. This function highlights one of the greatest weaknesses in -'awk', which is that it is very poor at manipulating single characters. -Repeated calls to 'substr()' are necessary for accessing individual -characters (*note String Functions::).(1) - - The discussion that follows walks through the code a bit at a time: - - # getopt.awk --- Do C library getopt(3) function in awk - - # External variables: - # Optind -- index in ARGV of first nonoption argument - # Optarg -- string value of argument to current option - # Opterr -- if nonzero, print our own diagnostic - # Optopt -- current option letter - - # Returns: - # -1 at end of options - # "?" for unrecognized option - # <c> a character representing the current option - - # Private Data: - # _opti -- index in multiflag option, e.g., -abc - - The function starts out with comments presenting a list of the global -variables it uses, what the return values are, what they mean, and any -global variables that are "private" to this library function. Such -documentation is essential for any program, and particularly for library -functions. - - The 'getopt()' function first checks that it was indeed called with a -string of options (the 'options' parameter). If 'options' has a zero -length, 'getopt()' immediately returns -1: - - function getopt(argc, argv, options, thisopt, i) - { - if (length(options) == 0) # no options given - return -1 - - if (argv[Optind] == "--") { # all done - Optind++ - _opti = 0 - return -1 - } else if (argv[Optind] !~ /^-[^:[:space:]]/) { - _opti = 0 - return -1 - } - - The next thing to check for is the end of the options. A '--' ends -the command-line options, as does any command-line argument that does -not begin with a '-'. 'Optind' is used to step through the array of -command-line arguments; it retains its value across calls to 'getopt()', -because it is a global variable. - - The regular expression that is used, '/^-[^:[:space:]/', checks for a -'-' followed by anything that is not whitespace and not a colon. If the -current command-line argument does not match this pattern, it is not an -option, and it ends option processing. Continuing on: - - if (_opti == 0) - _opti = 2 - thisopt = substr(argv[Optind], _opti, 1) - Optopt = thisopt - i = index(options, thisopt) - if (i == 0) { - if (Opterr) - printf("%c -- invalid option\n", thisopt) > "/dev/stderr" - if (_opti >= length(argv[Optind])) { - Optind++ - _opti = 0 - } else - _opti++ - return "?" - } - - The '_opti' variable tracks the position in the current command-line -argument ('argv[Optind]'). If multiple options are grouped together -with one '-' (e.g., '-abx'), it is necessary to return them to the user -one at a time. - - If '_opti' is equal to zero, it is set to two, which is the index in -the string of the next character to look at (we skip the '-', which is -at position one). The variable 'thisopt' holds the character, obtained -with 'substr()'. It is saved in 'Optopt' for the main program to use. - - If 'thisopt' is not in the 'options' string, then it is an invalid -option. If 'Opterr' is nonzero, 'getopt()' prints an error message on -the standard error that is similar to the message from the C version of -'getopt()'. - - Because the option is invalid, it is necessary to skip it and move on -to the next option character. If '_opti' is greater than or equal to -the length of the current command-line argument, it is necessary to move -on to the next argument, so 'Optind' is incremented and '_opti' is reset -to zero. Otherwise, 'Optind' is left alone and '_opti' is merely -incremented. - - In any case, because the option is invalid, 'getopt()' returns '"?"'. -The main program can examine 'Optopt' if it needs to know what the -invalid option letter actually is. Continuing on: - - if (substr(options, i + 1, 1) == ":") { - # get option argument - if (length(substr(argv[Optind], _opti + 1)) > 0) - Optarg = substr(argv[Optind], _opti + 1) - else - Optarg = argv[++Optind] - _opti = 0 - } else - Optarg = "" - - If the option requires an argument, the option letter is followed by -a colon in the 'options' string. If there are remaining characters in -the current command-line argument ('argv[Optind]'), then the rest of -that string is assigned to 'Optarg'. Otherwise, the next command-line -argument is used ('-xFOO' versus '-x FOO'). In either case, '_opti' is -reset to zero, because there are no more characters left to examine in -the current command-line argument. Continuing: - - if (_opti == 0 || _opti >= length(argv[Optind])) { - Optind++ - _opti = 0 - } else - _opti++ - return thisopt - } - - Finally, if '_opti' is either zero or greater than the length of the -current command-line argument, it means this element in 'argv' is -through being processed, so 'Optind' is incremented to point to the next -element in 'argv'. If neither condition is true, then only '_opti' is -incremented, so that the next option letter can be processed on the next -call to 'getopt()'. - - The 'BEGIN' rule initializes both 'Opterr' and 'Optind' to one. -'Opterr' is set to one, because the default behavior is for 'getopt()' -to print a diagnostic message upon seeing an invalid option. 'Optind' -is set to one, because there's no reason to look at the program name, -which is in 'ARGV[0]': - - BEGIN { - Opterr = 1 # default is to diagnose - Optind = 1 # skip ARGV[0] - - # test program - if (_getopt_test) { - while ((_go_c = getopt(ARGC, ARGV, "ab:cd")) != -1) - printf("c = <%c>, Optarg = <%s>\n", - _go_c, Optarg) - printf("non-option arguments:\n") - for (; Optind < ARGC; Optind++) - printf("\tARGV[%d] = <%s>\n", - Optind, ARGV[Optind]) - } - } - - The rest of the 'BEGIN' rule is a simple test program. Here are the -results of two sample runs of the test program: - - $ awk -f getopt.awk -v _getopt_test=1 -- -a -cbARG bax -x - -| c = <a>, Optarg = <> - -| c = <c>, Optarg = <> - -| c = <b>, Optarg = <ARG> - -| non-option arguments: - -| ARGV[3] = <bax> - -| ARGV[4] = <-x> - - $ awk -f getopt.awk -v _getopt_test=1 -- -a -x -- xyz abc - -| c = <a>, Optarg = <> - error-> x -- invalid option - -| c = <?>, Optarg = <> - -| non-option arguments: - -| ARGV[4] = <xyz> - -| ARGV[5] = <abc> - - In both runs, the first '--' terminates the arguments to 'awk', so -that it does not try to interpret the '-a', etc., as its own options. - - NOTE: After 'getopt()' is through, user-level code must clear out - all the elements of 'ARGV' from 1 to 'Optind', so that 'awk' does - not try to process the command-line options as file names. - - Using '#!' with the '-E' option may help avoid conflicts between your -program's options and 'gawk''s options, as '-E' causes 'gawk' to abandon -processing of further options (*note Executable Scripts:: and *note -Options::). - - Several of the sample programs presented in *note Sample Programs::, -use 'getopt()' to process their arguments. - - ---------- Footnotes ---------- - - (1) This function was written before 'gawk' acquired the ability to -split strings into single characters using '""' as the separator. We -have left it alone, as using 'substr()' is more portable. - - -File: gawk.info, Node: Passwd Functions, Next: Group Functions, Prev: Getopt Function, Up: Library Functions - -10.5 Reading the User Database -============================== - -The 'PROCINFO' array (*note Built-in Variables::) provides access to the -current user's real and effective user and group ID numbers, and, if -available, the user's supplementary group set. However, because these -are numbers, they do not provide very useful information to the average -user. There needs to be some way to find the user information -associated with the user and group ID numbers. This minor node presents -a suite of functions for retrieving information from the user database. -*Note Group Functions:: for a similar suite that retrieves information -from the group database. - - The POSIX standard does not define the file where user information is -kept. Instead, it provides the '<pwd.h>' header file and several C -language subroutines for obtaining user information. The primary -function is 'getpwent()', for "get password entry." The "password" -comes from the original user database file, '/etc/passwd', which stores -user information along with the encrypted passwords (hence the name). - - Although an 'awk' program could simply read '/etc/passwd' directly, -this file may not contain complete information about the system's set of -users.(1) To be sure you are able to produce a readable and complete -version of the user database, it is necessary to write a small C program -that calls 'getpwent()'. 'getpwent()' is defined as returning a pointer -to a 'struct passwd'. Each time it is called, it returns the next entry -in the database. When there are no more entries, it returns 'NULL', the -null pointer. When this happens, the C program should call 'endpwent()' -to close the database. Following is 'pwcat', a C program that "cats" -the password database: - - /* - * pwcat.c - * - * Generate a printable version of the password database. - */ - #include <stdio.h> - #include <pwd.h> - - int - main(int argc, char **argv) - { - struct passwd *p; - - while ((p = getpwent()) != NULL) - printf("%s:%s:%ld:%ld:%s:%s:%s\n", - p->pw_name, p->pw_passwd, (long) p->pw_uid, - (long) p->pw_gid, p->pw_gecos, p->pw_dir, p->pw_shell); - - endpwent(); - return 0; - } - - If you don't understand C, don't worry about it. The output from -'pwcat' is the user database, in the traditional '/etc/passwd' format of -colon-separated fields. The fields are: - -Login name - The user's login name. - -Encrypted password - The user's encrypted password. This may not be available on some - systems. - -User-ID - The user's numeric user ID number. (On some systems, it's a C - 'long', and not an 'int'. Thus, we cast it to 'long' for all - cases.) - -Group-ID - The user's numeric group ID number. (Similar comments about 'long' - versus 'int' apply here.) - -Full name - The user's full name, and perhaps other information associated with - the user. - -Home directory - The user's login (or "home") directory (familiar to shell - programmers as '$HOME'). - -Login shell - The program that is run when the user logs in. This is usually a - shell, such as Bash. - - A few lines representative of 'pwcat''s output are as follows: - - $ pwcat - -| root:x:0:1:Operator:/:/bin/sh - -| nobody:*:65534:65534::/: - -| daemon:*:1:1::/: - -| sys:*:2:2::/:/bin/csh - -| bin:*:3:3::/bin: - -| arnold:xyzzy:2076:10:Arnold Robbins:/home/arnold:/bin/sh - -| miriam:yxaay:112:10:Miriam Robbins:/home/miriam:/bin/sh - -| andy:abcca2:113:10:Andy Jacobs:/home/andy:/bin/sh - ... - - With that introduction, following is a group of functions for getting -user information. There are several functions here, corresponding to -the C functions of the same names: - - # passwd.awk --- access password file information - - BEGIN { - # tailor this to suit your system - _pw_awklib = "/usr/local/libexec/awk/" - } - - function _pw_init( oldfs, oldrs, olddol0, pwcat, using_fw, using_fpat) - { - if (_pw_inited) - return - - oldfs = FS - oldrs = RS - olddol0 = $0 - using_fw = (PROCINFO["FS"] == "FIELDWIDTHS") - using_fpat = (PROCINFO["FS"] == "FPAT") - FS = ":" - RS = "\n" - - pwcat = _pw_awklib "pwcat" - while ((pwcat | getline) > 0) { - _pw_byname[$1] = $0 - _pw_byuid[$3] = $0 - _pw_bycount[++_pw_total] = $0 - } - close(pwcat) - _pw_count = 0 - _pw_inited = 1 - FS = oldfs - if (using_fw) - FIELDWIDTHS = FIELDWIDTHS - else if (using_fpat) - FPAT = FPAT - RS = oldrs - $0 = olddol0 - } - - The 'BEGIN' rule sets a private variable to the directory where -'pwcat' is stored. Because it is used to help out an 'awk' library -routine, we have chosen to put it in '/usr/local/libexec/awk'; however, -you might want it to be in a different directory on your system. - - The function '_pw_init()' fills three copies of the user information -into three associative arrays. The arrays are indexed by username -('_pw_byname'), by user ID number ('_pw_byuid'), and by order of -occurrence ('_pw_bycount'). The variable '_pw_inited' is used for -efficiency, as '_pw_init()' needs to be called only once. - - Because this function uses 'getline' to read information from -'pwcat', it first saves the values of 'FS', 'RS', and '$0'. It notes in -the variable 'using_fw' whether field splitting with 'FIELDWIDTHS' is in -effect or not. Doing so is necessary, as these functions could be -called from anywhere within a user's program, and the user may have his -or her own way of splitting records and fields. This makes it possible -to restore the correct field-splitting mechanism later. The test can -only be true for 'gawk'. It is false if using 'FS' or 'FPAT', or on -some other 'awk' implementation. - - The code that checks for using 'FPAT', using 'using_fpat' and -'PROCINFO["FS"]', is similar. - - The main part of the function uses a loop to read database lines, -split the lines into fields, and then store the lines into each array as -necessary. When the loop is done, '_pw_init()' cleans up by closing the -pipeline, setting '_pw_inited' to one, and restoring 'FS' (and -'FIELDWIDTHS' or 'FPAT' if necessary), 'RS', and '$0'. The use of -'_pw_count' is explained shortly. - - The 'getpwnam()' function takes a username as a string argument. If -that user is in the database, it returns the appropriate line. -Otherwise, it relies on the array reference to a nonexistent element to -create the element with the null string as its value: - - function getpwnam(name) - { - _pw_init() - return _pw_byname[name] - } - - Similarly, the 'getpwuid()' function takes a user ID number argument. -If that user number is in the database, it returns the appropriate line. -Otherwise, it returns the null string: - - function getpwuid(uid) - { - _pw_init() - return _pw_byuid[uid] - } - - The 'getpwent()' function simply steps through the database, one -entry at a time. It uses '_pw_count' to track its current position in -the '_pw_bycount' array: - - function getpwent() - { - _pw_init() - if (_pw_count < _pw_total) - return _pw_bycount[++_pw_count] - return "" - } - - The 'endpwent()' function resets '_pw_count' to zero, so that -subsequent calls to 'getpwent()' start over again: - - function endpwent() - { - _pw_count = 0 - } - - A conscious design decision in this suite is that each subroutine -calls '_pw_init()' to initialize the database arrays. The overhead of -running a separate process to generate the user database, and the I/O to -scan it, are only incurred if the user's main program actually calls one -of these functions. If this library file is loaded along with a user's -program, but none of the routines are ever called, then there is no -extra runtime overhead. (The alternative is move the body of -'_pw_init()' into a 'BEGIN' rule, which always runs 'pwcat'. This -simplifies the code but runs an extra process that may never be needed.) - - In turn, calling '_pw_init()' is not too expensive, because the -'_pw_inited' variable keeps the program from reading the data more than -once. If you are worried about squeezing every last cycle out of your -'awk' program, the check of '_pw_inited' could be moved out of -'_pw_init()' and duplicated in all the other functions. In practice, -this is not necessary, as most 'awk' programs are I/O-bound, and such a -change would clutter up the code. - - The 'id' program in *note Id Program:: uses these functions. - - ---------- Footnotes ---------- - - (1) It is often the case that password information is stored in a -network database. - - -File: gawk.info, Node: Group Functions, Next: Walking Arrays, Prev: Passwd Functions, Up: Library Functions - -10.6 Reading the Group Database -=============================== - -Much of the discussion presented in *note Passwd Functions:: applies to -the group database as well. Although there has traditionally been a -well-known file ('/etc/group') in a well-known format, the POSIX -standard only provides a set of C library routines ('<grp.h>' and -'getgrent()') for accessing the information. Even though this file may -exist, it may not have complete information. Therefore, as with the -user database, it is necessary to have a small C program that generates -the group database as its output. 'grcat', a C program that "cats" the -group database, is as follows: - - /* - * grcat.c - * - * Generate a printable version of the group database. - */ - #include <stdio.h> - #include <grp.h> - - int - main(int argc, char **argv) - { - struct group *g; - int i; - - while ((g = getgrent()) != NULL) { - printf("%s:%s:%ld:", g->gr_name, g->gr_passwd, - (long) g->gr_gid); - for (i = 0; g->gr_mem[i] != NULL; i++) { - printf("%s", g->gr_mem[i]); - if (g->gr_mem[i+1] != NULL) - putchar(','); - } - putchar('\n'); - } - endgrent(); - return 0; - } - - Each line in the group database represents one group. The fields are -separated with colons and represent the following information: - -Group Name - The group's name. - -Group Password - The group's encrypted password. In practice, this field is never - used; it is usually empty or set to '*'. - -Group ID Number - The group's numeric group ID number; the association of name to - number must be unique within the file. (On some systems it's a C - 'long', and not an 'int'. Thus, we cast it to 'long' for all - cases.) - -Group Member List - A comma-separated list of usernames. These users are members of - the group. Modern Unix systems allow users to be members of - several groups simultaneously. If your system does, then there are - elements '"group1"' through '"groupN"' in 'PROCINFO' for those - group ID numbers. (Note that 'PROCINFO' is a 'gawk' extension; - *note Built-in Variables::.) - - Here is what running 'grcat' might produce: - - $ grcat - -| wheel:*:0:arnold - -| nogroup:*:65534: - -| daemon:*:1: - -| kmem:*:2: - -| staff:*:10:arnold,miriam,andy - -| other:*:20: - ... - - Here are the functions for obtaining information from the group -database. There are several, modeled after the C library functions of -the same names: - - # group.awk --- functions for dealing with the group file - - BEGIN { - # Change to suit your system - _gr_awklib = "/usr/local/libexec/awk/" - } - - function _gr_init( oldfs, oldrs, olddol0, grcat, - using_fw, using_fpat, n, a, i) - { - if (_gr_inited) - return - - oldfs = FS - oldrs = RS - olddol0 = $0 - using_fw = (PROCINFO["FS"] == "FIELDWIDTHS") - using_fpat = (PROCINFO["FS"] == "FPAT") - FS = ":" - RS = "\n" - - grcat = _gr_awklib "grcat" - while ((grcat | getline) > 0) { - if ($1 in _gr_byname) - _gr_byname[$1] = _gr_byname[$1] "," $4 - else - _gr_byname[$1] = $0 - if ($3 in _gr_bygid) - _gr_bygid[$3] = _gr_bygid[$3] "," $4 - else - _gr_bygid[$3] = $0 - - n = split($4, a, "[ \t]*,[ \t]*") - for (i = 1; i <= n; i++) - if (a[i] in _gr_groupsbyuser) - _gr_groupsbyuser[a[i]] = _gr_groupsbyuser[a[i]] " " $1 - else - _gr_groupsbyuser[a[i]] = $1 - - _gr_bycount[++_gr_count] = $0 - } - close(grcat) - _gr_count = 0 - _gr_inited++ - FS = oldfs - if (using_fw) - FIELDWIDTHS = FIELDWIDTHS - else if (using_fpat) - FPAT = FPAT - RS = oldrs - $0 = olddol0 - } - - The 'BEGIN' rule sets a private variable to the directory where -'grcat' is stored. Because it is used to help out an 'awk' library -routine, we have chosen to put it in '/usr/local/libexec/awk'. You -might want it to be in a different directory on your system. - - These routines follow the same general outline as the user database -routines (*note Passwd Functions::). The '_gr_inited' variable is used -to ensure that the database is scanned no more than once. The -'_gr_init()' function first saves 'FS', 'RS', and '$0', and then sets -'FS' and 'RS' to the correct values for scanning the group information. -It also takes care to note whether 'FIELDWIDTHS' or 'FPAT' is being -used, and to restore the appropriate field-splitting mechanism. - - The group information is stored in several associative arrays. The -arrays are indexed by group name ('_gr_byname'), by group ID number -('_gr_bygid'), and by position in the database ('_gr_bycount'). There -is an additional array indexed by username ('_gr_groupsbyuser'), which -is a space-separated list of groups to which each user belongs. - - Unlike in the user database, it is possible to have multiple records -in the database for the same group. This is common when a group has a -large number of members. A pair of such entries might look like the -following: - - tvpeople:*:101:johnny,jay,arsenio - tvpeople:*:101:david,conan,tom,joan - - For this reason, '_gr_init()' looks to see if a group name or group -ID number is already seen. If so, the usernames are simply concatenated -onto the previous list of users.(1) - - Finally, '_gr_init()' closes the pipeline to 'grcat', restores 'FS' -(and 'FIELDWIDTHS' or 'FPAT', if necessary), 'RS', and '$0', initializes -'_gr_count' to zero (it is used later), and makes '_gr_inited' nonzero. - - The 'getgrnam()' function takes a group name as its argument, and if -that group exists, it is returned. Otherwise, it relies on the array -reference to a nonexistent element to create the element with the null -string as its value: - - function getgrnam(group) - { - _gr_init() - return _gr_byname[group] - } - - The 'getgrgid()' function is similar; it takes a numeric group ID and -looks up the information associated with that group ID: - - function getgrgid(gid) - { - _gr_init() - return _gr_bygid[gid] - } - - The 'getgruser()' function does not have a C counterpart. It takes a -username and returns the list of groups that have the user as a member: - - function getgruser(user) - { - _gr_init() - return _gr_groupsbyuser[user] - } - - The 'getgrent()' function steps through the database one entry at a -time. It uses '_gr_count' to track its position in the list: - - function getgrent() - { - _gr_init() - if (++_gr_count in _gr_bycount) - return _gr_bycount[_gr_count] - return "" - } - - The 'endgrent()' function resets '_gr_count' to zero so that -'getgrent()' can start over again: - - function endgrent() - { - _gr_count = 0 - } - - As with the user database routines, each function calls '_gr_init()' -to initialize the arrays. Doing so only incurs the extra overhead of -running 'grcat' if these functions are used (as opposed to moving the -body of '_gr_init()' into a 'BEGIN' rule). - - Most of the work is in scanning the database and building the various -associative arrays. The functions that the user calls are themselves -very simple, relying on 'awk''s associative arrays to do work. - - The 'id' program in *note Id Program:: uses these functions. - - ---------- Footnotes ---------- - - (1) There is a subtle problem with the code just presented. Suppose -that the first time there were no names. This code adds the names with -a leading comma. It also doesn't check that there is a '$4'. - - -File: gawk.info, Node: Walking Arrays, Next: Library Functions Summary, Prev: Group Functions, Up: Library Functions - -10.7 Traversing Arrays of Arrays -================================ - -*note Arrays of Arrays:: described how 'gawk' provides arrays of arrays. -In particular, any element of an array may be either a scalar or another -array. The 'isarray()' function (*note Type Functions::) lets you -distinguish an array from a scalar. The following function, -'walk_array()', recursively traverses an array, printing the element -indices and values. You call it with the array and a string -representing the name of the array: - - function walk_array(arr, name, i) - { - for (i in arr) { - if (isarray(arr[i])) - walk_array(arr[i], (name "[" i "]")) - else - printf("%s[%s] = %s\n", name, i, arr[i]) - } - } - -It works by looping over each element of the array. If any given -element is itself an array, the function calls itself recursively, -passing the subarray and a new string representing the current index. -Otherwise, the function simply prints the element's name, index, and -value. Here is a main program to demonstrate: - - BEGIN { - a[1] = 1 - a[2][1] = 21 - a[2][2] = 22 - a[3] = 3 - a[4][1][1] = 411 - a[4][2] = 42 - - walk_array(a, "a") - } - - When run, the program produces the following output: - - $ gawk -f walk_array.awk - -| a[1] = 1 - -| a[2][1] = 21 - -| a[2][2] = 22 - -| a[3] = 3 - -| a[4][1][1] = 411 - -| a[4][2] = 42 - - The function just presented simply prints the name and value of each -scalar array element. However, it is easy to generalize it, by passing -in the name of a function to call when walking an array. The modified -function looks like this: - - function process_array(arr, name, process, do_arrays, i, new_name) - { - for (i in arr) { - new_name = (name "[" i "]") - if (isarray(arr[i])) { - if (do_arrays) - @process(new_name, arr[i]) - process_array(arr[i], new_name, process, do_arrays) - } else - @process(new_name, arr[i]) - } - } - - The arguments are as follows: - -'arr' - The array. - -'name' - The name of the array (a string). - -'process' - The name of the function to call. - -'do_arrays' - If this is true, the function can handle elements that are - subarrays. - - If subarrays are to be processed, that is done before walking them -further. - - When run with the following scaffolding, the function produces the -same results as does the earlier version of 'walk_array()': - - BEGIN { - a[1] = 1 - a[2][1] = 21 - a[2][2] = 22 - a[3] = 3 - a[4][1][1] = 411 - a[4][2] = 42 - - process_array(a, "a", "do_print", 0) - } - - function do_print(name, element) - { - printf "%s = %s\n", name, element - } - - -File: gawk.info, Node: Library Functions Summary, Next: Library Exercises, Prev: Walking Arrays, Up: Library Functions - -10.8 Summary -============ - - * Reading programs is an excellent way to learn Good Programming. - The functions and programs provided in this major node and the next - are intended to serve that purpose. - - * When writing general-purpose library functions, put some thought - into how to name any global variables so that they won't conflict - with variables from a user's program. - - * The functions presented here fit into the following categories: - - General problems - Number-to-string conversion, testing assertions, rounding, - random number generation, converting characters to numbers, - joining strings, getting easily usable time-of-day - information, and reading a whole file in one shot - - Managing data files - Noting data file boundaries, rereading the current file, - checking for readable files, checking for zero-length files, - and treating assignments as file names - - Processing command-line options - An 'awk' version of the standard C 'getopt()' function - - Reading the user and group databases - Two sets of routines that parallel the C library versions - - Traversing arrays of arrays - Two functions that traverse an array of arrays to any depth - - -File: gawk.info, Node: Library Exercises, Prev: Library Functions Summary, Up: Library Functions - -10.9 Exercises -============== - - 1. In *note Empty Files::, we presented the 'zerofile.awk' program, - which made use of 'gawk''s 'ARGIND' variable. Can this problem be - solved without relying on 'ARGIND'? If so, how? - - 2. As a related challenge, revise that code to handle the case where - an intervening value in 'ARGV' is a variable assignment. - - -File: gawk.info, Node: Sample Programs, Next: Advanced Features, Prev: Library Functions, Up: Top - -11 Practical 'awk' Programs -*************************** - -*note Library Functions::, presents the idea that reading programs in a -language contributes to learning that language. This major node -continues that theme, presenting a potpourri of 'awk' programs for your -reading enjoyment. - - Many of these programs use library functions presented in *note -Library Functions::. - -* Menu: - -* Running Examples:: How to run these examples. -* Clones:: Clones of common utilities. -* Miscellaneous Programs:: Some interesting 'awk' programs. -* Programs Summary:: Summary of programs. -* Programs Exercises:: Exercises. - - -File: gawk.info, Node: Running Examples, Next: Clones, Up: Sample Programs - -11.1 Running the Example Programs -================================= - -To run a given program, you would typically do something like this: - - awk -f PROGRAM -- OPTIONS FILES - -Here, PROGRAM is the name of the 'awk' program (such as 'cut.awk'), -OPTIONS are any command-line options for the program that start with a -'-', and FILES are the actual data files. - - If your system supports the '#!' executable interpreter mechanism -(*note Executable Scripts::), you can instead run your program directly: - - cut.awk -c1-8 myfiles > results - - If your 'awk' is not 'gawk', you may instead need to use this: - - cut.awk -- -c1-8 myfiles > results - - -File: gawk.info, Node: Clones, Next: Miscellaneous Programs, Prev: Running Examples, Up: Sample Programs - -11.2 Reinventing Wheels for Fun and Profit -========================================== - -This minor node presents a number of POSIX utilities implemented in -'awk'. Reinventing these programs in 'awk' is often enjoyable, because -the algorithms can be very clearly expressed, and the code is usually -very concise and simple. This is true because 'awk' does so much for -you. - - It should be noted that these programs are not necessarily intended -to replace the installed versions on your system. Nor may all of these -programs be fully compliant with the most recent POSIX standard. This -is not a problem; their purpose is to illustrate 'awk' language -programming for "real-world" tasks. - - The programs are presented in alphabetical order. - -* Menu: - -* Cut Program:: The 'cut' utility. -* Egrep Program:: The 'egrep' utility. -* Id Program:: The 'id' utility. -* Split Program:: The 'split' utility. -* Tee Program:: The 'tee' utility. -* Uniq Program:: The 'uniq' utility. -* Wc Program:: The 'wc' utility. - - -File: gawk.info, Node: Cut Program, Next: Egrep Program, Up: Clones - -11.2.1 Cutting Out Fields and Columns -------------------------------------- - -The 'cut' utility selects, or "cuts," characters or fields from its -standard input and sends them to its standard output. Fields are -separated by TABs by default, but you may supply a command-line option -to change the field "delimiter" (i.e., the field-separator character). -'cut''s definition of fields is less general than 'awk''s. - - A common use of 'cut' might be to pull out just the login names of -logged-on users from the output of 'who'. For example, the following -pipeline generates a sorted, unique list of the logged-on users: - - who | cut -c1-8 | sort | uniq - - The options for 'cut' are: - -'-c LIST' - Use LIST as the list of characters to cut out. Items within the - list may be separated by commas, and ranges of characters can be - separated with dashes. The list '1-8,15,22-35' specifies - characters 1 through 8, 15, and 22 through 35. - -'-f LIST' - Use LIST as the list of fields to cut out. - -'-d DELIM' - Use DELIM as the field-separator character instead of the TAB - character. - -'-s' - Suppress printing of lines that do not contain the field delimiter. - - The 'awk' implementation of 'cut' uses the 'getopt()' library -function (*note Getopt Function::) and the 'join()' library function -(*note Join Function::). - - The program begins with a comment describing the options, the library -functions needed, and a 'usage()' function that prints out a usage -message and exits. 'usage()' is called if invalid arguments are -supplied: - - # cut.awk --- implement cut in awk - - # Options: - # -f list Cut fields - # -d c Field delimiter character - # -c list Cut characters - # - # -s Suppress lines without the delimiter - # - # Requires getopt() and join() library functions - - function usage() - { - print("usage: cut [-f list] [-d c] [-s] [files...]") > "/dev/stderr" - print("usage: cut [-c list] [files...]") > "/dev/stderr" - exit 1 - } - - Next comes a 'BEGIN' rule that parses the command-line options. It -sets 'FS' to a single TAB character, because that is 'cut''s default -field separator. The rule then sets the output field separator to be -the same as the input field separator. A loop using 'getopt()' steps -through the command-line options. Exactly one of the variables -'by_fields' or 'by_chars' is set to true, to indicate that processing -should be done by fields or by characters, respectively. When cutting -by characters, the output field separator is set to the null string: - - BEGIN { - FS = "\t" # default - OFS = FS - while ((c = getopt(ARGC, ARGV, "sf:c:d:")) != -1) { - if (c == "f") { - by_fields = 1 - fieldlist = Optarg - } else if (c == "c") { - by_chars = 1 - fieldlist = Optarg - OFS = "" - } else if (c == "d") { - if (length(Optarg) > 1) { - printf("cut: using first character of %s" \ - " for delimiter\n", Optarg) > "/dev/stderr" - Optarg = substr(Optarg, 1, 1) - } - fs = FS = Optarg - OFS = FS - if (FS == " ") # defeat awk semantics - FS = "[ ]" - } else if (c == "s") - suppress = 1 - else - usage() - } - - # Clear out options - for (i = 1; i < Optind; i++) - ARGV[i] = "" - - The code must take special care when the field delimiter is a space. -Using a single space ('" "') for the value of 'FS' is incorrect--'awk' -would separate fields with runs of spaces, TABs, and/or newlines, and we -want them to be separated with individual spaces. To this end, we save -the original space character in the variable 'fs' for later use; after -setting 'FS' to '"[ ]"' we can't use it directly to see if the field -delimiter character is in the string. - - Also remember that after 'getopt()' is through (as described in *note -Getopt Function::), we have to clear out all the elements of 'ARGV' from -1 to 'Optind', so that 'awk' does not try to process the command-line -options as file names. - - After dealing with the command-line options, the program verifies -that the options make sense. Only one or the other of '-c' and '-f' -should be used, and both require a field list. Then the program calls -either 'set_fieldlist()' or 'set_charlist()' to pull apart the list of -fields or characters: - - if (by_fields && by_chars) - usage() - - if (by_fields == 0 && by_chars == 0) - by_fields = 1 # default - - if (fieldlist == "") { - print "cut: needs list for -c or -f" > "/dev/stderr" - exit 1 - } - - if (by_fields) - set_fieldlist() - else - set_charlist() - } - - 'set_fieldlist()' splits the field list apart at the commas into an -array. Then, for each element of the array, it looks to see if the -element is actually a range, and if so, splits it apart. The function -checks the range to make sure that the first number is smaller than the -second. Each number in the list is added to the 'flist' array, which -simply lists the fields that will be printed. Normal field splitting is -used. The program lets 'awk' handle the job of doing the field -splitting: - - function set_fieldlist( n, m, i, j, k, f, g) - { - n = split(fieldlist, f, ",") - j = 1 # index in flist - for (i = 1; i <= n; i++) { - if (index(f[i], "-") != 0) { # a range - m = split(f[i], g, "-") - if (m != 2 || g[1] >= g[2]) { - printf("cut: bad field list: %s\n", - f[i]) > "/dev/stderr" - exit 1 - } - for (k = g[1]; k <= g[2]; k++) - flist[j++] = k - } else - flist[j++] = f[i] - } - nfields = j - 1 - } - - The 'set_charlist()' function is more complicated than -'set_fieldlist()'. The idea here is to use 'gawk''s 'FIELDWIDTHS' -variable (*note Constant Size::), which describes constant-width input. -When using a character list, that is exactly what we have. - - Setting up 'FIELDWIDTHS' is more complicated than simply listing the -fields that need to be printed. We have to keep track of the fields to -print and also the intervening characters that have to be skipped. For -example, suppose you wanted characters 1 through 8, 15, and 22 through -35. You would use '-c 1-8,15,22-35'. The necessary value for -'FIELDWIDTHS' is '"8 6 1 6 14"'. This yields five fields, and the -fields to print are '$1', '$3', and '$5'. The intermediate fields are -"filler", which is stuff in between the desired data. 'flist' lists the -fields to print, and 't' tracks the complete field list, including -filler fields: - - function set_charlist( field, i, j, f, g, n, m, t, - filler, last, len) - { - field = 1 # count total fields - n = split(fieldlist, f, ",") - j = 1 # index in flist - for (i = 1; i <= n; i++) { - if (index(f[i], "-") != 0) { # range - m = split(f[i], g, "-") - if (m != 2 || g[1] >= g[2]) { - printf("cut: bad character list: %s\n", - f[i]) > "/dev/stderr" - exit 1 - } - len = g[2] - g[1] + 1 - if (g[1] > 1) # compute length of filler - filler = g[1] - last - 1 - else - filler = 0 - if (filler) - t[field++] = filler - t[field++] = len # length of field - last = g[2] - flist[j++] = field - 1 - } else { - if (f[i] > 1) - filler = f[i] - last - 1 - else - filler = 0 - if (filler) - t[field++] = filler - t[field++] = 1 - last = f[i] - flist[j++] = field - 1 - } - } - FIELDWIDTHS = join(t, 1, field - 1) - nfields = j - 1 - } - - Next is the rule that processes the data. If the '-s' option is -given, then 'suppress' is true. The first 'if' statement makes sure -that the input record does have the field separator. If 'cut' is -processing fields, 'suppress' is true, and the field separator character -is not in the record, then the record is skipped. - - If the record is valid, then 'gawk' has split the data into fields, -either using the character in 'FS' or using fixed-length fields and -'FIELDWIDTHS'. The loop goes through the list of fields that should be -printed. The corresponding field is printed if it contains data. If -the next field also has data, then the separator character is written -out between the fields: - - { - if (by_fields && suppress && index($0, fs) == 0) - next - - for (i = 1; i <= nfields; i++) { - if ($flist[i] != "") { - printf "%s", $flist[i] - if (i < nfields && $flist[i+1] != "") - printf "%s", OFS - } - } - print "" - } - - This version of 'cut' relies on 'gawk''s 'FIELDWIDTHS' variable to do -the character-based cutting. It is possible in other 'awk' -implementations to use 'substr()' (*note String Functions::), but it is -also extremely painful. The 'FIELDWIDTHS' variable supplies an elegant -solution to the problem of picking the input line apart by characters. - - -File: gawk.info, Node: Egrep Program, Next: Id Program, Prev: Cut Program, Up: Clones - -11.2.2 Searching for Regular Expressions in Files -------------------------------------------------- - -The 'egrep' utility searches files for patterns. It uses regular -expressions that are almost identical to those available in 'awk' (*note -Regexp::). You invoke it as follows: - - 'egrep' [OPTIONS] ''PATTERN'' FILES ... - - The PATTERN is a regular expression. In typical usage, the regular -expression is quoted to prevent the shell from expanding any of the -special characters as file name wildcards. Normally, 'egrep' prints the -lines that matched. If multiple file names are provided on the command -line, each output line is preceded by the name of the file and a colon. - - The options to 'egrep' are as follows: - -'-c' - Print out a count of the lines that matched the pattern, instead of - the lines themselves. - -'-s' - Be silent. No output is produced and the exit value indicates - whether the pattern was matched. - -'-v' - Invert the sense of the test. 'egrep' prints the lines that do - _not_ match the pattern and exits successfully if the pattern is - not matched. - -'-i' - Ignore case distinctions in both the pattern and the input data. - -'-l' - Only print (list) the names of the files that matched, not the - lines that matched. - -'-e PATTERN' - Use PATTERN as the regexp to match. The purpose of the '-e' option - is to allow patterns that start with a '-'. - - This version uses the 'getopt()' library function (*note Getopt -Function::) and the file transition library program (*note Filetrans -Function::). - - The program begins with a descriptive comment and then a 'BEGIN' rule -that processes the command-line arguments with 'getopt()'. The '-i' -(ignore case) option is particularly easy with 'gawk'; we just use the -'IGNORECASE' predefined variable (*note Built-in Variables::): - - # egrep.awk --- simulate egrep in awk - # - # Options: - # -c count of lines - # -s silent - use exit value - # -v invert test, success if no match - # -i ignore case - # -l print filenames only - # -e argument is pattern - # - # Requires getopt and file transition library functions - - BEGIN { - while ((c = getopt(ARGC, ARGV, "ce:svil")) != -1) { - if (c == "c") - count_only++ - else if (c == "s") - no_print++ - else if (c == "v") - invert++ - else if (c == "i") - IGNORECASE = 1 - else if (c == "l") - filenames_only++ - else if (c == "e") - pattern = Optarg - else - usage() - } - - Next comes the code that handles the 'egrep'-specific behavior. If -no pattern is supplied with '-e', the first nonoption on the command -line is used. The 'awk' command-line arguments up to 'ARGV[Optind]' are -cleared, so that 'awk' won't try to process them as files. If no files -are specified, the standard input is used, and if multiple files are -specified, we make sure to note this so that the file names can precede -the matched lines in the output: - - if (pattern == "") - pattern = ARGV[Optind++] - - for (i = 1; i < Optind; i++) - ARGV[i] = "" - if (Optind >= ARGC) { - ARGV[1] = "-" - ARGC = 2 - } else if (ARGC - Optind > 1) - do_filenames++ - - # if (IGNORECASE) - # pattern = tolower(pattern) - } - - The last two lines are commented out, as they are not needed in -'gawk'. They should be uncommented if you have to use another version -of 'awk'. - - The next set of lines should be uncommented if you are not using -'gawk'. This rule translates all the characters in the input line into -lowercase if the '-i' option is specified.(1) The rule is commented out -as it is not necessary with 'gawk': - - #{ - # if (IGNORECASE) - # $0 = tolower($0) - #} - - The 'beginfile()' function is called by the rule in 'ftrans.awk' when -each new file is processed. In this case, it is very simple; all it -does is initialize a variable 'fcount' to zero. 'fcount' tracks how -many lines in the current file matched the pattern. Naming the -parameter 'junk' shows we know that 'beginfile()' is called with a -parameter, but that we're not interested in its value: - - function beginfile(junk) - { - fcount = 0 - } - - The 'endfile()' function is called after each file has been -processed. It affects the output only when the user wants a count of -the number of lines that matched. 'no_print' is true only if the exit -status is desired. 'count_only' is true if line counts are desired. -'egrep' therefore only prints line counts if printing and counting are -enabled. The output format must be adjusted depending upon the number -of files to process. Finally, 'fcount' is added to 'total', so that we -know the total number of lines that matched the pattern: - - function endfile(file) - { - if (! no_print && count_only) { - if (do_filenames) - print file ":" fcount - else - print fcount - } - - total += fcount - } - - The 'BEGINFILE' and 'ENDFILE' special patterns (*note -BEGINFILE/ENDFILE::) could be used, but then the program would be -'gawk'-specific. Additionally, this example was written before 'gawk' -acquired 'BEGINFILE' and 'ENDFILE'. - - The following rule does most of the work of matching lines. The -variable 'matches' is true if the line matched the pattern. If the user -wants lines that did not match, the sense of 'matches' is inverted using -the '!' operator. 'fcount' is incremented with the value of 'matches', -which is either one or zero, depending upon a successful or unsuccessful -match. If the line does not match, the 'next' statement just moves on -to the next record. - - A number of additional tests are made, but they are only done if we -are not counting lines. First, if the user only wants the exit status -('no_print' is true), then it is enough to know that _one_ line in this -file matched, and we can skip on to the next file with 'nextfile'. -Similarly, if we are only printing file names, we can print the file -name, and then skip to the next file with 'nextfile'. Finally, each -line is printed, with a leading file name and colon if necessary: - - { - matches = ($0 ~ pattern) - if (invert) - matches = ! matches - - fcount += matches # 1 or 0 - - if (! matches) - next - - if (! count_only) { - if (no_print) - nextfile - - if (filenames_only) { - print FILENAME - nextfile - } - - if (do_filenames) - print FILENAME ":" $0 - else - print - } - } - - The 'END' rule takes care of producing the correct exit status. If -there are no matches, the exit status is one; otherwise, it is zero: - - END { - exit (total == 0) - } - - The 'usage()' function prints a usage message in case of invalid -options, and then exits: - - function usage() - { - print("Usage: egrep [-csvil] [-e pat] [files ...]") > "/dev/stderr" - print("\n\tegrep [-csvil] pat [files ...]") > "/dev/stderr" - exit 1 - } - - ---------- Footnotes ---------- - - (1) It also introduces a subtle bug; if a match happens, we output -the translated line, not the original. - - -File: gawk.info, Node: Id Program, Next: Split Program, Prev: Egrep Program, Up: Clones - -11.2.3 Printing Out User Information ------------------------------------- - -The 'id' utility lists a user's real and effective user ID numbers, real -and effective group ID numbers, and the user's group set, if any. 'id' -only prints the effective user ID and group ID if they are different -from the real ones. If possible, 'id' also supplies the corresponding -user and group names. The output might look like this: - - $ id - -| uid=1000(arnold) gid=1000(arnold) groups=1000(arnold),4(adm),7(lp),27(sudo) - - This information is part of what is provided by 'gawk''s 'PROCINFO' -array (*note Built-in Variables::). However, the 'id' utility provides -a more palatable output than just individual numbers. - - Here is a simple version of 'id' written in 'awk'. It uses the user -database library functions (*note Passwd Functions::) and the group -database library functions (*note Group Functions::) from *note Library -Functions::. - - The program is fairly straightforward. All the work is done in the -'BEGIN' rule. The user and group ID numbers are obtained from -'PROCINFO'. The code is repetitive. The entry in the user database for -the real user ID number is split into parts at the ':'. The name is the -first field. Similar code is used for the effective user ID number and -the group numbers: - - # id.awk --- implement id in awk - # - # Requires user and group library functions - # output is: - # uid=12(foo) euid=34(bar) gid=3(baz) \ - # egid=5(blat) groups=9(nine),2(two),1(one) - - BEGIN { - uid = PROCINFO["uid"] - euid = PROCINFO["euid"] - gid = PROCINFO["gid"] - egid = PROCINFO["egid"] - - printf("uid=%d", uid) - pw = getpwuid(uid) - pr_first_field(pw) - - if (euid != uid) { - printf(" euid=%d", euid) - pw = getpwuid(euid) - pr_first_field(pw) - } - - printf(" gid=%d", gid) - pw = getgrgid(gid) - pr_first_field(pw) - - if (egid != gid) { - printf(" egid=%d", egid) - pw = getgrgid(egid) - pr_first_field(pw) - } - - for (i = 1; ("group" i) in PROCINFO; i++) { - if (i == 1) - printf(" groups=") - group = PROCINFO["group" i] - printf("%d", group) - pw = getgrgid(group) - pr_first_field(pw) - if (("group" (i+1)) in PROCINFO) - printf(",") - } - - print "" - } - - function pr_first_field(str, a) - { - if (str != "") { - split(str, a, ":") - printf("(%s)", a[1]) - } - } - - The test in the 'for' loop is worth noting. Any supplementary groups -in the 'PROCINFO' array have the indices '"group1"' through '"groupN"' -for some N (i.e., the total number of supplementary groups). However, -we don't know in advance how many of these groups there are. - - This loop works by starting at one, concatenating the value with -'"group"', and then using 'in' to see if that value is in the array -(*note Reference to Elements::). Eventually, 'i' is incremented past -the last group in the array and the loop exits. - - The loop is also correct if there are _no_ supplementary groups; then -the condition is false the first time it's tested, and the loop body -never executes. - - The 'pr_first_field()' function simply isolates out some code that is -used repeatedly, making the whole program shorter and cleaner. In -particular, moving the check for the empty string into this function -saves several lines of code. - - -File: gawk.info, Node: Split Program, Next: Tee Program, Prev: Id Program, Up: Clones - -11.2.4 Splitting a Large File into Pieces ------------------------------------------ - -The 'split' program splits large text files into smaller pieces. Usage -is as follows:(1) - - 'split' ['-COUNT'] [FILE] [PREFIX] - - By default, the output files are named 'xaa', 'xab', and so on. Each -file has 1,000 lines in it, with the likely exception of the last file. -To change the number of lines in each file, supply a number on the -command line preceded with a minus sign (e.g., '-500' for files with 500 -lines in them instead of 1,000). To change the names of the output -files to something like 'myfileaa', 'myfileab', and so on, supply an -additional argument that specifies the file name prefix. - - Here is a version of 'split' in 'awk'. It uses the 'ord()' and -'chr()' functions presented in *note Ordinal Functions::. - - The program first sets its defaults, and then tests to make sure -there are not too many arguments. It then looks at each argument in -turn. The first argument could be a minus sign followed by a number. -If it is, this happens to look like a negative number, so it is made -positive, and that is the count of lines. The data file name is skipped -over and the final argument is used as the prefix for the output file -names: - - # split.awk --- do split in awk - # - # Requires ord() and chr() library functions - # usage: split [-count] [file] [outname] - - BEGIN { - outfile = "x" # default - count = 1000 - if (ARGC > 4) - usage() - - i = 1 - if (i in ARGV && ARGV[i] ~ /^-[[:digit:]]+$/) { - count = -ARGV[i] - ARGV[i] = "" - i++ - } - # test argv in case reading from stdin instead of file - if (i in ARGV) - i++ # skip datafile name - if (i in ARGV) { - outfile = ARGV[i] - ARGV[i] = "" - } - - s1 = s2 = "a" - out = (outfile s1 s2) - } - - The next rule does most of the work. 'tcount' (temporary count) -tracks how many lines have been printed to the output file so far. If -it is greater than 'count', it is time to close the current file and -start a new one. 's1' and 's2' track the current suffixes for the file -name. If they are both 'z', the file is just too big. Otherwise, 's1' -moves to the next letter in the alphabet and 's2' starts over again at -'a': - - { - if (++tcount > count) { - close(out) - if (s2 == "z") { - if (s1 == "z") { - printf("split: %s is too large to split\n", - FILENAME) > "/dev/stderr" - exit 1 - } - s1 = chr(ord(s1) + 1) - s2 = "a" - } - else - s2 = chr(ord(s2) + 1) - out = (outfile s1 s2) - tcount = 1 - } - print > out - } - -The 'usage()' function simply prints an error message and exits: - - function usage() - { - print("usage: split [-num] [file] [outname]") > "/dev/stderr" - exit 1 - } - - This program is a bit sloppy; it relies on 'awk' to automatically -close the last file instead of doing it in an 'END' rule. It also -assumes that letters are contiguous in the character set, which isn't -true for EBCDIC systems. - - ---------- Footnotes ---------- - - (1) This is the traditional usage. The POSIX usage is different, but -not relevant for what the program aims to demonstrate. - - -File: gawk.info, Node: Tee Program, Next: Uniq Program, Prev: Split Program, Up: Clones - -11.2.5 Duplicating Output into Multiple Files ---------------------------------------------- - -The 'tee' program is known as a "pipe fitting." 'tee' copies its -standard input to its standard output and also duplicates it to the -files named on the command line. Its usage is as follows: - - 'tee' ['-a'] FILE ... - - The '-a' option tells 'tee' to append to the named files, instead of -truncating them and starting over. - - The 'BEGIN' rule first makes a copy of all the command-line arguments -into an array named 'copy'. 'ARGV[0]' is not needed, so it is not -copied. 'tee' cannot use 'ARGV' directly, because 'awk' attempts to -process each file name in 'ARGV' as input data. - - If the first argument is '-a', then the flag variable 'append' is set -to true, and both 'ARGV[1]' and 'copy[1]' are deleted. If 'ARGC' is -less than two, then no file names were supplied and 'tee' prints a usage -message and exits. Finally, 'awk' is forced to read the standard input -by setting 'ARGV[1]' to '"-"' and 'ARGC' to two: - - # tee.awk --- tee in awk - # - # Copy standard input to all named output files. - # Append content if -a option is supplied. - # - BEGIN { - for (i = 1; i < ARGC; i++) - copy[i] = ARGV[i] - - if (ARGV[1] == "-a") { - append = 1 - delete ARGV[1] - delete copy[1] - ARGC-- - } - if (ARGC < 2) { - print "usage: tee [-a] file ..." > "/dev/stderr" - exit 1 - } - ARGV[1] = "-" - ARGC = 2 - } - - The following single rule does all the work. Because there is no -pattern, it is executed for each line of input. The body of the rule -simply prints the line into each file on the command line, and then to -the standard output: - - { - # moving the if outside the loop makes it run faster - if (append) - for (i in copy) - print >> copy[i] - else - for (i in copy) - print > copy[i] - print - } - -It is also possible to write the loop this way: - - for (i in copy) - if (append) - print >> copy[i] - else - print > copy[i] - -This is more concise, but it is also less efficient. The 'if' is tested -for each record and for each output file. By duplicating the loop body, -the 'if' is only tested once for each input record. If there are N -input records and M output files, the first method only executes N 'if' -statements, while the second executes N'*'M 'if' statements. - - Finally, the 'END' rule cleans up by closing all the output files: - - END { - for (i in copy) - close(copy[i]) - } - - -File: gawk.info, Node: Uniq Program, Next: Wc Program, Prev: Tee Program, Up: Clones - -11.2.6 Printing Nonduplicated Lines of Text -------------------------------------------- - -The 'uniq' utility reads sorted lines of data on its standard input, and -by default removes duplicate lines. In other words, it only prints -unique lines--hence the name. 'uniq' has a number of options. The -usage is as follows: - - 'uniq' ['-udc' ['-N']] ['+N'] [INPUTFILE [OUTPUTFILE]] - - The options for 'uniq' are: - -'-d' - Print only repeated (duplicated) lines. - -'-u' - Print only nonrepeated (unique) lines. - -'-c' - Count lines. This option overrides '-d' and '-u'. Both repeated - and nonrepeated lines are counted. - -'-N' - Skip N fields before comparing lines. The definition of fields is - similar to 'awk''s default: nonwhitespace characters separated by - runs of spaces and/or TABs. - -'+N' - Skip N characters before comparing lines. Any fields specified - with '-N' are skipped first. - -'INPUTFILE' - Data is read from the input file named on the command line, instead - of from the standard input. - -'OUTPUTFILE' - The generated output is sent to the named output file, instead of - to the standard output. - - Normally 'uniq' behaves as if both the '-d' and '-u' options are -provided. - - 'uniq' uses the 'getopt()' library function (*note Getopt Function::) -and the 'join()' library function (*note Join Function::). - - The program begins with a 'usage()' function and then a brief outline -of the options and their meanings in comments. The 'BEGIN' rule deals -with the command-line arguments and options. It uses a trick to get -'getopt()' to handle options of the form '-25', treating such an option -as the option letter '2' with an argument of '5'. If indeed two or more -digits are supplied ('Optarg' looks like a number), 'Optarg' is -concatenated with the option digit and then the result is added to zero -to make it into a number. If there is only one digit in the option, -then 'Optarg' is not needed. In this case, 'Optind' must be decremented -so that 'getopt()' processes it next time. This code is admittedly a -bit tricky. - - If no options are supplied, then the default is taken, to print both -repeated and nonrepeated lines. The output file, if provided, is -assigned to 'outputfile'. Early on, 'outputfile' is initialized to the -standard output, '/dev/stdout': - - # uniq.awk --- do uniq in awk - # - # Requires getopt() and join() library functions - - function usage() - { - print("Usage: uniq [-udc [-n]] [+n] [ in [ out ]]") > "/dev/stderr" - exit 1 - } - - # -c count lines. overrides -d and -u - # -d only repeated lines - # -u only nonrepeated lines - # -n skip n fields - # +n skip n characters, skip fields first - - BEGIN { - count = 1 - outputfile = "/dev/stdout" - opts = "udc0:1:2:3:4:5:6:7:8:9:" - while ((c = getopt(ARGC, ARGV, opts)) != -1) { - if (c == "u") - non_repeated_only++ - else if (c == "d") - repeated_only++ - else if (c == "c") - do_count++ - else if (index("0123456789", c) != 0) { - # getopt() requires args to options - # this messes us up for things like -5 - if (Optarg ~ /^[[:digit:]]+$/) - fcount = (c Optarg) + 0 - else { - fcount = c + 0 - Optind-- - } - } else - usage() - } - - if (ARGV[Optind] ~ /^\+[[:digit:]]+$/) { - charcount = substr(ARGV[Optind], 2) + 0 - Optind++ - } - - for (i = 1; i < Optind; i++) - ARGV[i] = "" - - if (repeated_only == 0 && non_repeated_only == 0) - repeated_only = non_repeated_only = 1 - - if (ARGC - Optind == 2) { - outputfile = ARGV[ARGC - 1] - ARGV[ARGC - 1] = "" - } - } - - The following function, 'are_equal()', compares the current line, -'$0', to the previous line, 'last'. It handles skipping fields and -characters. If no field count and no character count are specified, -'are_equal()' returns one or zero depending upon the result of a simple -string comparison of 'last' and '$0'. - - Otherwise, things get more complicated. If fields have to be -skipped, each line is broken into an array using 'split()' (*note String -Functions::); the desired fields are then joined back into a line using -'join()'. The joined lines are stored in 'clast' and 'cline'. If no -fields are skipped, 'clast' and 'cline' are set to 'last' and '$0', -respectively. Finally, if characters are skipped, 'substr()' is used to -strip off the leading 'charcount' characters in 'clast' and 'cline'. -The two strings are then compared and 'are_equal()' returns the result: - - function are_equal( n, m, clast, cline, alast, aline) - { - if (fcount == 0 && charcount == 0) - return (last == $0) - - if (fcount > 0) { - n = split(last, alast) - m = split($0, aline) - clast = join(alast, fcount+1, n) - cline = join(aline, fcount+1, m) - } else { - clast = last - cline = $0 - } - if (charcount) { - clast = substr(clast, charcount + 1) - cline = substr(cline, charcount + 1) - } - - return (clast == cline) - } - - The following two rules are the body of the program. The first one -is executed only for the very first line of data. It sets 'last' equal -to '$0', so that subsequent lines of text have something to be compared -to. - - The second rule does the work. The variable 'equal' is one or zero, -depending upon the results of 'are_equal()''s comparison. If 'uniq' is -counting repeated lines, and the lines are equal, then it increments the -'count' variable. Otherwise, it prints the line and resets 'count', -because the two lines are not equal. - - If 'uniq' is not counting, and if the lines are equal, 'count' is -incremented. Nothing is printed, as the point is to remove duplicates. -Otherwise, if 'uniq' is counting repeated lines and more than one line -is seen, or if 'uniq' is counting nonrepeated lines and only one line is -seen, then the line is printed, and 'count' is reset. - - Finally, similar logic is used in the 'END' rule to print the final -line of input data: - - NR == 1 { - last = $0 - next - } - - { - equal = are_equal() - - if (do_count) { # overrides -d and -u - if (equal) - count++ - else { - printf("%4d %s\n", count, last) > outputfile - last = $0 - count = 1 # reset - } - next - } - - if (equal) - count++ - else { - if ((repeated_only && count > 1) || - (non_repeated_only && count == 1)) - print last > outputfile - last = $0 - count = 1 - } - } - - END { - if (do_count) - printf("%4d %s\n", count, last) > outputfile - else if ((repeated_only && count > 1) || - (non_repeated_only && count == 1)) - print last > outputfile - close(outputfile) - } - - -File: gawk.info, Node: Wc Program, Prev: Uniq Program, Up: Clones - -11.2.7 Counting Things ----------------------- - -The 'wc' (word count) utility counts lines, words, and characters in one -or more input files. Its usage is as follows: - - 'wc' ['-lwc'] [FILES ...] - - If no files are specified on the command line, 'wc' reads its -standard input. If there are multiple files, it also prints total -counts for all the files. The options and their meanings are as -follows: - -'-l' - Count only lines. - -'-w' - Count only words. A "word" is a contiguous sequence of - nonwhitespace characters, separated by spaces and/or TABs. - Luckily, this is the normal way 'awk' separates fields in its input - data. - -'-c' - Count only characters. - - Implementing 'wc' in 'awk' is particularly elegant, because 'awk' -does a lot of the work for us; it splits lines into words (i.e., fields) -and counts them, it counts lines (i.e., records), and it can easily tell -us how long a line is. - - This program uses the 'getopt()' library function (*note Getopt -Function::) and the file-transition functions (*note Filetrans -Function::). - - This version has one notable difference from traditional versions of -'wc': it always prints the counts in the order lines, words, and -characters. Traditional versions note the order of the '-l', '-w', and -'-c' options on the command line, and print the counts in that order. - - The 'BEGIN' rule does the argument processing. The variable -'print_total' is true if more than one file is named on the command -line: - - # wc.awk --- count lines, words, characters - - # Options: - # -l only count lines - # -w only count words - # -c only count characters - # - # Default is to count lines, words, characters - # - # Requires getopt() and file transition library functions - - BEGIN { - # let getopt() print a message about - # invalid options. we ignore them - while ((c = getopt(ARGC, ARGV, "lwc")) != -1) { - if (c == "l") - do_lines = 1 - else if (c == "w") - do_words = 1 - else if (c == "c") - do_chars = 1 - } - for (i = 1; i < Optind; i++) - ARGV[i] = "" - - # if no options, do all - if (! do_lines && ! do_words && ! do_chars) - do_lines = do_words = do_chars = 1 - - print_total = (ARGC - i > 1) - } - - The 'beginfile()' function is simple; it just resets the counts of -lines, words, and characters to zero, and saves the current file name in -'fname': - - function beginfile(file) - { - lines = words = chars = 0 - fname = FILENAME - } - - The 'endfile()' function adds the current file's numbers to the -running totals of lines, words, and characters. It then prints out -those numbers for the file that was just read. It relies on -'beginfile()' to reset the numbers for the following data file: - - function endfile(file) - { - tlines += lines - twords += words - tchars += chars - if (do_lines) - printf "\t%d", lines - if (do_words) - printf "\t%d", words - if (do_chars) - printf "\t%d", chars - printf "\t%s\n", fname - } - - There is one rule that is executed for each line. It adds the length -of the record, plus one, to 'chars'.(1) Adding one plus the record -length is needed because the newline character separating records (the -value of 'RS') is not part of the record itself, and thus not included -in its length. Next, 'lines' is incremented for each line read, and -'words' is incremented by the value of 'NF', which is the number of -"words" on this line: - - # do per line - { - chars += length($0) + 1 # get newline - lines++ - words += NF - } - - Finally, the 'END' rule simply prints the totals for all the files: - - END { - if (print_total) { - if (do_lines) - printf "\t%d", tlines - if (do_words) - printf "\t%d", twords - if (do_chars) - printf "\t%d", tchars - print "\ttotal" - } - } - - ---------- Footnotes ---------- - - (1) Because 'gawk' understands multibyte locales, this code counts -characters, not bytes. - - -File: gawk.info, Node: Miscellaneous Programs, Next: Programs Summary, Prev: Clones, Up: Sample Programs - -11.3 A Grab Bag of 'awk' Programs -================================= - -This minor node is a large "grab bag" of miscellaneous programs. We -hope you find them both interesting and enjoyable. - -* Menu: - -* Dupword Program:: Finding duplicated words in a document. -* Alarm Program:: An alarm clock. -* Translate Program:: A program similar to the 'tr' utility. -* Labels Program:: Printing mailing labels. -* Word Sorting:: A program to produce a word usage count. -* History Sorting:: Eliminating duplicate entries from a history - file. -* Extract Program:: Pulling out programs from Texinfo source - files. -* Simple Sed:: A Simple Stream Editor. -* Igawk Program:: A wrapper for 'awk' that includes - files. -* Anagram Program:: Finding anagrams from a dictionary. -* Signature Program:: People do amazing things with too much time on - their hands. - - -File: gawk.info, Node: Dupword Program, Next: Alarm Program, Up: Miscellaneous Programs - -11.3.1 Finding Duplicated Words in a Document ---------------------------------------------- - -A common error when writing large amounts of prose is to accidentally -duplicate words. Typically you will see this in text as something like -"the the program does the following..." When the text is online, often -the duplicated words occur at the end of one line and the beginning of -another, making them very difficult to spot. - - This program, 'dupword.awk', scans through a file one line at a time -and looks for adjacent occurrences of the same word. It also saves the -last word on a line (in the variable 'prev') for comparison with the -first word on the next line. - - The first two statements make sure that the line is all lowercase, so -that, for example, "The" and "the" compare equal to each other. The -next statement replaces nonalphanumeric and nonwhitespace characters -with spaces, so that punctuation does not affect the comparison either. -The characters are replaced with spaces so that formatting controls -don't create nonsense words (e.g., the Texinfo '@code{NF}' becomes -'codeNF' if punctuation is simply deleted). The record is then resplit -into fields, yielding just the actual words on the line, and ensuring -that there are no empty fields. - - If there are no fields left after removing all the punctuation, the -current record is skipped. Otherwise, the program loops through each -word, comparing it to the previous one: - - # dupword.awk --- find duplicate words in text - { - $0 = tolower($0) - gsub(/[^[:alnum:][:blank:]]/, " "); - $0 = $0 # re-split - if (NF == 0) - next - if ($1 == prev) - printf("%s:%d: duplicate %s\n", - FILENAME, FNR, $1) - for (i = 2; i <= NF; i++) - if ($i == $(i-1)) - printf("%s:%d: duplicate %s\n", - FILENAME, FNR, $i) - prev = $NF - } - - -File: gawk.info, Node: Alarm Program, Next: Translate Program, Prev: Dupword Program, Up: Miscellaneous Programs - -11.3.2 An Alarm Clock Program ------------------------------ - - Nothing cures insomnia like a ringing alarm clock. - -- _Arnold Robbins_ - Sleep is for web developers. - -- _Erik Quanstrom_ - - The following program is a simple "alarm clock" program. You give it -a time of day and an optional message. At the specified time, it prints -the message on the standard output. In addition, you can give it the -number of times to repeat the message as well as a delay between -repetitions. - - This program uses the 'getlocaltime()' function from *note -Getlocaltime Function::. - - All the work is done in the 'BEGIN' rule. The first part is argument -checking and setting of defaults: the delay, the count, and the message -to print. If the user supplied a message without the ASCII BEL -character (known as the "alert" character, '"\a"'), then it is added to -the message. (On many systems, printing the ASCII BEL generates an -audible alert. Thus, when the alarm goes off, the system calls -attention to itself in case the user is not looking at the computer.) -Just for a change, this program uses a 'switch' statement (*note Switch -Statement::), but the processing could be done with a series of -'if'-'else' statements instead. Here is the program: - - # alarm.awk --- set an alarm - # - # Requires getlocaltime() library function - # usage: alarm time [ "message" [ count [ delay ] ] ] - - BEGIN { - # Initial argument sanity checking - usage1 = "usage: alarm time ['message' [count [delay]]]" - usage2 = sprintf("\t(%s) time ::= hh:mm", ARGV[1]) - - if (ARGC < 2) { - print usage1 > "/dev/stderr" - print usage2 > "/dev/stderr" - exit 1 - } - switch (ARGC) { - case 5: - delay = ARGV[4] + 0 - # fall through - case 4: - count = ARGV[3] + 0 - # fall through - case 3: - message = ARGV[2] - break - default: - if (ARGV[1] !~ /[[:digit:]]?[[:digit:]]:[[:digit:]]{2}/) { - print usage1 > "/dev/stderr" - print usage2 > "/dev/stderr" - exit 1 - } - break - } - - # set defaults for once we reach the desired time - if (delay == 0) - delay = 180 # 3 minutes - if (count == 0) - count = 5 - if (message == "") - message = sprintf("\aIt is now %s!\a", ARGV[1]) - else if (index(message, "\a") == 0) - message = "\a" message "\a" - - The next minor node of code turns the alarm time into hours and -minutes, converts it (if necessary) to a 24-hour clock, and then turns -that time into a count of the seconds since midnight. Next it turns the -current time into a count of seconds since midnight. The difference -between the two is how long to wait before setting off the alarm: - - # split up alarm time - split(ARGV[1], atime, ":") - hour = atime[1] + 0 # force numeric - minute = atime[2] + 0 # force numeric - - # get current broken down time - getlocaltime(now) - - # if time given is 12-hour hours and it's after that - # hour, e.g., `alarm 5:30' at 9 a.m. means 5:30 p.m., - # then add 12 to real hour - if (hour < 12 && now["hour"] > hour) - hour += 12 - - # set target time in seconds since midnight - target = (hour * 60 * 60) + (minute * 60) - - # get current time in seconds since midnight - current = (now["hour"] * 60 * 60) + \ - (now["minute"] * 60) + now["second"] - - # how long to sleep for - naptime = target - current - if (naptime <= 0) { - print "alarm: time is in the past!" > "/dev/stderr" - exit 1 - } - - Finally, the program uses the 'system()' function (*note I/O -Functions::) to call the 'sleep' utility. The 'sleep' utility simply -pauses for the given number of seconds. If the exit status is not zero, -the program assumes that 'sleep' was interrupted and exits. If 'sleep' -exited with an OK status (zero), then the program prints the message in -a loop, again using 'sleep' to delay for however many seconds are -necessary: - - # zzzzzz..... go away if interrupted - if (system(sprintf("sleep %d", naptime)) != 0) - exit 1 - - # time to notify! - command = sprintf("sleep %d", delay) - for (i = 1; i <= count; i++) { - print message - # if sleep command interrupted, go away - if (system(command) != 0) - break - } - - exit 0 - } - - -File: gawk.info, Node: Translate Program, Next: Labels Program, Prev: Alarm Program, Up: Miscellaneous Programs - -11.3.3 Transliterating Characters ---------------------------------- - -The system 'tr' utility transliterates characters. For example, it is -often used to map uppercase letters into lowercase for further -processing: - - GENERATE DATA | tr 'A-Z' 'a-z' | PROCESS DATA ... - - 'tr' requires two lists of characters.(1) When processing the input, -the first character in the first list is replaced with the first -character in the second list, the second character in the first list is -replaced with the second character in the second list, and so on. If -there are more characters in the "from" list than in the "to" list, the -last character of the "to" list is used for the remaining characters in -the "from" list. - - Once upon a time, a user proposed adding a transliteration function -to 'gawk'. The following program was written to prove that character -transliteration could be done with a user-level function. This program -is not as complete as the system 'tr' utility, but it does most of the -job. - - The 'translate' program was written long before 'gawk' acquired the -ability to split each character in a string into separate array -elements. Thus, it makes repeated use of the 'substr()', 'index()', and -'gsub()' built-in functions (*note String Functions::). There are two -functions. The first, 'stranslate()', takes three arguments: - -'from' - A list of characters from which to translate - -'to' - A list of characters to which to translate - -'target' - The string on which to do the translation - - Associative arrays make the translation part fairly easy. 't_ar' -holds the "to" characters, indexed by the "from" characters. Then a -simple loop goes through 'from', one character at a time. For each -character in 'from', if the character appears in 'target', it is -replaced with the corresponding 'to' character. - - The 'translate()' function calls 'stranslate()', using '$0' as the -target. The main program sets two global variables, 'FROM' and 'TO', -from the command line, and then changes 'ARGV' so that 'awk' reads from -the standard input. - - Finally, the processing rule simply calls 'translate()' for each -record: - - # translate.awk --- do tr-like stuff - # Bugs: does not handle things like tr A-Z a-z; it has - # to be spelled out. However, if `to' is shorter than `from', - # the last character in `to' is used for the rest of `from'. - - function stranslate(from, to, target, lf, lt, ltarget, t_ar, i, c, - result) - { - lf = length(from) - lt = length(to) - ltarget = length(target) - for (i = 1; i <= lt; i++) - t_ar[substr(from, i, 1)] = substr(to, i, 1) - if (lt < lf) - for (; i <= lf; i++) - t_ar[substr(from, i, 1)] = substr(to, lt, 1) - for (i = 1; i <= ltarget; i++) { - c = substr(target, i, 1) - if (c in t_ar) - c = t_ar[c] - result = result c - } - return result - } - - function translate(from, to) - { - return $0 = stranslate(from, to, $0) - } - - # main program - BEGIN { - if (ARGC < 3) { - print "usage: translate from to" > "/dev/stderr" - exit - } - FROM = ARGV[1] - TO = ARGV[2] - ARGC = 2 - ARGV[1] = "-" - } - - { - translate(FROM, TO) - print - } - - It is possible to do character transliteration in a user-level -function, but it is not necessarily efficient, and we (the 'gawk' -developers) started to consider adding a built-in function. However, -shortly after writing this program, we learned that Brian Kernighan had -added the 'toupper()' and 'tolower()' functions to his 'awk' (*note -String Functions::). These functions handle the vast majority of the -cases where character transliteration is necessary, and so we chose to -simply add those functions to 'gawk' as well and then leave well enough -alone. - - An obvious improvement to this program would be to set up the 't_ar' -array only once, in a 'BEGIN' rule. However, this assumes that the -"from" and "to" lists will never change throughout the lifetime of the -program. - - Another obvious improvement is to enable the use of ranges, such as -'a-z', as allowed by the 'tr' utility. Look at the code for 'cut.awk' -(*note Cut Program::) for inspiration. - - ---------- Footnotes ---------- - - (1) On some older systems, including Solaris, the system version of -'tr' may require that the lists be written as range expressions enclosed -in square brackets ('[a-z]') and quoted, to prevent the shell from -attempting a file name expansion. This is not a feature. - - -File: gawk.info, Node: Labels Program, Next: Word Sorting, Prev: Translate Program, Up: Miscellaneous Programs - -11.3.4 Printing Mailing Labels ------------------------------- - -Here is a "real-world"(1) program. This script reads lists of names and -addresses and generates mailing labels. Each page of labels has 20 -labels on it, two across and 10 down. The addresses are guaranteed to -be no more than five lines of data. Each address is separated from the -next by a blank line. - - The basic idea is to read 20 labels' worth of data. Each line of -each label is stored in the 'line' array. The single rule takes care of -filling the 'line' array and printing the page when 20 labels have been -read. - - The 'BEGIN' rule simply sets 'RS' to the empty string, so that 'awk' -splits records at blank lines (*note Records::). It sets 'MAXLINES' to -100, because 100 is the maximum number of lines on the page (20 * 5 = -100). - - Most of the work is done in the 'printpage()' function. The label -lines are stored sequentially in the 'line' array. But they have to -print horizontally: 'line[1]' next to 'line[6]', 'line[2]' next to -'line[7]', and so on. Two loops accomplish this. The outer loop, -controlled by 'i', steps through every 10 lines of data; this is each -row of labels. The inner loop, controlled by 'j', goes through the -lines within the row. As 'j' goes from 0 to 4, 'i+j' is the 'j'th line -in the row, and 'i+j+5' is the entry next to it. The output ends up -looking something like this: - - line 1 line 6 - line 2 line 7 - line 3 line 8 - line 4 line 9 - line 5 line 10 - ... - -The 'printf' format string '%-41s' left-aligns the data and prints it -within a fixed-width field. - - As a final note, an extra blank line is printed at lines 21 and 61, -to keep the output lined up on the labels. This is dependent on the -particular brand of labels in use when the program was written. You -will also note that there are two blank lines at the top and two blank -lines at the bottom. - - The 'END' rule arranges to flush the final page of labels; there may -not have been an even multiple of 20 labels in the data: - - # labels.awk --- print mailing labels - - # Each label is 5 lines of data that may have blank lines. - # The label sheets have 2 blank lines at the top and 2 at - # the bottom. - - BEGIN { RS = "" ; MAXLINES = 100 } - - function printpage( i, j) - { - if (Nlines <= 0) - return - - printf "\n\n" # header - - for (i = 1; i <= Nlines; i += 10) { - if (i == 21 || i == 61) - print "" - for (j = 0; j < 5; j++) { - if (i + j > MAXLINES) - break - printf " %-41s %s\n", line[i+j], line[i+j+5] - } - print "" - } - - printf "\n\n" # footer - - delete line - } - - # main rule - { - if (Count >= 20) { - printpage() - Count = 0 - Nlines = 0 - } - n = split($0, a, "\n") - for (i = 1; i <= n; i++) - line[++Nlines] = a[i] - for (; i <= 5; i++) - line[++Nlines] = "" - Count++ - } - - END { - printpage() - } - - ---------- Footnotes ---------- - - (1) "Real world" is defined as "a program actually used to get -something done." - - -File: gawk.info, Node: Word Sorting, Next: History Sorting, Prev: Labels Program, Up: Miscellaneous Programs - -11.3.5 Generating Word-Usage Counts ------------------------------------ - -When working with large amounts of text, it can be interesting to know -how often different words appear. For example, an author may overuse -certain words, in which case he or she might wish to find synonyms to -substitute for words that appear too often. This node develops a -program for counting words and presenting the frequency information in a -useful format. - - At first glance, a program like this would seem to do the job: - - # wordfreq-first-try.awk --- print list of word frequencies - - { - for (i = 1; i <= NF; i++) - freq[$i]++ - } - - END { - for (word in freq) - printf "%s\t%d\n", word, freq[word] - } - - The program relies on 'awk''s default field-splitting mechanism to -break each line up into "words" and uses an associative array named -'freq', indexed by each word, to count the number of times the word -occurs. In the 'END' rule, it prints the counts. - - This program has several problems that prevent it from being useful -on real text files: - - * The 'awk' language considers upper- and lowercase characters to be - distinct. Therefore, "bartender" and "Bartender" are not treated - as the same word. This is undesirable, because words are - capitalized if they begin sentences in normal text, and a frequency - analyzer should not be sensitive to capitalization. - - * Words are detected using the 'awk' convention that fields are - separated just by whitespace. Other characters in the input - (except newlines) don't have any special meaning to 'awk'. This - means that punctuation characters count as part of words. - - * The output does not come out in any useful order. You're more - likely to be interested in which words occur most frequently or in - having an alphabetized table of how frequently each word occurs. - - The first problem can be solved by using 'tolower()' to remove case -distinctions. The second problem can be solved by using 'gsub()' to -remove punctuation characters. Finally, we solve the third problem by -using the system 'sort' utility to process the output of the 'awk' -script. Here is the new version of the program: - - # wordfreq.awk --- print list of word frequencies - - { - $0 = tolower($0) # remove case distinctions - # remove punctuation - gsub(/[^[:alnum:]_[:blank:]]/, "", $0) - for (i = 1; i <= NF; i++) - freq[$i]++ - } - - END { - for (word in freq) - printf "%s\t%d\n", word, freq[word] - } - - The regexp '/[^[:alnum:]_[:blank:]]/' might have been written -'/[[:punct:]]/', but then underscores would also be removed, and we want -to keep them. - - Assuming we have saved this program in a file named 'wordfreq.awk', -and that the data is in 'file1', the following pipeline: - - awk -f wordfreq.awk file1 | sort -k 2nr - -produces a table of the words appearing in 'file1' in order of -decreasing frequency. - - The 'awk' program suitably massages the data and produces a word -frequency table, which is not ordered. The 'awk' script's output is -then sorted by the 'sort' utility and printed on the screen. - - The options given to 'sort' specify a sort that uses the second field -of each input line (skipping one field), that the sort keys should be -treated as numeric quantities (otherwise '15' would come before '5'), -and that the sorting should be done in descending (reverse) order. - - The 'sort' could even be done from within the program, by changing -the 'END' action to: - - END { - sort = "sort -k 2nr" - for (word in freq) - printf "%s\t%d\n", word, freq[word] | sort - close(sort) - } - - This way of sorting must be used on systems that do not have true -pipes at the command-line (or batch-file) level. See the general -operating system documentation for more information on how to use the -'sort' program. - - -File: gawk.info, Node: History Sorting, Next: Extract Program, Prev: Word Sorting, Up: Miscellaneous Programs - -11.3.6 Removing Duplicates from Unsorted Text ---------------------------------------------- - -The 'uniq' program (*note Uniq Program::) removes duplicate lines from -_sorted_ data. - - Suppose, however, you need to remove duplicate lines from a data file -but that you want to preserve the order the lines are in. A good -example of this might be a shell history file. The history file keeps a -copy of all the commands you have entered, and it is not unusual to -repeat a command several times in a row. Occasionally you might want to -compact the history by removing duplicate entries. Yet it is desirable -to maintain the order of the original commands. - - This simple program does the job. It uses two arrays. The 'data' -array is indexed by the text of each line. For each line, 'data[$0]' is -incremented. If a particular line has not been seen before, then -'data[$0]' is zero. In this case, the text of the line is stored in -'lines[count]'. Each element of 'lines' is a unique command, and the -indices of 'lines' indicate the order in which those lines are -encountered. The 'END' rule simply prints out the lines, in order: - - # histsort.awk --- compact a shell history file - # Thanks to Byron Rakitzis for the general idea - - { - if (data[$0]++ == 0) - lines[++count] = $0 - } - - END { - for (i = 1; i <= count; i++) - print lines[i] - } - - This program also provides a foundation for generating other useful -information. For example, using the following 'print' statement in the -'END' rule indicates how often a particular command is used: - - print data[lines[i]], lines[i] - -This works because 'data[$0]' is incremented each time a line is seen. - - -File: gawk.info, Node: Extract Program, Next: Simple Sed, Prev: History Sorting, Up: Miscellaneous Programs - -11.3.7 Extracting Programs from Texinfo Source Files ----------------------------------------------------- - -The nodes *note Library Functions::, and *note Sample Programs::, are -the top level nodes for a large number of 'awk' programs. If you want -to experiment with these programs, it is tedious to type them in by -hand. Here we present a program that can extract parts of a Texinfo -input file into separate files. - - This Info file is written in Texinfo -(http://www.gnu.org/software/texinfo/), the GNU Project's document -formatting language. A single Texinfo source file can be used to -produce both printed documentation, with TeX, and online documentation. -(The Texinfo language is described fully, starting with *note (Texinfo, -texinfo,Texinfo---The GNU Documentation Format)Top::.) - - For our purposes, it is enough to know three things about Texinfo -input files: - - * The "at" symbol ('@') is special in Texinfo, much as the backslash - ('\') is in C or 'awk'. Literal '@' symbols are represented in - Texinfo source files as '@@'. - - * Comments start with either '@c' or '@comment'. The file-extraction - program works by using special comments that start at the beginning - of a line. - - * Lines containing '@group' and '@end group' commands bracket example - text that should not be split across a page boundary. - (Unfortunately, TeX isn't always smart enough to do things exactly - right, so we have to give it some help.) - - The following program, 'extract.awk', reads through a Texinfo source -file and does two things, based on the special comments. Upon seeing -'@c system ...', it runs a command, by extracting the command text from -the control line and passing it on to the 'system()' function (*note I/O -Functions::). Upon seeing '@c file FILENAME', each subsequent line is -sent to the file FILENAME, until '@c endfile' is encountered. The rules -in 'extract.awk' match either '@c' or '@comment' by letting the 'omment' -part be optional. Lines containing '@group' and '@end group' are simply -removed. 'extract.awk' uses the 'join()' library function (*note Join -Function::). - - The example programs in the online Texinfo source for 'GAWK: -Effective AWK Programming' ('gawktexi.in') have all been bracketed -inside 'file' and 'endfile' lines. The 'gawk' distribution uses a copy -of 'extract.awk' to extract the sample programs and install many of them -in a standard directory where 'gawk' can find them. The Texinfo file -looks something like this: - - ... - This program has a @code{BEGIN} rule - that prints a nice message: - - @example - @c file examples/messages.awk - BEGIN @{ print "Don't panic!" @} - @c endfile - @end example - - It also prints some final advice: - - @example - @c file examples/messages.awk - END @{ print "Always avoid bored archaeologists!" @} - @c endfile - @end example - ... - - 'extract.awk' begins by setting 'IGNORECASE' to one, so that mixed -upper- and lowercase letters in the directives won't matter. - - The first rule handles calling 'system()', checking that a command is -given ('NF' is at least three) and also checking that the command exits -with a zero exit status, signifying OK: - - # extract.awk --- extract files and run programs from Texinfo files - - BEGIN { IGNORECASE = 1 } - - /^@c(omment)?[ \t]+system/ { - if (NF < 3) { - e = ("extract: " FILENAME ":" FNR) - e = (e ": badly formed `system' line") - print e > "/dev/stderr" - next - } - $1 = "" - $2 = "" - stat = system($0) - if (stat != 0) { - e = ("extract: " FILENAME ":" FNR) - e = (e ": warning: system returned " stat) - print e > "/dev/stderr" - } - } - -The variable 'e' is used so that the rule fits nicely on the screen. - - The second rule handles moving data into files. It verifies that a -file name is given in the directive. If the file named is not the -current file, then the current file is closed. Keeping the current file -open until a new file is encountered allows the use of the '>' -redirection for printing the contents, keeping open-file management -simple. - - The 'for' loop does the work. It reads lines using 'getline' (*note -Getline::). For an unexpected end-of-file, it calls the -'unexpected_eof()' function. If the line is an "endfile" line, then it -breaks out of the loop. If the line is an '@group' or '@end group' -line, then it ignores it and goes on to the next line. Similarly, -comments within examples are also ignored. - - Most of the work is in the following few lines. If the line has no -'@' symbols, the program can print it directly. Otherwise, each leading -'@' must be stripped off. To remove the '@' symbols, the line is split -into separate elements of the array 'a', using the 'split()' function -(*note String Functions::). The '@' symbol is used as the separator -character. Each element of 'a' that is empty indicates two successive -'@' symbols in the original line. For each two empty elements ('@@' in -the original file), we have to add a single '@' symbol back in. - - When the processing of the array is finished, 'join()' is called with -the value of 'SUBSEP' (*note Multidimensional::), to rejoin the pieces -back into a single line. That line is then printed to the output file: - - /^@c(omment)?[ \t]+file/ { - if (NF != 3) { - e = ("extract: " FILENAME ":" FNR ": badly formed `file' line") - print e > "/dev/stderr" - next - } - if ($3 != curfile) { - if (curfile != "") - close(curfile) - curfile = $3 - } - - for (;;) { - if ((getline line) <= 0) - unexpected_eof() - if (line ~ /^@c(omment)?[ \t]+endfile/) - break - else if (line ~ /^@(end[ \t]+)?group/) - continue - else if (line ~ /^@c(omment+)?[ \t]+/) - continue - if (index(line, "@") == 0) { - print line > curfile - continue - } - n = split(line, a, "@") - # if a[1] == "", means leading @, - # don't add one back in. - for (i = 2; i <= n; i++) { - if (a[i] == "") { # was an @@ - a[i] = "@" - if (a[i+1] == "") - i++ - } - } - print join(a, 1, n, SUBSEP) > curfile - } - } - - An important thing to note is the use of the '>' redirection. Output -done with '>' only opens the file once; it stays open and subsequent -output is appended to the file (*note Redirection::). This makes it -easy to mix program text and explanatory prose for the same sample -source file (as has been done here!) without any hassle. The file is -only closed when a new data file name is encountered or at the end of -the input file. - - Finally, the function 'unexpected_eof()' prints an appropriate error -message and then exits. The 'END' rule handles the final cleanup, -closing the open file: - - function unexpected_eof() - { - printf("extract: %s:%d: unexpected EOF or error\n", - FILENAME, FNR) > "/dev/stderr" - exit 1 - } - - END { - if (curfile) - close(curfile) - } - - -File: gawk.info, Node: Simple Sed, Next: Igawk Program, Prev: Extract Program, Up: Miscellaneous Programs - -11.3.8 A Simple Stream Editor ------------------------------ - -The 'sed' utility is a "stream editor", a program that reads a stream of -data, makes changes to it, and passes it on. It is often used to make -global changes to a large file or to a stream of data generated by a -pipeline of commands. Although 'sed' is a complicated program in its -own right, its most common use is to perform global substitutions in the -middle of a pipeline: - - COMMAND1 < orig.data | sed 's/old/new/g' | COMMAND2 > result - - Here, 's/old/new/g' tells 'sed' to look for the regexp 'old' on each -input line and globally replace it with the text 'new' (i.e., all the -occurrences on a line). This is similar to 'awk''s 'gsub()' function -(*note String Functions::). - - The following program, 'awksed.awk', accepts at least two -command-line arguments: the pattern to look for and the text to replace -it with. Any additional arguments are treated as data file names to -process. If none are provided, the standard input is used: - - # awksed.awk --- do s/foo/bar/g using just print - # Thanks to Michael Brennan for the idea - - function usage() - { - print "usage: awksed pat repl [files...]" > "/dev/stderr" - exit 1 - } - - BEGIN { - # validate arguments - if (ARGC < 3) - usage() - - RS = ARGV[1] - ORS = ARGV[2] - - # don't use arguments as files - ARGV[1] = ARGV[2] = "" - } - - # look ma, no hands! - { - if (RT == "") - printf "%s", $0 - else - print - } - - The program relies on 'gawk''s ability to have 'RS' be a regexp, as -well as on the setting of 'RT' to the actual text that terminates the -record (*note Records::). - - The idea is to have 'RS' be the pattern to look for. 'gawk' -automatically sets '$0' to the text between matches of the pattern. -This is text that we want to keep, unmodified. Then, by setting 'ORS' -to the replacement text, a simple 'print' statement outputs the text we -want to keep, followed by the replacement text. - - There is one wrinkle to this scheme, which is what to do if the last -record doesn't end with text that matches 'RS'. Using a 'print' -statement unconditionally prints the replacement text, which is not -correct. However, if the file did not end in text that matches 'RS', -'RT' is set to the null string. In this case, we can print '$0' using -'printf' (*note Printf::). - - The 'BEGIN' rule handles the setup, checking for the right number of -arguments and calling 'usage()' if there is a problem. Then it sets -'RS' and 'ORS' from the command-line arguments and sets 'ARGV[1]' and -'ARGV[2]' to the null string, so that they are not treated as file names -(*note ARGC and ARGV::). - - The 'usage()' function prints an error message and exits. Finally, -the single rule handles the printing scheme outlined earlier, using -'print' or 'printf' as appropriate, depending upon the value of 'RT'. - - -File: gawk.info, Node: Igawk Program, Next: Anagram Program, Prev: Simple Sed, Up: Miscellaneous Programs - -11.3.9 An Easy Way to Use Library Functions -------------------------------------------- - -In *note Include Files::, we saw how 'gawk' provides a built-in -file-inclusion capability. However, this is a 'gawk' extension. This -minor node provides the motivation for making file inclusion available -for standard 'awk', and shows how to do it using a combination of shell -and 'awk' programming. - - Using library functions in 'awk' can be very beneficial. It -encourages code reuse and the writing of general functions. Programs -are smaller and therefore clearer. However, using library functions is -only easy when writing 'awk' programs; it is painful when running them, -requiring multiple '-f' options. If 'gawk' is unavailable, then so too -is the 'AWKPATH' environment variable and the ability to put 'awk' -functions into a library directory (*note Options::). It would be nice -to be able to write programs in the following manner: - - # library functions - @include getopt.awk - @include join.awk - ... - - # main program - BEGIN { - while ((c = getopt(ARGC, ARGV, "a:b:cde")) != -1) - ... - ... - } - - The following program, 'igawk.sh', provides this service. It -simulates 'gawk''s searching of the 'AWKPATH' variable and also allows -"nested" includes (i.e., a file that is included with '@include' can -contain further '@include' statements). 'igawk' makes an effort to only -include files once, so that nested includes don't accidentally include a -library function twice. - - 'igawk' should behave just like 'gawk' externally. This means it -should accept all of 'gawk''s command-line arguments, including the -ability to have multiple source files specified via '-f' and the ability -to mix command-line and library source files. - - The program is written using the POSIX Shell ('sh') command -language.(1) It works as follows: - - 1. Loop through the arguments, saving anything that doesn't represent - 'awk' source code for later, when the expanded program is run. - - 2. For any arguments that do represent 'awk' text, put the arguments - into a shell variable that will be expanded. There are two cases: - - a. Literal text, provided with '-e' or '--source'. This text is - just appended directly. - - b. Source file names, provided with '-f'. We use a neat trick - and append '@include FILENAME' to the shell variable's - contents. Because the file-inclusion program works the way - 'gawk' does, this gets the text of the file included in the - program at the correct point. - - 3. Run an 'awk' program (naturally) over the shell variable's contents - to expand '@include' statements. The expanded program is placed in - a second shell variable. - - 4. Run the expanded program with 'gawk' and any other original - command-line arguments that the user supplied (such as the data - file names). - - This program uses shell variables extensively: for storing -command-line arguments and the text of the 'awk' program that will -expand the user's program, for the user's original program, and for the -expanded program. Doing so removes some potential problems that might -arise were we to use temporary files instead, at the cost of making the -script somewhat more complicated. - - The initial part of the program turns on shell tracing if the first -argument is 'debug'. - - The next part loops through all the command-line arguments. There -are several cases of interest: - -'--' - This ends the arguments to 'igawk'. Anything else should be passed - on to the user's 'awk' program without being evaluated. - -'-W' - This indicates that the next option is specific to 'gawk'. To make - argument processing easier, the '-W' is appended to the front of - the remaining arguments and the loop continues. (This is an 'sh' - programming trick. Don't worry about it if you are not familiar - with 'sh'.) - -'-v', '-F' - These are saved and passed on to 'gawk'. - -'-f', '--file', '--file=', '-Wfile=' - The file name is appended to the shell variable 'program' with an - '@include' statement. The 'expr' utility is used to remove the - leading option part of the argument (e.g., '--file='). (Typical - 'sh' usage would be to use the 'echo' and 'sed' utilities to do - this work. Unfortunately, some versions of 'echo' evaluate escape - sequences in their arguments, possibly mangling the program text. - Using 'expr' avoids this problem.) - -'--source', '--source=', '-Wsource=' - The source text is appended to 'program'. - -'--version', '-Wversion' - 'igawk' prints its version number, runs 'gawk --version' to get the - 'gawk' version information, and then exits. - - If none of the '-f', '--file', '-Wfile', '--source', or '-Wsource' -arguments are supplied, then the first nonoption argument should be the -'awk' program. If there are no command-line arguments left, 'igawk' -prints an error message and exits. Otherwise, the first argument is -appended to 'program'. In any case, after the arguments have been -processed, the shell variable 'program' contains the complete text of -the original 'awk' program. - - The program is as follows: - - #! /bin/sh - # igawk --- like gawk but do @include processing - - if [ "$1" = debug ] - then - set -x - shift - fi - - # A literal newline, so that program text is formatted correctly - n=' - ' - - # Initialize variables to empty - program= - opts= - - while [ $# -ne 0 ] # loop over arguments - do - case $1 in - --) shift - break ;; - - -W) shift - # The ${x?'message here'} construct prints a - # diagnostic if $x is the null string - set -- -W"${@?'missing operand'}" - continue ;; - - -[vF]) opts="$opts $1 '${2?'missing operand'}'" - shift ;; - - -[vF]*) opts="$opts '$1'" ;; - - -f) program="$program$n@include ${2?'missing operand'}" - shift ;; - - -f*) f=$(expr "$1" : '-f\(.*\)') - program="$program$n@include $f" ;; - - -[W-]file=*) - f=$(expr "$1" : '-.file=\(.*\)') - program="$program$n@include $f" ;; - - -[W-]file) - program="$program$n@include ${2?'missing operand'}" - shift ;; - - -[W-]source=*) - t=$(expr "$1" : '-.source=\(.*\)') - program="$program$n$t" ;; - - -[W-]source) - program="$program$n${2?'missing operand'}" - shift ;; - - -[W-]version) - echo igawk: version 3.0 1>&2 - gawk --version - exit 0 ;; - - -[W-]*) opts="$opts '$1'" ;; - - *) break ;; - esac - shift - done - - if [ -z "$program" ] - then - program=${1?'missing program'} - shift - fi - - # At this point, `program' has the program. - - The 'awk' program to process '@include' directives is stored in the -shell variable 'expand_prog'. Doing this keeps the shell script -readable. The 'awk' program reads through the user's program, one line -at a time, using 'getline' (*note Getline::). The input file names and -'@include' statements are managed using a stack. As each '@include' is -encountered, the current file name is "pushed" onto the stack and the -file named in the '@include' directive becomes the current file name. -As each file is finished, the stack is "popped," and the previous input -file becomes the current input file again. The process is started by -making the original file the first one on the stack. - - The 'pathto()' function does the work of finding the full path to a -file. It simulates 'gawk''s behavior when searching the 'AWKPATH' -environment variable (*note AWKPATH Variable::). If a file name has a -'/' in it, no path search is done. Similarly, if the file name is -'"-"', then that string is used as-is. Otherwise, the file name is -concatenated with the name of each directory in the path, and an attempt -is made to open the generated file name. The only way to test if a file -can be read in 'awk' is to go ahead and try to read it with 'getline'; -this is what 'pathto()' does.(2) If the file can be read, it is closed -and the file name is returned: - - expand_prog=' - - function pathto(file, i, t, junk) - { - if (index(file, "/") != 0) - return file - - if (file == "-") - return file - - for (i = 1; i <= ndirs; i++) { - t = (pathlist[i] "/" file) - if ((getline junk < t) > 0) { - # found it - close(t) - return t - } - } - return "" - } - - The main program is contained inside one 'BEGIN' rule. The first -thing it does is set up the 'pathlist' array that 'pathto()' uses. -After splitting the path on ':', null elements are replaced with '"."', -which represents the current directory: - - BEGIN { - path = ENVIRON["AWKPATH"] - ndirs = split(path, pathlist, ":") - for (i = 1; i <= ndirs; i++) { - if (pathlist[i] == "") - pathlist[i] = "." - } - - The stack is initialized with 'ARGV[1]', which will be -'"/dev/stdin"'. The main loop comes next. Input lines are read in -succession. Lines that do not start with '@include' are printed -verbatim. If the line does start with '@include', the file name is in -'$2'. 'pathto()' is called to generate the full path. If it cannot, -then the program prints an error message and continues. - - The next thing to check is if the file is included already. The -'processed' array is indexed by the full file name of each included file -and it tracks this information for us. If the file is seen again, a -warning message is printed. Otherwise, the new file name is pushed onto -the stack and processing continues. - - Finally, when 'getline' encounters the end of the input file, the -file is closed and the stack is popped. When 'stackptr' is less than -zero, the program is done: - - stackptr = 0 - input[stackptr] = ARGV[1] # ARGV[1] is first file - - for (; stackptr >= 0; stackptr--) { - while ((getline < input[stackptr]) > 0) { - if (tolower($1) != "@include") { - print - continue - } - fpath = pathto($2) - if (fpath == "") { - printf("igawk: %s:%d: cannot find %s\n", - input[stackptr], FNR, $2) > "/dev/stderr" - continue - } - if (! (fpath in processed)) { - processed[fpath] = input[stackptr] - input[++stackptr] = fpath # push onto stack - } else - print $2, "included in", input[stackptr], - "already included in", - processed[fpath] > "/dev/stderr" - } - close(input[stackptr]) - } - }' # close quote ends `expand_prog' variable - - processed_program=$(gawk -- "$expand_prog" /dev/stdin << EOF - $program - EOF - ) - - The shell construct 'COMMAND << MARKER' is called a "here document". -Everything in the shell script up to the MARKER is fed to COMMAND as -input. The shell processes the contents of the here document for -variable and command substitution (and possibly other things as well, -depending upon the shell). - - The shell construct '$(...)' is called "command substitution". The -output of the command inside the parentheses is substituted into the -command line. Because the result is used in a variable assignment, it -is saved as a single string, even if the results contain whitespace. - - The expanded program is saved in the variable 'processed_program'. -It's done in these steps: - - 1. Run 'gawk' with the '@include'-processing program (the value of the - 'expand_prog' shell variable) reading standard input. - - 2. Standard input is the contents of the user's program, from the - shell variable 'program'. Feed its contents to 'gawk' via a here - document. - - 3. Save the results of this processing in the shell variable - 'processed_program' by using command substitution. - - The last step is to call 'gawk' with the expanded program, along with -the original options and command-line arguments that the user supplied: - - eval gawk $opts -- '"$processed_program"' '"$@"' - - The 'eval' command is a shell construct that reruns the shell's -parsing process. This keeps things properly quoted. - - This version of 'igawk' represents the fifth version of this program. -There are four key simplifications that make the program work better: - - * Using '@include' even for the files named with '-f' makes building - the initial collected 'awk' program much simpler; all the - '@include' processing can be done once. - - * Not trying to save the line read with 'getline' in the 'pathto()' - function when testing for the file's accessibility for use with the - main program simplifies things considerably. - - * Using a 'getline' loop in the 'BEGIN' rule does it all in one - place. It is not necessary to call out to a separate loop for - processing nested '@include' statements. - - * Instead of saving the expanded program in a temporary file, putting - it in a shell variable avoids some potential security problems. - This has the disadvantage that the script relies upon more features - of the 'sh' language, making it harder to follow for those who - aren't familiar with 'sh'. - - Also, this program illustrates that it is often worthwhile to combine -'sh' and 'awk' programming together. You can usually accomplish quite a -lot, without having to resort to low-level programming in C or C++, and -it is frequently easier to do certain kinds of string and argument -manipulation using the shell than it is in 'awk'. - - Finally, 'igawk' shows that it is not always necessary to add new -features to a program; they can often be layered on top.(3) - - ---------- Footnotes ---------- - - (1) Fully explaining the 'sh' language is beyond the scope of this -book. We provide some minimal explanations, but see a good shell -programming book if you wish to understand things in more depth. - - (2) On some very old versions of 'awk', the test 'getline junk < t' -can loop forever if the file exists but is empty. - - (3) 'gawk' does '@include' processing itself in order to support the -use of 'awk' programs as Web CGI scripts. - - -File: gawk.info, Node: Anagram Program, Next: Signature Program, Prev: Igawk Program, Up: Miscellaneous Programs - -11.3.10 Finding Anagrams from a Dictionary ------------------------------------------- - -An interesting programming challenge is to search for "anagrams" in a -word list (such as '/usr/share/dict/words' on many GNU/Linux systems). -One word is an anagram of another if both words contain the same letters -(e.g., "babbling" and "blabbing"). - - Column 2, Problem C, of Jon Bentley's 'Programming Pearls', Second -Edition, presents an elegant algorithm. The idea is to give words that -are anagrams a common signature, sort all the words together by their -signatures, and then print them. Dr. Bentley observes that taking the -letters in each word and sorting them produces those common signatures. - - The following program uses arrays of arrays to bring together words -with the same signature and array sorting to print the words in sorted -order: - - # anagram.awk --- An implementation of the anagram-finding algorithm - # from Jon Bentley's "Programming Pearls," 2nd edition. - # Addison Wesley, 2000, ISBN 0-201-65788-0. - # Column 2, Problem C, section 2.8, pp 18-20. - - /'s$/ { next } # Skip possessives - - The program starts with a header, and then a rule to skip possessives -in the dictionary file. The next rule builds up the data structure. -The first dimension of the array is indexed by the signature; the second -dimension is the word itself: - - { - key = word2key($1) # Build signature - data[key][$1] = $1 # Store word with signature - } - - The 'word2key()' function creates the signature. It splits the word -apart into individual letters, sorts the letters, and then joins them -back together: - - # word2key --- split word apart into letters, sort, and join back together - - function word2key(word, a, i, n, result) - { - n = split(word, a, "") - asort(a) - - for (i = 1; i <= n; i++) - result = result a[i] - - return result - } - - Finally, the 'END' rule traverses the array and prints out the -anagram lists. It sends the output to the system 'sort' command because -otherwise the anagrams would appear in arbitrary order: - - END { - sort = "sort" - for (key in data) { - # Sort words with same key - nwords = asorti(data[key], words) - if (nwords == 1) - continue - - # And print. Minor glitch: trailing space at end of each line - for (j = 1; j <= nwords; j++) - printf("%s ", words[j]) | sort - print "" | sort - } - close(sort) - } - - Here is some partial output when the program is run: - - $ gawk -f anagram.awk /usr/share/dict/words | grep '^b' - ... - babbled blabbed - babbler blabber brabble - babblers blabbers brabbles - babbling blabbing - babbly blabby - babel bable - babels beslab - babery yabber - ... - - -File: gawk.info, Node: Signature Program, Prev: Anagram Program, Up: Miscellaneous Programs - -11.3.11 And Now for Something Completely Different --------------------------------------------------- - -The following program was written by Davide Brini and is published on -his website (http://backreference.org/2011/02/03/obfuscated-awk/). It -serves as his signature in the Usenet group 'comp.lang.awk'. He -supplies the following copyright terms: - - Copyright (C) 2008 Davide Brini - - Copying and distribution of the code published in this page, with - or without modification, are permitted in any medium without - royalty provided the copyright notice and this notice are - preserved. - - Here is the program: - - awk 'BEGIN{O="~"~"~";o="=="=="==";o+=+o;x=O""O;while(X++<=x+o+o)c=c"%c"; - printf c,(x-O)*(x-O),x*(x-o)-o,x*(x-O)+x-O-o,+x*(x-O)-x+o,X*(o*o+O)+x-O, - X*(X-x)-o*o,(x+X)*o*o+o,x*(X-x)-O-O,x-O+(O+o+X+x)*(o+O),X*X-X*(x-O)-x+O, - O+X*(o*(o+O)+O),+x+O+X*o,x*(x-o),(o+X+x)*o*o-(x-O-O),O+(X-x)*(X+O),x-O}' - - We leave it to you to determine what the program does. (If you are -truly desperate to understand it, see Chris Johansen's explanation, -which is embedded in the Texinfo source file for this Info file.) - - -File: gawk.info, Node: Programs Summary, Next: Programs Exercises, Prev: Miscellaneous Programs, Up: Sample Programs - -11.4 Summary -============ - - * The programs provided in this major node continue on the theme that - reading programs is an excellent way to learn Good Programming. - - * Using '#!' to make 'awk' programs directly runnable makes them - easier to use. Otherwise, invoke the program using 'awk -f ...'. - - * Reimplementing standard POSIX programs in 'awk' is a pleasant - exercise; 'awk''s expressive power lets you write such programs in - relatively few lines of code, yet they are functionally complete - and usable. - - * One of standard 'awk''s weaknesses is working with individual - characters. The ability to use 'split()' with the empty string as - the separator can considerably simplify such tasks. - - * The examples here demonstrate the usefulness of the library - functions from *note Library Functions:: for a number of real (if - small) programs. - - * Besides reinventing POSIX wheels, other programs solved a selection - of interesting problems, such as finding duplicate words in text, - printing mailing labels, and finding anagrams. - - -File: gawk.info, Node: Programs Exercises, Prev: Programs Summary, Up: Sample Programs - -11.5 Exercises -============== - - 1. Rewrite 'cut.awk' (*note Cut Program::) using 'split()' with '""' - as the separator. - - 2. In *note Egrep Program::, we mentioned that 'egrep -i' could be - simulated in versions of 'awk' without 'IGNORECASE' by using - 'tolower()' on the line and the pattern. In a footnote there, we - also mentioned that this solution has a bug: the translated line is - output, and not the original one. Fix this problem. - - 3. The POSIX version of 'id' takes options that control which - information is printed. Modify the 'awk' version (*note Id - Program::) to accept the same arguments and perform in the same - way. - - 4. The 'split.awk' program (*note Split Program::) assumes that - letters are contiguous in the character set, which isn't true for - EBCDIC systems. Fix this problem. (Hint: Consider a different way - to work through the alphabet, without relying on 'ord()' and - 'chr()'.) - - 5. In 'uniq.awk' (*note Uniq Program::, the logic for choosing which - lines to print represents a "state machine", which is "a device - that can be in one of a set number of stable conditions depending - on its previous condition and on the present values of its - inputs."(1) Brian Kernighan suggests that "an alternative approach - to state machines is to just read the input into an array, then use - indexing. It's almost always easier code, and for most inputs - where you would use this, just as fast." Rewrite the logic to - follow this suggestion. - - 6. Why can't the 'wc.awk' program (*note Wc Program::) just use the - value of 'FNR' in 'endfile()'? Hint: Examine the code in *note - Filetrans Function::. - - 7. Manipulation of individual characters in the 'translate' program - (*note Translate Program::) is painful using standard 'awk' - functions. Given that 'gawk' can split strings into individual - characters using '""' as the separator, how might you use this - feature to simplify the program? - - 8. The 'extract.awk' program (*note Extract Program::) was written - before 'gawk' had the 'gensub()' function. Use it to simplify the - code. - - 9. Compare the performance of the 'awksed.awk' program (*note Simple - Sed::) with the more straightforward: - - BEGIN { - pat = ARGV[1] - repl = ARGV[2] - ARGV[1] = ARGV[2] = "" - } - - { gsub(pat, repl); print } - - 10. What are the advantages and disadvantages of 'awksed.awk' versus - the real 'sed' utility? - - 11. In *note Igawk Program::, we mentioned that not trying to save the - line read with 'getline' in the 'pathto()' function when testing - for the file's accessibility for use with the main program - simplifies things considerably. What problem does this engender - though? - - 12. As an additional example of the idea that it is not always - necessary to add new features to a program, consider the idea of - having two files in a directory in the search path: - - 'default.awk' - This file contains a set of default library functions, such as - 'getopt()' and 'assert()'. - - 'site.awk' - This file contains library functions that are specific to a - site or installation; i.e., locally developed functions. - Having a separate file allows 'default.awk' to change with new - 'gawk' releases, without requiring the system administrator to - update it each time by adding the local functions. - - One user suggested that 'gawk' be modified to automatically read - these files upon startup. Instead, it would be very simple to - modify 'igawk' to do this. Since 'igawk' can process nested - '@include' directives, 'default.awk' could simply contain - '@include' statements for the desired library functions. Make this - change. - - 13. Modify 'anagram.awk' (*note Anagram Program::), to avoid the use - of the external 'sort' utility. - - ---------- Footnotes ---------- - - (1) This is the definition returned from entering 'define: state -machine' into Google. - - -File: gawk.info, Node: Advanced Features, Next: Internationalization, Prev: Sample Programs, Up: Top - -12 Advanced Features of 'gawk' -****************************** - - Write documentation as if whoever reads it is a violent psychopath - who knows where you live. - -- _Steve English, as quoted by Peter Langston_ - - This major node discusses advanced features in 'gawk'. It's a bit of -a "grab bag" of items that are otherwise unrelated to each other. -First, we look at a command-line option that allows 'gawk' to recognize -nondecimal numbers in input data, not just in 'awk' programs. Then, -'gawk''s special features for sorting arrays are presented. Next, -two-way I/O, discussed briefly in earlier parts of this Info file, is -described in full detail, along with the basics of TCP/IP networking. -Finally, we see how 'gawk' can "profile" an 'awk' program, making it -possible to tune it for performance. - - Additional advanced features are discussed in separate major nodes of -their own: - - * *note Internationalization::, discusses how to internationalize - your 'awk' programs, so that they can speak multiple national - languages. - - * *note Debugger::, describes 'gawk''s built-in command-line debugger - for debugging 'awk' programs. - - * *note Arbitrary Precision Arithmetic::, describes how you can use - 'gawk' to perform arbitrary-precision arithmetic. - - * *note Dynamic Extensions::, discusses the ability to dynamically - add new built-in functions to 'gawk'. - -* Menu: - -* Nondecimal Data:: Allowing nondecimal input data. -* Array Sorting:: Facilities for controlling array traversal and - sorting arrays. -* Two-way I/O:: Two-way communications with another process. -* TCP/IP Networking:: Using 'gawk' for network programming. -* Profiling:: Profiling your 'awk' programs. -* Advanced Features Summary:: Summary of advanced features. - - -File: gawk.info, Node: Nondecimal Data, Next: Array Sorting, Up: Advanced Features - -12.1 Allowing Nondecimal Input Data -=================================== - -If you run 'gawk' with the '--non-decimal-data' option, you can have -nondecimal values in your input data: - - $ echo 0123 123 0x123 | - > gawk --non-decimal-data '{ printf "%d, %d, %d\n", $1, $2, $3 }' - -| 83, 123, 291 - - For this feature to work, write your program so that 'gawk' treats -your data as numeric: - - $ echo 0123 123 0x123 | gawk '{ print $1, $2, $3 }' - -| 0123 123 0x123 - -The 'print' statement treats its expressions as strings. Although the -fields can act as numbers when necessary, they are still strings, so -'print' does not try to treat them numerically. You need to add zero to -a field to force it to be treated as a number. For example: - - $ echo 0123 123 0x123 | gawk --non-decimal-data ' - > { print $1, $2, $3 - > print $1 + 0, $2 + 0, $3 + 0 }' - -| 0123 123 0x123 - -| 83 123 291 - - Because it is common to have decimal data with leading zeros, and -because using this facility could lead to surprising results, the -default is to leave it disabled. If you want it, you must explicitly -request it. - - CAUTION: _Use of this option is not recommended._ It can break old - programs very badly. Instead, use the 'strtonum()' function to - convert your data (*note String Functions::). This makes your - programs easier to write and easier to read, and leads to less - surprising results. - - This option may disappear in a future version of 'gawk'. - - -File: gawk.info, Node: Array Sorting, Next: Two-way I/O, Prev: Nondecimal Data, Up: Advanced Features - -12.2 Controlling Array Traversal and Array Sorting -================================================== - -'gawk' lets you control the order in which a 'for (INDX in ARRAY)' loop -traverses an array. - - In addition, two built-in functions, 'asort()' and 'asorti()', let -you sort arrays based on the array values and indices, respectively. -These two functions also provide control over the sorting criteria used -to order the elements during sorting. - -* Menu: - -* Controlling Array Traversal:: How to use PROCINFO["sorted_in"]. -* Array Sorting Functions:: How to use 'asort()' and 'asorti()'. - - -File: gawk.info, Node: Controlling Array Traversal, Next: Array Sorting Functions, Up: Array Sorting - -12.2.1 Controlling Array Traversal ----------------------------------- - -By default, the order in which a 'for (INDX in ARRAY)' loop scans an -array is not defined; it is generally based upon the internal -implementation of arrays inside 'awk'. - - Often, though, it is desirable to be able to loop over the elements -in a particular order that you, the programmer, choose. 'gawk' lets you -do this. - - *note Controlling Scanning:: describes how you can assign special, -predefined values to 'PROCINFO["sorted_in"]' in order to control the -order in which 'gawk' traverses an array during a 'for' loop. - - In addition, the value of 'PROCINFO["sorted_in"]' can be a function -name.(1) This lets you traverse an array based on any custom criterion. -The array elements are ordered according to the return value of this -function. The comparison function should be defined with at least four -arguments: - - function comp_func(i1, v1, i2, v2) - { - COMPARE ELEMENTS 1 AND 2 IN SOME FASHION - RETURN < 0; 0; OR > 0 - } - - Here, 'i1' and 'i2' are the indices, and 'v1' and 'v2' are the -corresponding values of the two elements being compared. Either 'v1' or -'v2', or both, can be arrays if the array being traversed contains -subarrays as values. (*Note Arrays of Arrays:: for more information -about subarrays.) The three possible return values are interpreted as -follows: - -'comp_func(i1, v1, i2, v2) < 0' - Index 'i1' comes before index 'i2' during loop traversal. - -'comp_func(i1, v1, i2, v2) == 0' - Indices 'i1' and 'i2' come together, but the relative order with - respect to each other is undefined. - -'comp_func(i1, v1, i2, v2) > 0' - Index 'i1' comes after index 'i2' during loop traversal. - - Our first comparison function can be used to scan an array in -numerical order of the indices: - - function cmp_num_idx(i1, v1, i2, v2) - { - # numerical index comparison, ascending order - return (i1 - i2) - } - - Our second function traverses an array based on the string order of -the element values rather than by indices: - - function cmp_str_val(i1, v1, i2, v2) - { - # string value comparison, ascending order - v1 = v1 "" - v2 = v2 "" - if (v1 < v2) - return -1 - return (v1 != v2) - } - - The third comparison function makes all numbers, and numeric strings -without any leading or trailing spaces, come out first during loop -traversal: - - function cmp_num_str_val(i1, v1, i2, v2, n1, n2) - { - # numbers before string value comparison, ascending order - n1 = v1 + 0 - n2 = v2 + 0 - if (n1 == v1) - return (n2 == v2) ? (n1 - n2) : -1 - else if (n2 == v2) - return 1 - return (v1 < v2) ? -1 : (v1 != v2) - } - - Here is a main program to demonstrate how 'gawk' behaves using each -of the previous functions: - - BEGIN { - data["one"] = 10 - data["two"] = 20 - data[10] = "one" - data[100] = 100 - data[20] = "two" - - f[1] = "cmp_num_idx" - f[2] = "cmp_str_val" - f[3] = "cmp_num_str_val" - for (i = 1; i <= 3; i++) { - printf("Sort function: %s\n", f[i]) - PROCINFO["sorted_in"] = f[i] - for (j in data) - printf("\tdata[%s] = %s\n", j, data[j]) - print "" - } - } - - Here are the results when the program is run: - - $ gawk -f compdemo.awk - -| Sort function: cmp_num_idx Sort by numeric index - -| data[two] = 20 - -| data[one] = 10 Both strings are numerically zero - -| data[10] = one - -| data[20] = two - -| data[100] = 100 - -| - -| Sort function: cmp_str_val Sort by element values as strings - -| data[one] = 10 - -| data[100] = 100 String 100 is less than string 20 - -| data[two] = 20 - -| data[10] = one - -| data[20] = two - -| - -| Sort function: cmp_num_str_val Sort all numeric values before all strings - -| data[one] = 10 - -| data[two] = 20 - -| data[100] = 100 - -| data[10] = one - -| data[20] = two - - Consider sorting the entries of a GNU/Linux system password file -according to login name. The following program sorts records by a -specific field position and can be used for this purpose: - - # passwd-sort.awk --- simple program to sort by field position - # field position is specified by the global variable POS - - function cmp_field(i1, v1, i2, v2) - { - # comparison by value, as string, and ascending order - return v1[POS] < v2[POS] ? -1 : (v1[POS] != v2[POS]) - } - - { - for (i = 1; i <= NF; i++) - a[NR][i] = $i - } - - END { - PROCINFO["sorted_in"] = "cmp_field" - if (POS < 1 || POS > NF) - POS = 1 - for (i in a) { - for (j = 1; j <= NF; j++) - printf("%s%c", a[i][j], j < NF ? ":" : "") - print "" - } - } - - The first field in each entry of the password file is the user's -login name, and the fields are separated by colons. Each record defines -a subarray, with each field as an element in the subarray. Running the -program produces the following output: - - $ gawk -v POS=1 -F: -f sort.awk /etc/passwd - -| adm:x:3:4:adm:/var/adm:/sbin/nologin - -| apache:x:48:48:Apache:/var/www:/sbin/nologin - -| avahi:x:70:70:Avahi daemon:/:/sbin/nologin - ... - - The comparison should normally always return the same value when -given a specific pair of array elements as its arguments. If -inconsistent results are returned, then the order is undefined. This -behavior can be exploited to introduce random order into otherwise -seemingly ordered data: - - function cmp_randomize(i1, v1, i2, v2) - { - # random order (caution: this may never terminate!) - return (2 - 4 * rand()) - } - - As already mentioned, the order of the indices is arbitrary if two -elements compare equal. This is usually not a problem, but letting the -tied elements come out in arbitrary order can be an issue, especially -when comparing item values. The partial ordering of the equal elements -may change the next time the array is traversed, if other elements are -added to or removed from the array. One way to resolve ties when -comparing elements with otherwise equal values is to include the indices -in the comparison rules. Note that doing this may make the loop -traversal less efficient, so consider it only if necessary. The -following comparison functions force a deterministic order, and are -based on the fact that the (string) indices of two elements are never -equal: - - function cmp_numeric(i1, v1, i2, v2) - { - # numerical value (and index) comparison, descending order - return (v1 != v2) ? (v2 - v1) : (i2 - i1) - } - - function cmp_string(i1, v1, i2, v2) - { - # string value (and index) comparison, descending order - v1 = v1 i1 - v2 = v2 i2 - return (v1 > v2) ? -1 : (v1 != v2) - } - - A custom comparison function can often simplify ordered loop -traversal, and the sky is really the limit when it comes to designing -such a function. - - When string comparisons are made during a sort, either for element -values where one or both aren't numbers, or for element indices handled -as strings, the value of 'IGNORECASE' (*note Built-in Variables::) -controls whether the comparisons treat corresponding upper- and -lowercase letters as equivalent or distinct. - - Another point to keep in mind is that in the case of subarrays, the -element values can themselves be arrays; a production comparison -function should use the 'isarray()' function (*note Type Functions::) to -check for this, and choose a defined sorting order for subarrays. - - All sorting based on 'PROCINFO["sorted_in"]' is disabled in POSIX -mode, because the 'PROCINFO' array is not special in that case. - - As a side note, sorting the array indices before traversing the array -has been reported to add a 15% to 20% overhead to the execution time of -'awk' programs. For this reason, sorted array traversal is not the -default. - - ---------- Footnotes ---------- - - (1) This is why the predefined sorting orders start with an '@' -character, which cannot be part of an identifier. - - -File: gawk.info, Node: Array Sorting Functions, Prev: Controlling Array Traversal, Up: Array Sorting - -12.2.2 Sorting Array Values and Indices with 'gawk' ---------------------------------------------------- - -In most 'awk' implementations, sorting an array requires writing a -'sort()' function. This can be educational for exploring different -sorting algorithms, but usually that's not the point of the program. -'gawk' provides the built-in 'asort()' and 'asorti()' functions (*note -String Functions::) for sorting arrays. For example: - - POPULATE THE ARRAY data - n = asort(data) - for (i = 1; i <= n; i++) - DO SOMETHING WITH data[i] - - After the call to 'asort()', the array 'data' is indexed from 1 to -some number N, the total number of elements in 'data'. (This count is -'asort()''s return value.) 'data[1]' <= 'data[2]' <= 'data[3]', and so -on. The default comparison is based on the type of the elements (*note -Typing and Comparison::). All numeric values come before all string -values, which in turn come before all subarrays. - - An important side effect of calling 'asort()' is that _the array's -original indices are irrevocably lost_. As this isn't always desirable, -'asort()' accepts a second argument: - - POPULATE THE ARRAY source - n = asort(source, dest) - for (i = 1; i <= n; i++) - DO SOMETHING WITH dest[i] - - In this case, 'gawk' copies the 'source' array into the 'dest' array -and then sorts 'dest', destroying its indices. However, the 'source' -array is not affected. - - Often, what's needed is to sort on the values of the _indices_ -instead of the values of the elements. To do that, use the 'asorti()' -function. The interface and behavior are identical to that of -'asort()', except that the index values are used for sorting and become -the values of the result array: - - { source[$0] = some_func($0) } - - END { - n = asorti(source, dest) - for (i = 1; i <= n; i++) { - Work with sorted indices directly: - DO SOMETHING WITH dest[i] - ... - Access original array via sorted indices: - DO SOMETHING WITH source[dest[i]] - } - } - - So far, so good. Now it starts to get interesting. Both 'asort()' -and 'asorti()' accept a third string argument to control comparison of -array elements. When we introduced 'asort()' and 'asorti()' in *note -String Functions::, we ignored this third argument; however, now is the -time to describe how this argument affects these two functions. - - Basically, the third argument specifies how the array is to be -sorted. There are two possibilities. As with 'PROCINFO["sorted_in"]', -this argument may be one of the predefined names that 'gawk' provides -(*note Controlling Scanning::), or it may be the name of a user-defined -function (*note Controlling Array Traversal::). - - In the latter case, _the function can compare elements in any way it -chooses_, taking into account just the indices, just the values, or -both. This is extremely powerful. - - Once the array is sorted, 'asort()' takes the _values_ in their final -order and uses them to fill in the result array, whereas 'asorti()' -takes the _indices_ in their final order and uses them to fill in the -result array. - - NOTE: Copying array indices and elements isn't expensive in terms - of memory. Internally, 'gawk' maintains "reference counts" to - data. For example, when 'asort()' copies the first array to the - second one, there is only one copy of the original array elements' - data, even though both arrays use the values. - - Because 'IGNORECASE' affects string comparisons, the value of -'IGNORECASE' also affects sorting for both 'asort()' and 'asorti()'. -Note also that the locale's sorting order does _not_ come into play; -comparisons are based on character values only.(1) - - The following example demonstrates the use of a comparison function -with 'asort()'. The comparison function, 'case_fold_compare()', maps -both values to lowercase in order to compare them ignoring case. - - # case_fold_compare --- compare as strings, ignoring case - - function case_fold_compare(i1, v1, i2, v2, l, r) - { - l = tolower(v1) - r = tolower(v2) - - if (l < r) - return -1 - else if (l == r) - return 0 - else - return 1 - } - - And here is the test program for it: - - # Test program - - BEGIN { - Letters = "abcdefghijklmnopqrstuvwxyz" \ - "ABCDEFGHIJKLMNOPQRSTUVWXYZ" - split(Letters, data, "") - - asort(data, result, "case_fold_compare") - - j = length(result) - for (i = 1; i <= j; i++) { - printf("%s", result[i]) - if (i % (j/2) == 0) - printf("\n") - else - printf(" ") - } - } - - When run, we get the following: - - $ gawk -f case_fold_compare.awk - -| A a B b c C D d e E F f g G H h i I J j k K l L M m - -| n N O o p P Q q r R S s t T u U V v w W X x y Y z Z - - ---------- Footnotes ---------- - - (1) This is true because locale-based comparison occurs only when in -POSIX-compatibility mode, and because 'asort()' and 'asorti()' are -'gawk' extensions, they are not available in that case. - - -File: gawk.info, Node: Two-way I/O, Next: TCP/IP Networking, Prev: Array Sorting, Up: Advanced Features - -12.3 Two-Way Communications with Another Process -================================================ - -It is often useful to be able to send data to a separate program for -processing and then read the result. This can always be done with -temporary files: - - # Write the data for processing - tempfile = ("mydata." PROCINFO["pid"]) - while (NOT DONE WITH DATA) - print DATA | ("subprogram > " tempfile) - close("subprogram > " tempfile) - - # Read the results, remove tempfile when done - while ((getline newdata < tempfile) > 0) - PROCESS newdata APPROPRIATELY - close(tempfile) - system("rm " tempfile) - -This works, but not elegantly. Among other things, it requires that the -program be run in a directory that cannot be shared among users; for -example, '/tmp' will not do, as another user might happen to be using a -temporary file with the same name.(1) - - However, with 'gawk', it is possible to open a _two-way_ pipe to -another process. The second process is termed a "coprocess", as it runs -in parallel with 'gawk'. The two-way connection is created using the -'|&' operator (borrowed from the Korn shell, 'ksh'):(2) - - do { - print DATA |& "subprogram" - "subprogram" |& getline results - } while (DATA LEFT TO PROCESS) - close("subprogram") - - The first time an I/O operation is executed using the '|&' operator, -'gawk' creates a two-way pipeline to a child process that runs the other -program. Output created with 'print' or 'printf' is written to the -program's standard input, and output from the program's standard output -can be read by the 'gawk' program using 'getline'. As is the case with -processes started by '|', the subprogram can be any program, or pipeline -of programs, that can be started by the shell. - - There are some cautionary items to be aware of: - - * As the code inside 'gawk' currently stands, the coprocess's - standard error goes to the same place that the parent 'gawk''s - standard error goes. It is not possible to read the child's - standard error separately. - - * I/O buffering may be a problem. 'gawk' automatically flushes all - output down the pipe to the coprocess. However, if the coprocess - does not flush its output, 'gawk' may hang when doing a 'getline' - in order to read the coprocess's results. This could lead to a - situation known as "deadlock", where each process is waiting for - the other one to do something. - - It is possible to close just one end of the two-way pipe to a -coprocess, by supplying a second argument to the 'close()' function of -either '"to"' or '"from"' (*note Close Files And Pipes::). These -strings tell 'gawk' to close the end of the pipe that sends data to the -coprocess or the end that reads from it, respectively. - - This is particularly necessary in order to use the system 'sort' -utility as part of a coprocess; 'sort' must read _all_ of its input data -before it can produce any output. The 'sort' program does not receive -an end-of-file indication until 'gawk' closes the write end of the pipe. - - When you have finished writing data to the 'sort' utility, you can -close the '"to"' end of the pipe, and then start reading sorted data via -'getline'. For example: - - BEGIN { - command = "LC_ALL=C sort" - n = split("abcdefghijklmnopqrstuvwxyz", a, "") - - for (i = n; i > 0; i--) - print a[i] |& command - close(command, "to") - - while ((command |& getline line) > 0) - print "got", line - close(command) - } - - This program writes the letters of the alphabet in reverse order, one -per line, down the two-way pipe to 'sort'. It then closes the write end -of the pipe, so that 'sort' receives an end-of-file indication. This -causes 'sort' to sort the data and write the sorted data back to the -'gawk' program. Once all of the data has been read, 'gawk' terminates -the coprocess and exits. - - As a side note, the assignment 'LC_ALL=C' in the 'sort' command -ensures traditional Unix (ASCII) sorting from 'sort'. This is not -strictly necessary here, but it's good to know how to do this. - - Be careful when closing the '"from"' end of a two-way pipe; in this -case 'gawk' waits for the child process to exit, which may cause your -program to hang. (Thus, this particular feature is of much less use in -practice than being able to close the '"to"' end.) - - CAUTION: Normally, it is a fatal error to write to the '"to"' end - of a two-way pipe which has been closed, and it is also a fatal - error to read from the '"from"' end of a two-way pipe that has been - closed. - - You may set 'PROCINFO["COMMAND", "NONFATAL"]' to make such - operations become nonfatal, in which case you then need to check - 'ERRNO' after each 'print', 'printf', or 'getline'. *Note - Nonfatal::, for more information. - - You may also use pseudo-ttys (ptys) for two-way communication instead -of pipes, if your system supports them. This is done on a per-command -basis, by setting a special element in the 'PROCINFO' array (*note -Auto-set::), like so: - - command = "sort -nr" # command, save in convenience variable - PROCINFO[command, "pty"] = 1 # update PROCINFO - print ... |& command # start two-way pipe - ... - -If your system does not have ptys, or if all the system's ptys are in -use, 'gawk' automatically falls back to using regular pipes. - - Using ptys usually avoids the buffer deadlock issues described -earlier, at some loss in performance. This is because the tty driver -buffers and sends data line-by-line. On systems with the 'stdbuf' (part -of the GNU Coreutils package -(http://www.gnu.org/software/coreutils/coreutils.html)), you can use -that program instead of ptys. - - Note also that ptys are not fully transparent. Certain binary -control codes, such 'Ctrl-d' for end-of-file, are interpreted by the tty -driver and not passed through. - - CAUTION: Finally, coprocesses open up the possibility of "deadlock" - between 'gawk' and the program running in the coprocess. This can - occur if you send "too much" data to the coprocess before reading - any back; each process is blocked writing data with noone available - to read what they've already written. There is no workaround for - deadlock; careful programming and knowledge of the behavior of the - coprocess are required. - - ---------- Footnotes ---------- - - (1) Michael Brennan suggests the use of 'rand()' to generate unique -file names. This is a valid point; nevertheless, temporary files remain -more difficult to use than two-way pipes. - - (2) This is very different from the same operator in the C shell and -in Bash. - - -File: gawk.info, Node: TCP/IP Networking, Next: Profiling, Prev: Two-way I/O, Up: Advanced Features - -12.4 Using 'gawk' for Network Programming -========================================= - - 'EMRED': - A host is a host from coast to coast, - and nobody talks to a host that's close, - unless the host that isn't close - is busy, hung, or dead. - -- _Mike O'Brien (aka Mr. Protocol)_ - - In addition to being able to open a two-way pipeline to a coprocess -on the same system (*note Two-way I/O::), it is possible to make a -two-way connection to another process on another system across an IP -network connection. - - You can think of this as just a _very long_ two-way pipeline to a -coprocess. The way 'gawk' decides that you want to use TCP/IP -networking is by recognizing special file names that begin with one of -'/inet/', '/inet4/', or '/inet6/'. - - The full syntax of the special file name is -'/NET-TYPE/PROTOCOL/LOCAL-PORT/REMOTE-HOST/REMOTE-PORT'. The components -are: - -NET-TYPE - Specifies the kind of Internet connection to make. Use '/inet4/' - to force IPv4, and '/inet6/' to force IPv6. Plain '/inet/' (which - used to be the only option) uses the system default, most likely - IPv4. - -PROTOCOL - The protocol to use over IP. This must be either 'tcp', or 'udp', - for a TCP or UDP IP connection, respectively. TCP should be used - for most applications. - -LOCAL-PORT - The local TCP or UDP port number to use. Use a port number of '0' - when you want the system to pick a port. This is what you should - do when writing a TCP or UDP client. You may also use a well-known - service name, such as 'smtp' or 'http', in which case 'gawk' - attempts to determine the predefined port number using the C - 'getaddrinfo()' function. - -REMOTE-HOST - The IP address or fully qualified domain name of the Internet host - to which you want to connect. - -REMOTE-PORT - The TCP or UDP port number to use on the given REMOTE-HOST. Again, - use '0' if you don't care, or else a well-known service name. - - NOTE: Failure in opening a two-way socket will result in a nonfatal - error being returned to the calling code. The value of 'ERRNO' - indicates the error (*note Auto-set::). - - Consider the following very simple example: - - BEGIN { - Service = "/inet/tcp/0/localhost/daytime" - Service |& getline - print $0 - close(Service) - } - - This program reads the current date and time from the local system's -TCP 'daytime' server. It then prints the results and closes the -connection. - - Because this topic is extensive, the use of 'gawk' for TCP/IP -programming is documented separately. See *note (General Introduction, -gawkinet, TCP/IP Internetworking with 'gawk')Top::, for a much more -complete introduction and discussion, as well as extensive examples. - - NOTE: 'gawk' can only open direct sockets. There is currently no - way to access services available over Secure Socket Layer (SSL); - this includes any web service whose URL starts with 'https://'. - - -File: gawk.info, Node: Profiling, Next: Advanced Features Summary, Prev: TCP/IP Networking, Up: Advanced Features - -12.5 Profiling Your 'awk' Programs -================================== - -You may produce execution traces of your 'awk' programs. This is done -by passing the option '--profile' to 'gawk'. When 'gawk' has finished -running, it creates a profile of your program in a file named -'awkprof.out'. Because it is profiling, it also executes up to 45% -slower than 'gawk' normally does. - - As shown in the following example, the '--profile' option can be used -to change the name of the file where 'gawk' will write the profile: - - gawk --profile=myprog.prof -f myprog.awk data1 data2 - -In the preceding example, 'gawk' places the profile in 'myprog.prof' -instead of in 'awkprof.out'. - - Here is a sample session showing a simple 'awk' program, its input -data, and the results from running 'gawk' with the '--profile' option. -First, the 'awk' program: - - BEGIN { print "First BEGIN rule" } - - END { print "First END rule" } - - /foo/ { - print "matched /foo/, gosh" - for (i = 1; i <= 3; i++) - sing() - } - - { - if (/foo/) - print "if is true" - else - print "else is true" - } - - BEGIN { print "Second BEGIN rule" } - - END { print "Second END rule" } - - function sing( dummy) - { - print "I gotta be me!" - } - - Following is the input data: - - foo - bar - baz - foo - junk - - Here is the 'awkprof.out' that results from running the 'gawk' -profiler on this program and data (this example also illustrates that -'awk' programmers sometimes get up very early in the morning to work): - - # gawk profile, created Mon Sep 29 05:16:21 2014 - - # BEGIN rule(s) - - BEGIN { - 1 print "First BEGIN rule" - } - - BEGIN { - 1 print "Second BEGIN rule" - } - - # Rule(s) - - 5 /foo/ { # 2 - 2 print "matched /foo/, gosh" - 6 for (i = 1; i <= 3; i++) { - 6 sing() - } - } - - 5 { - 5 if (/foo/) { # 2 - 2 print "if is true" - 3 } else { - 3 print "else is true" - } - } - - # END rule(s) - - END { - 1 print "First END rule" - } - - END { - 1 print "Second END rule" - } - - - # Functions, listed alphabetically - - 6 function sing(dummy) - { - 6 print "I gotta be me!" - } - - This example illustrates many of the basic features of profiling -output. They are as follows: - - * The program is printed in the order 'BEGIN' rules, 'BEGINFILE' - rules, pattern-action rules, 'ENDFILE' rules, 'END' rules, and - functions, listed alphabetically. Multiple 'BEGIN' and 'END' rules - retain their separate identities, as do multiple 'BEGINFILE' and - 'ENDFILE' rules. - - * Pattern-action rules have two counts. The first count, to the left - of the rule, shows how many times the rule's pattern was _tested_. - The second count, to the right of the rule's opening left brace in - a comment, shows how many times the rule's action was _executed_. - The difference between the two indicates how many times the rule's - pattern evaluated to false. - - * Similarly, the count for an 'if'-'else' statement shows how many - times the condition was tested. To the right of the opening left - brace for the 'if''s body is a count showing how many times the - condition was true. The count for the 'else' indicates how many - times the test failed. - - * The count for a loop header (such as 'for' or 'while') shows how - many times the loop test was executed. (Because of this, you can't - just look at the count on the first statement in a rule to - determine how many times the rule was executed. If the first - statement is a loop, the count is misleading.) - - * For user-defined functions, the count next to the 'function' - keyword indicates how many times the function was called. The - counts next to the statements in the body show how many times those - statements were executed. - - * The layout uses "K&R" style with TABs. Braces are used everywhere, - even when the body of an 'if', 'else', or loop is only a single - statement. - - * Parentheses are used only where needed, as indicated by the - structure of the program and the precedence rules. For example, - '(3 + 5) * 4' means add three and five, then multiply the total by - four. However, '3 + 5 * 4' has no parentheses, and means '3 + (5 * - 4)'. - - * Parentheses are used around the arguments to 'print' and 'printf' - only when the 'print' or 'printf' statement is followed by a - redirection. Similarly, if the target of a redirection isn't a - scalar, it gets parenthesized. - - * 'gawk' supplies leading comments in front of the 'BEGIN' and 'END' - rules, the 'BEGINFILE' and 'ENDFILE' rules, the pattern-action - rules, and the functions. - - The profiled version of your program may not look exactly like what -you typed when you wrote it. This is because 'gawk' creates the -profiled version by "pretty-printing" its internal representation of the -program. The advantage to this is that 'gawk' can produce a standard -representation. Also, things such as: - - /foo/ - -come out as: - - /foo/ { - print $0 - } - -which is correct, but possibly unexpected. - - Besides creating profiles when a program has completed, 'gawk' can -produce a profile while it is running. This is useful if your 'awk' -program goes into an infinite loop and you want to see what has been -executed. To use this feature, run 'gawk' with the '--profile' option -in the background: - - $ gawk --profile -f myprog & - [1] 13992 - -The shell prints a job number and process ID number; in this case, -13992. Use the 'kill' command to send the 'USR1' signal to 'gawk': - - $ kill -USR1 13992 - -As usual, the profiled version of the program is written to -'awkprof.out', or to a different file if one was specified with the -'--profile' option. - - Along with the regular profile, as shown earlier, the profile file -includes a trace of any active functions: - - # Function Call Stack: - - # 3. baz - # 2. bar - # 1. foo - # -- main -- - - You may send 'gawk' the 'USR1' signal as many times as you like. -Each time, the profile and function call trace are appended to the -output profile file. - - If you use the 'HUP' signal instead of the 'USR1' signal, 'gawk' -produces the profile and the function call trace and then exits. - - When 'gawk' runs on MS-Windows systems, it uses the 'INT' and 'QUIT' -signals for producing the profile, and in the case of the 'INT' signal, -'gawk' exits. This is because these systems don't support the 'kill' -command, so the only signals you can deliver to a program are those -generated by the keyboard. The 'INT' signal is generated by the -'Ctrl-c' or 'Ctrl-BREAK' key, while the 'QUIT' signal is generated by -the 'Ctrl-\' key. - - Finally, 'gawk' also accepts another option, '--pretty-print'. When -called this way, 'gawk' "pretty-prints" the program into 'awkprof.out', -without any execution counts. - - NOTE: Once upon a time, the '--pretty-print' option would also run - your program. This is is no longer the case. - - There is a significant difference between the output created when -profiling, and that created when pretty-printing. Pretty-printed output -preserves the original comments that were in the program, although their -placement may not correspond exactly to their original locations in the -source code.(1) - - However, as a deliberate design decision, profiling output _omits_ -the original program's comments. This allows you to focus on the -execution count data and helps you avoid the temptation to use the -profiler for pretty-printing. - - Additionally, pretty-printed output does not have the leading -indentation that the profiling output does. This makes it easy to -pretty-print your code once development is completed, and then use the -result as the final version of your program. - - Because the internal representation of your program is formatted to -recreate an 'awk' program, profiling and pretty-printing automatically -disable 'gawk''s default optimizations. - - ---------- Footnotes ---------- - - (1) 'gawk' does the best it can to preserve the distinction between -comments at the end of a statement and comments on lines by themselves. -Due to implementation constraints, it does not always do so correctly, -particularly for 'switch' statements. The 'gawk' maintainers hope to -improve this in a subsequent release. - - -File: gawk.info, Node: Advanced Features Summary, Prev: Profiling, Up: Advanced Features - -12.6 Summary -============ - - * The '--non-decimal-data' option causes 'gawk' to treat octal- and - hexadecimal-looking input data as octal and hexadecimal. This - option should be used with caution or not at all; use of - 'strtonum()' is preferable. Note that this option may disappear in - a future version of 'gawk'. - - * You can take over complete control of sorting in 'for (INDX in - ARRAY)' array traversal by setting 'PROCINFO["sorted_in"]' to the - name of a user-defined function that does the comparison of array - elements based on index and value. - - * Similarly, you can supply the name of a user-defined comparison - function as the third argument to either 'asort()' or 'asorti()' to - control how those functions sort arrays. Or you may provide one of - the predefined control strings that work for - 'PROCINFO["sorted_in"]'. - - * You can use the '|&' operator to create a two-way pipe to a - coprocess. You read from the coprocess with 'getline' and write to - it with 'print' or 'printf'. Use 'close()' to close off the - coprocess completely, or optionally, close off one side of the - two-way communications. - - * By using special file names with the '|&' operator, you can open a - TCP/IP (or UDP/IP) connection to remote hosts on the Internet. - 'gawk' supports both IPv4 and IPv6. - - * You can generate statement count profiles of your program. This - can help you determine which parts of your program may be taking - the most time and let you tune them more easily. Sending the - 'USR1' signal while profiling causes 'gawk' to dump the profile and - keep going, including a function call stack. - - * You can also just "pretty-print" the program. - - -File: gawk.info, Node: Internationalization, Next: Debugger, Prev: Advanced Features, Up: Top - -13 Internationalization with 'gawk' -*********************************** - -Once upon a time, computer makers wrote software that worked only in -English. Eventually, hardware and software vendors noticed that if -their systems worked in the native languages of non-English-speaking -countries, they were able to sell more systems. As a result, -internationalization and localization of programs and software systems -became a common practice. - - For many years, the ability to provide internationalization was -largely restricted to programs written in C and C++. This major node -describes the underlying library 'gawk' uses for internationalization, -as well as how 'gawk' makes internationalization features available at -the 'awk' program level. Having internationalization available at the -'awk' level gives software developers additional flexibility--they are -no longer forced to write in C or C++ when internationalization is a -requirement. - -* Menu: - -* I18N and L10N:: Internationalization and Localization. -* Explaining gettext:: How GNU 'gettext' works. -* Programmer i18n:: Features for the programmer. -* Translator i18n:: Features for the translator. -* I18N Example:: A simple i18n example. -* Gawk I18N:: 'gawk' is also internationalized. -* I18N Summary:: Summary of I18N stuff. - - -File: gawk.info, Node: I18N and L10N, Next: Explaining gettext, Up: Internationalization - -13.1 Internationalization and Localization -========================================== - -"Internationalization" means writing (or modifying) a program once, in -such a way that it can use multiple languages without requiring further -source code changes. "Localization" means providing the data necessary -for an internationalized program to work in a particular language. Most -typically, these terms refer to features such as the language used for -printing error messages, the language used to read responses, and -information related to how numerical and monetary values are printed and -read. - - -File: gawk.info, Node: Explaining gettext, Next: Programmer i18n, Prev: I18N and L10N, Up: Internationalization - -13.2 GNU 'gettext' -================== - -'gawk' uses GNU 'gettext' to provide its internationalization features. -The facilities in GNU 'gettext' focus on messages: strings printed by a -program, either directly or via formatting with 'printf' or -'sprintf()'.(1) - - When using GNU 'gettext', each application has its own "text domain". -This is a unique name, such as 'kpilot' or 'gawk', that identifies the -application. A complete application may have multiple -components--programs written in C or C++, as well as scripts written in -'sh' or 'awk'. All of the components use the same text domain. - - To make the discussion concrete, assume we're writing an application -named 'guide'. Internationalization consists of the following steps, in -this order: - - 1. The programmer reviews the source for all of 'guide''s components - and marks each string that is a candidate for translation. For - example, '"`-F': option required"' is a good candidate for - translation. A table with strings of option names is not (e.g., - 'gawk''s '--profile' option should remain the same, no matter what - the local language). - - 2. The programmer indicates the application's text domain ('"guide"') - to the 'gettext' library, by calling the 'textdomain()' function. - - 3. Messages from the application are extracted from the source code - and collected into a portable object template file ('guide.pot'), - which lists the strings and their translations. The translations - are initially empty. The original (usually English) messages serve - as the key for lookup of the translations. - - 4. For each language with a translator, 'guide.pot' is copied to a - portable object file ('.po') and translations are created and - shipped with the application. For example, there might be a - 'fr.po' for a French translation. - - 5. Each language's '.po' file is converted into a binary message - object ('.gmo') file. A message object file contains the original - messages and their translations in a binary format that allows fast - lookup of translations at runtime. - - 6. When 'guide' is built and installed, the binary translation files - are installed in a standard place. - - 7. For testing and development, it is possible to tell 'gettext' to - use '.gmo' files in a different directory than the standard one by - using the 'bindtextdomain()' function. - - 8. At runtime, 'guide' looks up each string via a call to 'gettext()'. - The returned string is the translated string if available, or the - original string if not. - - 9. If necessary, it is possible to access messages from a different - text domain than the one belonging to the application, without - having to switch the application's default text domain back and - forth. - - In C (or C++), the string marking and dynamic translation lookup are -accomplished by wrapping each string in a call to 'gettext()': - - printf("%s", gettext("Don't Panic!\n")); - - The tools that extract messages from source code pull out all strings -enclosed in calls to 'gettext()'. - - The GNU 'gettext' developers, recognizing that typing 'gettext(...)' -over and over again is both painful and ugly to look at, use the macro -'_' (an underscore) to make things easier: - - /* In the standard header file: */ - #define _(str) gettext(str) - - /* In the program text: */ - printf("%s", _("Don't Panic!\n")); - -This reduces the typing overhead to just three extra characters per -string and is considerably easier to read as well. - - There are locale "categories" for different types of locale-related -information. The defined locale categories that 'gettext' knows about -are: - -'LC_MESSAGES' - Text messages. This is the default category for 'gettext' - operations, but it is possible to supply a different one - explicitly, if necessary. (It is almost never necessary to supply - a different category.) - -'LC_COLLATE' - Text-collation information (i.e., how different characters and/or - groups of characters sort in a given language). - -'LC_CTYPE' - Character-type information (alphabetic, digit, upper- or lowercase, - and so on) as well as character encoding. This information is - accessed via the POSIX character classes in regular expressions, - such as '/[[:alnum:]]/' (*note Bracket Expressions::). - -'LC_MONETARY' - Monetary information, such as the currency symbol, and whether the - symbol goes before or after a number. - -'LC_NUMERIC' - Numeric information, such as which characters to use for the - decimal point and the thousands separator.(2) - -'LC_TIME' - Time- and date-related information, such as 12- or 24-hour clock, - month printed before or after the day in a date, local month - abbreviations, and so on. - -'LC_ALL' - All of the above. (Not too useful in the context of 'gettext'.) - - NOTE: As described in *note Locales::, environment variables with - the same name as the locale categories ('LC_CTYPE', 'LC_ALL', etc.) - influence 'gawk''s behavior (and that of other utilities). - - Normally, these variables also affect how the 'gettext' library - finds translations. However, the 'LANGUAGE' environment variable - overrides the 'LC_XXX' variables. Many GNU/Linux systems may - define this variable without your knowledge, causing 'gawk' to not - find the correct translations. If this happens to you, look to see - if 'LANGUAGE' is defined, and if so, use the shell's 'unset' - command to remove it. - - For testing translations of 'gawk' itself, you can set the -'GAWK_LOCALE_DIR' environment variable. See the documentation for the C -'bindtextdomain()' function and also see *note Other Environment -Variables::. - - ---------- Footnotes ---------- - - (1) For some operating systems, the 'gawk' port doesn't support GNU -'gettext'. Therefore, these features are not available if you are using -one of those operating systems. Sorry. - - (2) Americans use a comma every three decimal places and a period for -the decimal point, while many Europeans do exactly the opposite: -1,234.56 versus 1.234,56. - - -File: gawk.info, Node: Programmer i18n, Next: Translator i18n, Prev: Explaining gettext, Up: Internationalization - -13.3 Internationalizing 'awk' Programs -====================================== - -'gawk' provides the following variables for internationalization: - -'TEXTDOMAIN' - This variable indicates the application's text domain. For - compatibility with GNU 'gettext', the default value is - '"messages"'. - -'_"your message here"' - String constants marked with a leading underscore are candidates - for translation at runtime. String constants without a leading - underscore are not translated. - - 'gawk' provides the following functions for internationalization: - -'dcgettext(STRING [, DOMAIN [, CATEGORY]])' - Return the translation of STRING in text domain DOMAIN for locale - category CATEGORY. The default value for DOMAIN is the current - value of 'TEXTDOMAIN'. The default value for CATEGORY is - '"LC_MESSAGES"'. - - If you supply a value for CATEGORY, it must be a string equal to - one of the known locale categories described in *note Explaining - gettext::. You must also supply a text domain. Use 'TEXTDOMAIN' - if you want to use the current domain. - - CAUTION: The order of arguments to the 'awk' version of the - 'dcgettext()' function is purposely different from the order - for the C version. The 'awk' version's order was chosen to be - simple and to allow for reasonable 'awk'-style default - arguments. - -'dcngettext(STRING1, STRING2, NUMBER [, DOMAIN [, CATEGORY]])' - Return the plural form used for NUMBER of the translation of - STRING1 and STRING2 in text domain DOMAIN for locale category - CATEGORY. STRING1 is the English singular variant of a message, - and STRING2 is the English plural variant of the same message. The - default value for DOMAIN is the current value of 'TEXTDOMAIN'. The - default value for CATEGORY is '"LC_MESSAGES"'. - - The same remarks about argument order as for the 'dcgettext()' - function apply. - -'bindtextdomain(DIRECTORY [, DOMAIN ])' - Change the directory in which 'gettext' looks for '.gmo' files, in - case they will not or cannot be placed in the standard locations - (e.g., during testing). Return the directory in which DOMAIN is - "bound." - - The default DOMAIN is the value of 'TEXTDOMAIN'. If DIRECTORY is - the null string ('""'), then 'bindtextdomain()' returns the current - binding for the given DOMAIN. - - To use these facilities in your 'awk' program, follow these steps: - - 1. Set the variable 'TEXTDOMAIN' to the text domain of your program. - This is best done in a 'BEGIN' rule (*note BEGIN/END::), or it can - also be done via the '-v' command-line option (*note Options::): - - BEGIN { - TEXTDOMAIN = "guide" - ... - } - - 2. Mark all translatable strings with a leading underscore ('_') - character. It _must_ be adjacent to the opening quote of the - string. For example: - - print _"hello, world" - x = _"you goofed" - printf(_"Number of users is %d\n", nusers) - - 3. If you are creating strings dynamically, you can still translate - them, using the 'dcgettext()' built-in function:(1) - - if (groggy) - message = dcgettext("%d customers disturbing me\n", "adminprog") - else - message = dcgettext("enjoying %d customers\n", "adminprog") - printf(message, ncustomers) - - Here, the call to 'dcgettext()' supplies a different text domain - ('"adminprog"') in which to find the message, but it uses the - default '"LC_MESSAGES"' category. - - The previous example only works if 'ncustomers' is greater than - one. This example would be better done with 'dcngettext()': - - if (groggy) - message = dcngettext("%d customer disturbing me\n", - "%d customers disturbing me\n", "adminprog") - else - message = dcngettext("enjoying %d customer\n", - "enjoying %d customers\n", "adminprog") - printf(message, ncustomers) - - 4. During development, you might want to put the '.gmo' file in a - private directory for testing. This is done with the - 'bindtextdomain()' built-in function: - - BEGIN { - TEXTDOMAIN = "guide" # our text domain - if (Testing) { - # where to find our files - bindtextdomain("testdir") - # joe is in charge of adminprog - bindtextdomain("../joe/testdir", "adminprog") - } - ... - } - - *Note I18N Example:: for an example program showing the steps to -create and use translations from 'awk'. - - ---------- Footnotes ---------- - - (1) Thanks to Bruno Haible for this example. - - -File: gawk.info, Node: Translator i18n, Next: I18N Example, Prev: Programmer i18n, Up: Internationalization - -13.4 Translating 'awk' Programs -=============================== - -Once a program's translatable strings have been marked, they must be -extracted to create the initial '.pot' file. As part of translation, it -is often helpful to rearrange the order in which arguments to 'printf' -are output. - - 'gawk''s '--gen-pot' command-line option extracts the messages and is -discussed next. After that, 'printf''s ability to rearrange the order -for 'printf' arguments at runtime is covered. - -* Menu: - -* String Extraction:: Extracting marked strings. -* Printf Ordering:: Rearranging 'printf' arguments. -* I18N Portability:: 'awk'-level portability issues. - - -File: gawk.info, Node: String Extraction, Next: Printf Ordering, Up: Translator i18n - -13.4.1 Extracting Marked Strings --------------------------------- - -Once your 'awk' program is working, and all the strings have been marked -and you've set (and perhaps bound) the text domain, it is time to -produce translations. First, use the '--gen-pot' command-line option to -create the initial '.pot' file: - - gawk --gen-pot -f guide.awk > guide.pot - - When run with '--gen-pot', 'gawk' does not execute your program. -Instead, it parses it as usual and prints all marked strings to standard -output in the format of a GNU 'gettext' Portable Object file. Also -included in the output are any constant strings that appear as the first -argument to 'dcgettext()' or as the first and second argument to -'dcngettext()'.(1) You should distribute the generated '.pot' file with -your 'awk' program; translators will eventually use it to provide you -translations that you can also then distribute. *Note I18N Example:: -for the full list of steps to go through to create and test translations -for 'guide'. - - ---------- Footnotes ---------- - - (1) The 'xgettext' utility that comes with GNU 'gettext' can handle -'.awk' files. - - -File: gawk.info, Node: Printf Ordering, Next: I18N Portability, Prev: String Extraction, Up: Translator i18n - -13.4.2 Rearranging 'printf' Arguments -------------------------------------- - -Format strings for 'printf' and 'sprintf()' (*note Printf::) present a -special problem for translation. Consider the following:(1) - - printf(_"String `%s' has %d characters\n", - string, length(string))) - - A possible German translation for this might be: - - "%d Zeichen lang ist die Zeichenkette `%s'\n" - - The problem should be obvious: the order of the format specifications -is different from the original! Even though 'gettext()' can return the -translated string at runtime, it cannot change the argument order in the -call to 'printf'. - - To solve this problem, 'printf' format specifiers may have an -additional optional element, which we call a "positional specifier". -For example: - - "%2$d Zeichen lang ist die Zeichenkette `%1$s'\n" - - Here, the positional specifier consists of an integer count, which -indicates which argument to use, and a '$'. Counts are one-based, and -the format string itself is _not_ included. Thus, in the following -example, 'string' is the first argument and 'length(string)' is the -second: - - $ gawk 'BEGIN { - > string = "Don\47t Panic" - > printf "%2$d characters live in \"%1$s\"\n", - > string, length(string) - > }' - -| 11 characters live in "Don't Panic" - - If present, positional specifiers come first in the format -specification, before the flags, the field width, and/or the precision. - - Positional specifiers can be used with the dynamic field width and -precision capability: - - $ gawk 'BEGIN { - > printf("%*.*s\n", 10, 20, "hello") - > printf("%3$*2$.*1$s\n", 20, 10, "hello") - > }' - -| hello - -| hello - - NOTE: When using '*' with a positional specifier, the '*' comes - first, then the integer position, and then the '$'. This is - somewhat counterintuitive. - - 'gawk' does not allow you to mix regular format specifiers and those -with positional specifiers in the same string: - - $ gawk 'BEGIN { printf "%d %3$s\n", 1, 2, "hi" }' - error-> gawk: cmd. line:1: fatal: must use `count$' on all formats or none - - NOTE: There are some pathological cases that 'gawk' may fail to - diagnose. In such cases, the output may not be what you expect. - It's still a bad idea to try mixing them, even if 'gawk' doesn't - detect it. - - Although positional specifiers can be used directly in 'awk' -programs, their primary purpose is to help in producing correct -translations of format strings into languages different from the one in -which the program is first written. - - ---------- Footnotes ---------- - - (1) This example is borrowed from the GNU 'gettext' manual. - - -File: gawk.info, Node: I18N Portability, Prev: Printf Ordering, Up: Translator i18n - -13.4.3 'awk' Portability Issues -------------------------------- - -'gawk''s internationalization features were purposely chosen to have as -little impact as possible on the portability of 'awk' programs that use -them to other versions of 'awk'. Consider this program: - - BEGIN { - TEXTDOMAIN = "guide" - if (Test_Guide) # set with -v - bindtextdomain("/test/guide/messages") - print _"don't panic!" - } - -As written, it won't work on other versions of 'awk'. However, it is -actually almost portable, requiring very little change: - - * Assignments to 'TEXTDOMAIN' won't have any effect, because - 'TEXTDOMAIN' is not special in other 'awk' implementations. - - * Non-GNU versions of 'awk' treat marked strings as the concatenation - of a variable named '_' with the string following it.(1) - Typically, the variable '_' has the null string ('""') as its - value, leaving the original string constant as the result. - - * By defining "dummy" functions to replace 'dcgettext()', - 'dcngettext()', and 'bindtextdomain()', the 'awk' program can be - made to run, but all the messages are output in the original - language. For example: - - function bindtextdomain(dir, domain) - { - return dir - } - - function dcgettext(string, domain, category) - { - return string - } - - function dcngettext(string1, string2, number, domain, category) - { - return (number == 1 ? string1 : string2) - } - - * The use of positional specifications in 'printf' or 'sprintf()' is - _not_ portable. To support 'gettext()' at the C level, many - systems' C versions of 'sprintf()' do support positional - specifiers. But it works only if enough arguments are supplied in - the function call. Many versions of 'awk' pass 'printf' formats - and arguments unchanged to the underlying C library version of - 'sprintf()', but only one format and argument at a time. What - happens if a positional specification is used is anybody's guess. - However, because the positional specifications are primarily for - use in _translated_ format strings, and because non-GNU 'awk's - never retrieve the translated string, this should not be a problem - in practice. - - ---------- Footnotes ---------- - - (1) This is good fodder for an "Obfuscated 'awk'" contest. - - -File: gawk.info, Node: I18N Example, Next: Gawk I18N, Prev: Translator i18n, Up: Internationalization - -13.5 A Simple Internationalization Example -========================================== - -Now let's look at a step-by-step example of how to internationalize and -localize a simple 'awk' program, using 'guide.awk' as our original -source: - - BEGIN { - TEXTDOMAIN = "guide" - bindtextdomain(".") # for testing - print _"Don't Panic" - print _"The Answer Is", 42 - print "Pardon me, Zaphod who?" - } - -Run 'gawk --gen-pot' to create the '.pot' file: - - $ gawk --gen-pot -f guide.awk > guide.pot - -This produces: - - #: guide.awk:4 - msgid "Don't Panic" - msgstr "" - - #: guide.awk:5 - msgid "The Answer Is" - msgstr "" - - - This original portable object template file is saved and reused for -each language into which the application is translated. The 'msgid' is -the original string and the 'msgstr' is the translation. - - NOTE: Strings not marked with a leading underscore do not appear in - the 'guide.pot' file. - - Next, the messages must be translated. Here is a translation to a -hypothetical dialect of English, called "Mellow":(1) - - $ cp guide.pot guide-mellow.po - ADD TRANSLATIONS TO guide-mellow.po ... - -Following are the translations: - - #: guide.awk:4 - msgid "Don't Panic" - msgstr "Hey man, relax!" - - #: guide.awk:5 - msgid "The Answer Is" - msgstr "Like, the scoop is" - - - The next step is to make the directory to hold the binary message -object file and then to create the 'guide.mo' file. We pretend that our -file is to be used in the 'en_US.UTF-8' locale, because we have to use a -locale name known to the C 'gettext' routines. The directory layout -shown here is standard for GNU 'gettext' on GNU/Linux systems. Other -versions of 'gettext' may use a different layout: - - $ mkdir en_US.UTF-8 en_US.UTF-8/LC_MESSAGES - - The 'msgfmt' utility does the conversion from human-readable '.po' -file to machine-readable '.mo' file. By default, 'msgfmt' creates a -file named 'messages'. This file must be renamed and placed in the -proper directory (using the '-o' option) so that 'gawk' can find it: - - $ msgfmt guide-mellow.po -o en_US.UTF-8/LC_MESSAGES/guide.mo - - Finally, we run the program to test it: - - $ gawk -f guide.awk - -| Hey man, relax! - -| Like, the scoop is 42 - -| Pardon me, Zaphod who? - - If the three replacement functions for 'dcgettext()', 'dcngettext()', -and 'bindtextdomain()' (*note I18N Portability::) are in a file named -'libintl.awk', then we can run 'guide.awk' unchanged as follows: - - $ gawk --posix -f guide.awk -f libintl.awk - -| Don't Panic - -| The Answer Is 42 - -| Pardon me, Zaphod who? - - ---------- Footnotes ---------- - - (1) Perhaps it would be better if it were called "Hippy." Ah, well. - - -File: gawk.info, Node: Gawk I18N, Next: I18N Summary, Prev: I18N Example, Up: Internationalization - -13.6 'gawk' Can Speak Your Language -=================================== - -'gawk' itself has been internationalized using the GNU 'gettext' -package. (GNU 'gettext' is described in complete detail in *note (GNU -'gettext' utilities, gettext, GNU 'gettext' utilities)Top::.) As of -this writing, the latest version of GNU 'gettext' is version 0.19.4 -(ftp://ftp.gnu.org/gnu/gettext/gettext-0.19.4.tar.gz). - - If a translation of 'gawk''s messages exists, then 'gawk' produces -usage messages, warnings, and fatal errors in the local language. - - -File: gawk.info, Node: I18N Summary, Prev: Gawk I18N, Up: Internationalization - -13.7 Summary -============ - - * Internationalization means writing a program such that it can use - multiple languages without requiring source code changes. - Localization means providing the data necessary for an - internationalized program to work in a particular language. - - * 'gawk' uses GNU 'gettext' to let you internationalize and localize - 'awk' programs. A program's text domain identifies the program for - grouping all messages and other data together. - - * You mark a program's strings for translation by preceding them with - an underscore. Once that is done, the strings are extracted into a - '.pot' file. This file is copied for each language into a '.po' - file, and the '.po' files are compiled into '.gmo' files for use at - runtime. - - * You can use positional specifications with 'sprintf()' and 'printf' - to rearrange the placement of argument values in formatted strings - and output. This is useful for the translation of format control - strings. - - * The internationalization features have been designed so that they - can be easily worked around in a standard 'awk'. - - * 'gawk' itself has been internationalized and ships with a number of - translations for its messages. - - -File: gawk.info, Node: Debugger, Next: Arbitrary Precision Arithmetic, Prev: Internationalization, Up: Top - -14 Debugging 'awk' Programs -*************************** - -It would be nice if computer programs worked perfectly the first time -they were run, but in real life, this rarely happens for programs of any -complexity. Thus, most programming languages have facilities available -for "debugging" programs, and now 'awk' is no exception. - - The 'gawk' debugger is purposely modeled after the GNU Debugger (GDB) -(http://www.gnu.org/software/gdb/) command-line debugger. If you are -familiar with GDB, learning how to use 'gawk' for debugging your program -is easy. - -* Menu: - -* Debugging:: Introduction to 'gawk' debugger. -* Sample Debugging Session:: Sample debugging session. -* List of Debugger Commands:: Main debugger commands. -* Readline Support:: Readline support. -* Limitations:: Limitations and future plans. -* Debugging Summary:: Debugging summary. - - -File: gawk.info, Node: Debugging, Next: Sample Debugging Session, Up: Debugger - -14.1 Introduction to the 'gawk' Debugger -======================================== - -This minor node introduces debugging in general and begins the -discussion of debugging in 'gawk'. - -* Menu: - -* Debugging Concepts:: Debugging in General. -* Debugging Terms:: Additional Debugging Concepts. -* Awk Debugging:: Awk Debugging. - - -File: gawk.info, Node: Debugging Concepts, Next: Debugging Terms, Up: Debugging - -14.1.1 Debugging in General ---------------------------- - -(If you have used debuggers in other languages, you may want to skip -ahead to *note Awk Debugging::.) - - Of course, a debugging program cannot remove bugs for you, because it -has no way of knowing what you or your users consider a "bug" versus a -"feature." (Sometimes, we humans have a hard time with this ourselves.) -In that case, what can you expect from such a tool? The answer to that -depends on the language being debugged, but in general, you can expect -at least the following: - - * The ability to watch a program execute its instructions one by one, - giving you, the programmer, the opportunity to think about what is - happening on a time scale of seconds, minutes, or hours, rather - than the nanosecond time scale at which the code usually runs. - - * The opportunity to not only passively observe the operation of your - program, but to control it and try different paths of execution, - without having to change your source files. - - * The chance to see the values of data in the program at any point in - execution, and also to change that data on the fly, to see how that - affects what happens afterward. (This often includes the ability - to look at internal data structures besides the variables you - actually defined in your code.) - - * The ability to obtain additional information about your program's - state or even its internal structure. - - All of these tools provide a great amount of help in using your own -skills and understanding of the goals of your program to find where it -is going wrong (or, for that matter, to better comprehend a perfectly -functional program that you or someone else wrote). - - -File: gawk.info, Node: Debugging Terms, Next: Awk Debugging, Prev: Debugging Concepts, Up: Debugging - -14.1.2 Debugging Concepts -------------------------- - -Before diving in to the details, we need to introduce several important -concepts that apply to just about all debuggers. The following list -defines terms used throughout the rest of this major node: - -"Stack frame" - Programs generally call functions during the course of their - execution. One function can call another, or a function can call - itself (recursion). You can view the chain of called functions - (main program calls A, which calls B, which calls C), as a stack of - executing functions: the currently running function is the topmost - one on the stack, and when it finishes (returns), the next one down - then becomes the active function. Such a stack is termed a "call - stack". - - For each function on the call stack, the system maintains a data - area that contains the function's parameters, local variables, and - return value, as well as any other "bookkeeping" information needed - to manage the call stack. This data area is termed a "stack - frame". - - 'gawk' also follows this model, and gives you access to the call - stack and to each stack frame. You can see the call stack, as well - as from where each function on the stack was invoked. Commands - that print the call stack print information about each stack frame - (as detailed later on). - -"Breakpoint" - During debugging, you often wish to let the program run until it - reaches a certain point, and then continue execution from there one - statement (or instruction) at a time. The way to do this is to set - a "breakpoint" within the program. A breakpoint is where the - execution of the program should break off (stop), so that you can - take over control of the program's execution. You can add and - remove as many breakpoints as you like. - -"Watchpoint" - A watchpoint is similar to a breakpoint. The difference is that - breakpoints are oriented around the code: stop when a certain point - in the code is reached. A watchpoint, however, specifies that - program execution should stop when a _data value_ is changed. This - is useful, as sometimes it happens that a variable receives an - erroneous value, and it's hard to track down where this happens - just by looking at the code. By using a watchpoint, you can stop - whenever a variable is assigned to, and usually find the errant - code quite quickly. - - -File: gawk.info, Node: Awk Debugging, Prev: Debugging Terms, Up: Debugging - -14.1.3 'awk' Debugging ----------------------- - -Debugging an 'awk' program has some specific aspects that are not shared -with programs written in other languages. - - First of all, the fact that 'awk' programs usually take input line by -line from a file or files and operate on those lines using specific -rules makes it especially useful to organize viewing the execution of -the program in terms of these rules. As we will see, each 'awk' rule is -treated almost like a function call, with its own specific block of -instructions. - - In addition, because 'awk' is by design a very concise language, it -is easy to lose sight of everything that is going on "inside" each line -of 'awk' code. The debugger provides the opportunity to look at the -individual primitive instructions carried out by the higher-level 'awk' -commands. - - -File: gawk.info, Node: Sample Debugging Session, Next: List of Debugger Commands, Prev: Debugging, Up: Debugger - -14.2 Sample 'gawk' Debugging Session -==================================== - -In order to illustrate the use of 'gawk' as a debugger, let's look at a -sample debugging session. We will use the 'awk' implementation of the -POSIX 'uniq' command described earlier (*note Uniq Program::) as our -example. - -* Menu: - -* Debugger Invocation:: How to Start the Debugger. -* Finding The Bug:: Finding the Bug. - - -File: gawk.info, Node: Debugger Invocation, Next: Finding The Bug, Up: Sample Debugging Session - -14.2.1 How to Start the Debugger --------------------------------- - -Starting the debugger is almost exactly like running 'gawk' normally, -except you have to pass an additional option, '--debug', or the -corresponding short option, '-D'. The file(s) containing the program -and any supporting code are given on the command line as arguments to -one or more '-f' options. ('gawk' is not designed to debug command-line -programs, only programs contained in files.) In our case, we invoke the -debugger like this: - - $ gawk -D -f getopt.awk -f join.awk -f uniq.awk -1 inputfile - -where both 'getopt.awk' and 'uniq.awk' are in '$AWKPATH'. (Experienced -users of GDB or similar debuggers should note that this syntax is -slightly different from what you are used to. With the 'gawk' debugger, -you give the arguments for running the program in the command line to -the debugger rather than as part of the 'run' command at the debugger -prompt.) The '-1' is an option to 'uniq.awk'. - - Instead of immediately running the program on 'inputfile', as 'gawk' -would ordinarily do, the debugger merely loads all the program source -files, compiles them internally, and then gives us a prompt: - - gawk> - -from which we can issue commands to the debugger. At this point, no -code has been executed. - - -File: gawk.info, Node: Finding The Bug, Prev: Debugger Invocation, Up: Sample Debugging Session - -14.2.2 Finding the Bug ----------------------- - -Let's say that we are having a problem using (a faulty version of) -'uniq.awk' in the "field-skipping" mode, and it doesn't seem to be -catching lines which should be identical when skipping the first field, -such as: - - awk is a wonderful program! - gawk is a wonderful program! - - This could happen if we were thinking (C-like) of the fields in a -record as being numbered in a zero-based fashion, so instead of the -lines: - - clast = join(alast, fcount+1, n) - cline = join(aline, fcount+1, m) - -we wrote: - - clast = join(alast, fcount, n) - cline = join(aline, fcount, m) - - The first thing we usually want to do when trying to investigate a -problem like this is to put a breakpoint in the program so that we can -watch it at work and catch what it is doing wrong. A reasonable spot -for a breakpoint in 'uniq.awk' is at the beginning of the function -'are_equal()', which compares the current line with the previous one. -To set the breakpoint, use the 'b' (breakpoint) command: - - gawk> b are_equal - -| Breakpoint 1 set at file `awklib/eg/prog/uniq.awk', line 63 - - The debugger tells us the file and line number where the breakpoint -is. Now type 'r' or 'run' and the program runs until it hits the -breakpoint for the first time: - - gawk> r - -| Starting program: - -| Stopping in Rule ... - -| Breakpoint 1, are_equal(n, m, clast, cline, alast, aline) - at `awklib/eg/prog/uniq.awk':63 - -| 63 if (fcount == 0 && charcount == 0) - gawk> - - Now we can look at what's going on inside our program. First of all, -let's see how we got to where we are. At the prompt, we type 'bt' -(short for "backtrace"), and the debugger responds with a listing of the -current stack frames: - - gawk> bt - -| #0 are_equal(n, m, clast, cline, alast, aline) - at `awklib/eg/prog/uniq.awk':68 - -| #1 in main() at `awklib/eg/prog/uniq.awk':88 - - This tells us that 'are_equal()' was called by the main program at -line 88 of 'uniq.awk'. (This is not a big surprise, because this is the -only call to 'are_equal()' in the program, but in more complex programs, -knowing who called a function and with what parameters can be the key to -finding the source of the problem.) - - Now that we're in 'are_equal()', we can start looking at the values -of some variables. Let's say we type 'p n' ('p' is short for "print"). -We would expect to see the value of 'n', a parameter to 'are_equal()'. -Actually, the debugger gives us: - - gawk> p n - -| n = untyped variable - -In this case, 'n' is an uninitialized local variable, because the -function was called without arguments (*note Function Calls::). - - A more useful variable to display might be the current record: - - gawk> p $0 - -| $0 = "gawk is a wonderful program!" - -This might be a bit puzzling at first, as this is the second line of our -test input. Let's look at 'NR': - - gawk> p NR - -| NR = 2 - -So we can see that 'are_equal()' was only called for the second record -of the file. Of course, this is because our program contains a rule for -'NR == 1': - - NR == 1 { - last = $0 - next - } - - OK, let's just check that that rule worked correctly: - - gawk> p last - -| last = "awk is a wonderful program!" - - Everything we have done so far has verified that the program has -worked as planned, up to and including the call to 'are_equal()', so the -problem must be inside this function. To investigate further, we must -begin "stepping through" the lines of 'are_equal()'. We start by typing -'n' (for "next"): - - gawk> n - -| 66 if (fcount > 0) { - - This tells us that 'gawk' is now ready to execute line 66, which -decides whether to give the lines the special "field-skipping" treatment -indicated by the '-1' command-line option. (Notice that we skipped from -where we were before, at line 63, to here, because the condition in line -63, 'if (fcount == 0 && charcount == 0)', was false.) - - Continuing to step, we now get to the splitting of the current and -last records: - - gawk> n - -| 67 n = split(last, alast) - gawk> n - -| 68 m = split($0, aline) - - At this point, we should be curious to see what our records were -split into, so we try to look: - - gawk> p n m alast aline - -| n = 5 - -| m = untyped variable - -| alast = array, 5 elements - -| aline = untyped variable - -(The 'p' command can take more than one argument, similar to 'awk''s -'print' statement.) - - This is kind of disappointing, though. All we found out is that -there are five elements in 'alast'; 'm' and 'aline' don't have values -because we are at line 68 but haven't executed it yet. This information -is useful enough (we now know that none of the words were accidentally -left out), but what if we want to see inside the array? - - The first choice would be to use subscripts: - - gawk> p alast[0] - -| "0" not in array `alast' - -Oops! - - gawk> p alast[1] - -| alast["1"] = "awk" - - This would be kind of slow for a 100-member array, though, so 'gawk' -provides a shortcut (reminiscent of another language not to be -mentioned): - - gawk> p @alast - -| alast["1"] = "awk" - -| alast["2"] = "is" - -| alast["3"] = "a" - -| alast["4"] = "wonderful" - -| alast["5"] = "program!" - - It looks like we got this far OK. Let's take another step or two: - - gawk> n - -| 69 clast = join(alast, fcount, n) - gawk> n - -| 70 cline = join(aline, fcount, m) - - Well, here we are at our error (sorry to spoil the suspense). What -we had in mind was to join the fields starting from the second one to -make the virtual record to compare, and if the first field were numbered -zero, this would work. Let's look at what we've got: - - gawk> p cline clast - -| cline = "gawk is a wonderful program!" - -| clast = "awk is a wonderful program!" - - Hey, those look pretty familiar! They're just our original, -unaltered input records. A little thinking (the human brain is still -the best debugging tool), and we realize that we were off by one! - - We get out of the debugger: - - gawk> q - -| The program is running. Exit anyway (y/n)? y - -Then we get into an editor: - - clast = join(alast, fcount+1, n) - cline = join(aline, fcount+1, m) - -and problem solved! - - -File: gawk.info, Node: List of Debugger Commands, Next: Readline Support, Prev: Sample Debugging Session, Up: Debugger - -14.3 Main Debugger Commands -=========================== - -The 'gawk' debugger command set can be divided into the following -categories: - - * Breakpoint control - - * Execution control - - * Viewing and changing data - - * Working with the stack - - * Getting information - - * Miscellaneous - - Each of these are discussed in the following subsections. In the -following descriptions, commands that may be abbreviated show the -abbreviation on a second description line. A debugger command name may -also be truncated if that partial name is unambiguous. The debugger has -the built-in capability to automatically repeat the previous command -just by hitting 'Enter'. This works for the commands 'list', 'next', -'nexti', 'step', 'stepi', and 'continue' executed without any argument. - -* Menu: - -* Breakpoint Control:: Control of Breakpoints. -* Debugger Execution Control:: Control of Execution. -* Viewing And Changing Data:: Viewing and Changing Data. -* Execution Stack:: Dealing with the Stack. -* Debugger Info:: Obtaining Information about the Program and - the Debugger State. -* Miscellaneous Debugger Commands:: Miscellaneous Commands. - - -File: gawk.info, Node: Breakpoint Control, Next: Debugger Execution Control, Up: List of Debugger Commands - -14.3.1 Control of Breakpoints ------------------------------ - -As we saw earlier, the first thing you probably want to do in a -debugging session is to get your breakpoints set up, because your -program will otherwise just run as if it was not under the debugger. -The commands for controlling breakpoints are: - -'break' [[FILENAME':']N | FUNCTION] ['"EXPRESSION"'] -'b' [[FILENAME':']N | FUNCTION] ['"EXPRESSION"'] - Without any argument, set a breakpoint at the next instruction to - be executed in the selected stack frame. Arguments can be one of - the following: - - N - Set a breakpoint at line number N in the current source file. - - FILENAME':'N - Set a breakpoint at line number N in source file FILENAME. - - FUNCTION - Set a breakpoint at entry to (the first instruction of) - function FUNCTION. - - Each breakpoint is assigned a number that can be used to delete it - from the breakpoint list using the 'delete' command. - - With a breakpoint, you may also supply a condition. This is an - 'awk' expression (enclosed in double quotes) that the debugger - evaluates whenever the breakpoint is reached. If the condition is - true, then the debugger stops execution and prompts for a command. - Otherwise, it continues executing the program. - -'clear' [[FILENAME':']N | FUNCTION] - Without any argument, delete any breakpoint at the next instruction - to be executed in the selected stack frame. If the program stops - at a breakpoint, this deletes that breakpoint so that the program - does not stop at that location again. Arguments can be one of the - following: - - N - Delete breakpoint(s) set at line number N in the current - source file. - - FILENAME':'N - Delete breakpoint(s) set at line number N in source file - FILENAME. - - FUNCTION - Delete breakpoint(s) set at entry to function FUNCTION. - -'condition' N '"EXPRESSION"' - Add a condition to existing breakpoint or watchpoint N. The - condition is an 'awk' expression _enclosed in double quotes_ that - the debugger evaluates whenever the breakpoint or watchpoint is - reached. If the condition is true, then the debugger stops - execution and prompts for a command. Otherwise, the debugger - continues executing the program. If the condition expression is - not specified, any existing condition is removed (i.e., the - breakpoint or watchpoint is made unconditional). - -'delete' [N1 N2 ...] [N-M] -'d' [N1 N2 ...] [N-M] - Delete specified breakpoints or a range of breakpoints. Delete all - defined breakpoints if no argument is supplied. - -'disable' [N1 N2 ... | N-M] - Disable specified breakpoints or a range of breakpoints. Without - any argument, disable all breakpoints. - -'enable' ['del' | 'once'] [N1 N2 ...] [N-M] -'e' ['del' | 'once'] [N1 N2 ...] [N-M] - Enable specified breakpoints or a range of breakpoints. Without - any argument, enable all breakpoints. Optionally, you can specify - how to enable the breakpoints: - - 'del' - Enable the breakpoints temporarily, then delete each one when - the program stops at it. - - 'once' - Enable the breakpoints temporarily, then disable each one when - the program stops at it. - -'ignore' N COUNT - Ignore breakpoint number N the next COUNT times it is hit. - -'tbreak' [[FILENAME':']N | FUNCTION] -'t' [[FILENAME':']N | FUNCTION] - Set a temporary breakpoint (enabled for only one stop). The - arguments are the same as for 'break'. - - -File: gawk.info, Node: Debugger Execution Control, Next: Viewing And Changing Data, Prev: Breakpoint Control, Up: List of Debugger Commands - -14.3.2 Control of Execution ---------------------------- - -Now that your breakpoints are ready, you can start running the program -and observing its behavior. There are more commands for controlling -execution of the program than we saw in our earlier example: - -'commands' [N] -'silent' -... -'end' - Set a list of commands to be executed upon stopping at a breakpoint - or watchpoint. N is the breakpoint or watchpoint number. Without - a number, the last one set is used. The actual commands follow, - starting on the next line, and terminated by the 'end' command. If - the command 'silent' is in the list, the usual messages about - stopping at a breakpoint and the source line are not printed. Any - command in the list that resumes execution (e.g., 'continue') - terminates the list (an implicit 'end'), and subsequent commands - are ignored. For example: - - gawk> commands - > silent - > printf "A silent breakpoint; i = %d\n", i - > info locals - > set i = 10 - > continue - > end - gawk> - -'continue' [COUNT] -'c' [COUNT] - Resume program execution. If continued from a breakpoint and COUNT - is specified, ignore the breakpoint at that location the next COUNT - times before stopping. - -'finish' - Execute until the selected stack frame returns. Print the returned - value. - -'next' [COUNT] -'n' [COUNT] - Continue execution to the next source line, stepping over function - calls. The argument COUNT controls how many times to repeat the - action, as in 'step'. - -'nexti' [COUNT] -'ni' [COUNT] - Execute one (or COUNT) instruction(s), stepping over function - calls. - -'return' [VALUE] - Cancel execution of a function call. If VALUE (either a string or - a number) is specified, it is used as the function's return value. - If used in a frame other than the innermost one (the currently - executing function; i.e., frame number 0), discard all inner frames - in addition to the selected one, and the caller of that frame - becomes the innermost frame. - -'run' -'r' - Start/restart execution of the program. When restarting, the - debugger retains the current breakpoints, watchpoints, command - history, automatic display variables, and debugger options. - -'step' [COUNT] -'s' [COUNT] - Continue execution until control reaches a different source line in - the current stack frame, stepping inside any function called within - the line. If the argument COUNT is supplied, steps that many times - before stopping, unless it encounters a breakpoint or watchpoint. - -'stepi' [COUNT] -'si' [COUNT] - Execute one (or COUNT) instruction(s), stepping inside function - calls. (For illustration of what is meant by an "instruction" in - 'gawk', see the output shown under 'dump' in *note Miscellaneous - Debugger Commands::.) - -'until' [[FILENAME':']N | FUNCTION] -'u' [[FILENAME':']N | FUNCTION] - Without any argument, continue execution until a line past the - current line in the current stack frame is reached. With an - argument, continue execution until the specified location is - reached, or the current stack frame returns. - - -File: gawk.info, Node: Viewing And Changing Data, Next: Execution Stack, Prev: Debugger Execution Control, Up: List of Debugger Commands - -14.3.3 Viewing and Changing Data --------------------------------- - -The commands for viewing and changing variables inside of 'gawk' are: - -'display' [VAR | '$'N] - Add variable VAR (or field '$N') to the display list. The value of - the variable or field is displayed each time the program stops. - Each variable added to the list is identified by a unique number: - - gawk> display x - -| 10: x = 1 - - This displays the assigned item number, the variable name, and its - current value. If the display variable refers to a function - parameter, it is silently deleted from the list as soon as the - execution reaches a context where no such variable of the given - name exists. Without argument, 'display' displays the current - values of items on the list. - -'eval "AWK STATEMENTS"' - Evaluate AWK STATEMENTS in the context of the running program. You - can do anything that an 'awk' program would do: assign values to - variables, call functions, and so on. - -'eval' PARAM, ... -AWK STATEMENTS -'end' - This form of 'eval' is similar, but it allows you to define "local - variables" that exist in the context of the AWK STATEMENTS, instead - of using variables or function parameters defined by the program. - -'print' VAR1[',' VAR2 ...] -'p' VAR1[',' VAR2 ...] - Print the value of a 'gawk' variable or field. Fields must be - referenced by constants: - - gawk> print $3 - - This prints the third field in the input record (if the specified - field does not exist, it prints 'Null field'). A variable can be - an array element, with the subscripts being constant string values. - To print the contents of an array, prefix the name of the array - with the '@' symbol: - - gawk> print @a - - This prints the indices and the corresponding values for all - elements in the array 'a'. - -'printf' FORMAT [',' ARG ...] - Print formatted text. The FORMAT may include escape sequences, - such as '\n' (*note Escape Sequences::). No newline is printed - unless one is specified. - -'set' VAR'='VALUE - Assign a constant (number or string) value to an 'awk' variable or - field. String values must be enclosed between double quotes - ('"'...'"'). - - You can also set special 'awk' variables, such as 'FS', 'NF', 'NR', - and so on. - -'watch' VAR | '$'N ['"EXPRESSION"'] -'w' VAR | '$'N ['"EXPRESSION"'] - Add variable VAR (or field '$N') to the watch list. The debugger - then stops whenever the value of the variable or field changes. - Each watched item is assigned a number that can be used to delete - it from the watch list using the 'unwatch' command. - - With a watchpoint, you may also supply a condition. This is an - 'awk' expression (enclosed in double quotes) that the debugger - evaluates whenever the watchpoint is reached. If the condition is - true, then the debugger stops execution and prompts for a command. - Otherwise, 'gawk' continues executing the program. - -'undisplay' [N] - Remove item number N (or all items, if no argument) from the - automatic display list. - -'unwatch' [N] - Remove item number N (or all items, if no argument) from the watch - list. - - -File: gawk.info, Node: Execution Stack, Next: Debugger Info, Prev: Viewing And Changing Data, Up: List of Debugger Commands - -14.3.4 Working with the Stack ------------------------------ - -Whenever you run a program that contains any function calls, 'gawk' -maintains a stack of all of the function calls leading up to where the -program is right now. You can see how you got to where you are, and -also move around in the stack to see what the state of things was in the -functions that called the one you are in. The commands for doing this -are: - -'backtrace' [COUNT] -'bt' [COUNT] -'where' [COUNT] - Print a backtrace of all function calls (stack frames), or - innermost COUNT frames if COUNT > 0. Print the outermost COUNT - frames if COUNT < 0. The backtrace displays the name and arguments - to each function, the source file name, and the line number. The - alias 'where' for 'backtrace' is provided for longtime GDB users - who may be used to that command. - -'down' [COUNT] - Move COUNT (default 1) frames down the stack toward the innermost - frame. Then select and print the frame. - -'frame' [N] -'f' [N] - Select and print stack frame N. Frame 0 is the currently - executing, or "innermost", frame (function call); frame 1 is the - frame that called the innermost one. The highest-numbered frame is - the one for the main program. The printed information consists of - the frame number, function and argument names, source file, and the - source line. - -'up' [COUNT] - Move COUNT (default 1) frames up the stack toward the outermost - frame. Then select and print the frame. - - -File: gawk.info, Node: Debugger Info, Next: Miscellaneous Debugger Commands, Prev: Execution Stack, Up: List of Debugger Commands - -14.3.5 Obtaining Information About the Program and the Debugger State ---------------------------------------------------------------------- - -Besides looking at the values of variables, there is often a need to get -other sorts of information about the state of your program and of the -debugging environment itself. The 'gawk' debugger has one command that -provides this information, appropriately called 'info'. 'info' is used -with one of a number of arguments that tell it exactly what you want to -know: - -'info' WHAT -'i' WHAT - The value for WHAT should be one of the following: - - 'args' - List arguments of the selected frame. - - 'break' - List all currently set breakpoints. - - 'display' - List all items in the automatic display list. - - 'frame' - Give a description of the selected stack frame. - - 'functions' - List all function definitions including source file names and - line numbers. - - 'locals' - List local variables of the selected frame. - - 'source' - Print the name of the current source file. Each time the - program stops, the current source file is the file containing - the current instruction. When the debugger first starts, the - current source file is the first file included via the '-f' - option. The 'list FILENAME:LINENO' command can be used at any - time to change the current source. - - 'sources' - List all program sources. - - 'variables' - List all global variables. - - 'watch' - List all items in the watch list. - - Additional commands give you control over the debugger, the ability -to save the debugger's state, and the ability to run debugger commands -from a file. The commands are: - -'option' [NAME['='VALUE]] -'o' [NAME['='VALUE]] - Without an argument, display the available debugger options and - their current values. 'option NAME' shows the current value of the - named option. 'option NAME=VALUE' assigns a new value to the named - option. The available options are: - - 'history_size' - Set the maximum number of lines to keep in the history file - './.gawk_history'. The default is 100. - - 'listsize' - Specify the number of lines that 'list' prints. The default - is 15. - - 'outfile' - Send 'gawk' output to a file; debugger output still goes to - standard output. An empty string ('""') resets output to - standard output. - - 'prompt' - Change the debugger prompt. The default is 'gawk> '. - - 'save_history' ['on' | 'off'] - Save command history to file './.gawk_history'. The default - is 'on'. - - 'save_options' ['on' | 'off'] - Save current options to file './.gawkrc' upon exit. The - default is 'on'. Options are read back into the next session - upon startup. - - 'trace' ['on' | 'off'] - Turn instruction tracing on or off. The default is 'off'. - -'save' FILENAME - Save the commands from the current session to the given file name, - so that they can be replayed using the 'source' command. - -'source' FILENAME - Run command(s) from a file; an error in any command does not - terminate execution of subsequent commands. Comments (lines - starting with '#') are allowed in a command file. Empty lines are - ignored; they do _not_ repeat the last command. You can't restart - the program by having more than one 'run' command in the file. - Also, the list of commands may include additional 'source' - commands; however, the 'gawk' debugger will not source the same - file more than once in order to avoid infinite recursion. - - In addition to, or instead of, the 'source' command, you can use - the '-D FILE' or '--debug=FILE' command-line options to execute - commands from a file non-interactively (*note Options::). - - -File: gawk.info, Node: Miscellaneous Debugger Commands, Prev: Debugger Info, Up: List of Debugger Commands - -14.3.6 Miscellaneous Commands ------------------------------ - -There are a few more commands that do not fit into the previous -categories, as follows: - -'dump' [FILENAME] - Dump byte code of the program to standard output or to the file - named in FILENAME. This prints a representation of the internal - instructions that 'gawk' executes to implement the 'awk' commands - in a program. This can be very enlightening, as the following - partial dump of Davide Brini's obfuscated code (*note Signature - Program::) demonstrates: - - gawk> dump - -| # BEGIN - -| - -| [ 1:0xfcd340] Op_rule : [in_rule = BEGIN] [source_file = brini.awk] - -| [ 1:0xfcc240] Op_push_i : "~" [MALLOC|STRING|STRCUR] - -| [ 1:0xfcc2a0] Op_push_i : "~" [MALLOC|STRING|STRCUR] - -| [ 1:0xfcc280] Op_match : - -| [ 1:0xfcc1e0] Op_store_var : O - -| [ 1:0xfcc2e0] Op_push_i : "==" [MALLOC|STRING|STRCUR] - -| [ 1:0xfcc340] Op_push_i : "==" [MALLOC|STRING|STRCUR] - -| [ 1:0xfcc320] Op_equal : - -| [ 1:0xfcc200] Op_store_var : o - -| [ 1:0xfcc380] Op_push : o - -| [ 1:0xfcc360] Op_plus_i : 0 [MALLOC|NUMCUR|NUMBER] - -| [ 1:0xfcc220] Op_push_lhs : o [do_reference = true] - -| [ 1:0xfcc300] Op_assign_plus : - -| [ :0xfcc2c0] Op_pop : - -| [ 1:0xfcc400] Op_push : O - -| [ 1:0xfcc420] Op_push_i : "" [MALLOC|STRING|STRCUR] - -| [ :0xfcc4a0] Op_no_op : - -| [ 1:0xfcc480] Op_push : O - -| [ :0xfcc4c0] Op_concat : [expr_count = 3] [concat_flag = 0] - -| [ 1:0xfcc3c0] Op_store_var : x - -| [ 1:0xfcc440] Op_push_lhs : X [do_reference = true] - -| [ 1:0xfcc3a0] Op_postincrement : - -| [ 1:0xfcc4e0] Op_push : x - -| [ 1:0xfcc540] Op_push : o - -| [ 1:0xfcc500] Op_plus : - -| [ 1:0xfcc580] Op_push : o - -| [ 1:0xfcc560] Op_plus : - -| [ 1:0xfcc460] Op_leq : - -| [ :0xfcc5c0] Op_jmp_false : [target_jmp = 0xfcc5e0] - -| [ 1:0xfcc600] Op_push_i : "%c" [MALLOC|STRING|STRCUR] - -| [ :0xfcc660] Op_no_op : - -| [ 1:0xfcc520] Op_assign_concat : c - -| [ :0xfcc620] Op_jmp : [target_jmp = 0xfcc440] - -| - ... - -| - -| [ 2:0xfcc5a0] Op_K_printf : [expr_count = 17] [redir_type = ""] - -| [ :0xfcc140] Op_no_op : - -| [ :0xfcc1c0] Op_atexit : - -| [ :0xfcc640] Op_stop : - -| [ :0xfcc180] Op_no_op : - -| [ :0xfcd150] Op_after_beginfile : - -| [ :0xfcc160] Op_no_op : - -| [ :0xfcc1a0] Op_after_endfile : - gawk> - -'exit' - Exit the debugger. See the entry for 'quit', later in this list. - -'help' -'h' - Print a list of all of the 'gawk' debugger commands with a short - summary of their usage. 'help COMMAND' prints the information - about the command COMMAND. - -'list' ['-' | '+' | N | FILENAME':'N | N-M | FUNCTION] -'l' ['-' | '+' | N | FILENAME':'N | N-M | FUNCTION] - Print the specified lines (default 15) from the current source file - or the file named FILENAME. The possible arguments to 'list' are - as follows: - - '-' (Minus) - Print lines before the lines last printed. - - '+' - Print lines after the lines last printed. 'list' without any - argument does the same thing. - - N - Print lines centered around line number N. - - N-M - Print lines from N to M. - - FILENAME':'N - Print lines centered around line number N in source file - FILENAME. This command may change the current source file. - - FUNCTION - Print lines centered around the beginning of the function - FUNCTION. This command may change the current source file. - -'quit' -'q' - Exit the debugger. Debugging is great fun, but sometimes we all - have to tend to other obligations in life, and sometimes we find - the bug and are free to go on to the next one! As we saw earlier, - if you are running a program, the debugger warns you when you type - 'q' or 'quit', to make sure you really want to quit. - -'trace' ['on' | 'off'] - Turn on or off continuous printing of the instructions that are - about to be executed, along with the 'awk' lines they implement. - The default is 'off'. - - It is to be hoped that most of the "opcodes" in these instructions - are fairly self-explanatory, and using 'stepi' and 'nexti' while - 'trace' is on will make them into familiar friends. - - -File: gawk.info, Node: Readline Support, Next: Limitations, Prev: List of Debugger Commands, Up: Debugger - -14.4 Readline Support -===================== - -If 'gawk' is compiled with the GNU Readline library -(http://cnswww.cns.cwru.edu/php/chet/readline/readline.html), you can -take advantage of that library's command completion and history -expansion features. The following types of completion are available: - -Command completion - Command names. - -Source file name completion - Source file names. Relevant commands are 'break', 'clear', 'list', - 'tbreak', and 'until'. - -Argument completion - Non-numeric arguments to a command. Relevant commands are 'enable' - and 'info'. - -Variable name completion - Global variable names, and function arguments in the current - context if the program is running. Relevant commands are - 'display', 'print', 'set', and 'watch'. - - -File: gawk.info, Node: Limitations, Next: Debugging Summary, Prev: Readline Support, Up: Debugger - -14.5 Limitations -================ - -We hope you find the 'gawk' debugger useful and enjoyable to work with, -but as with any program, especially in its early releases, it still has -some limitations. A few that it's worth being aware of are: - - * At this point, the debugger does not give a detailed explanation of - what you did wrong when you type in something it doesn't like. - Rather, it just responds 'syntax error'. When you do figure out - what your mistake was, though, you'll feel like a real guru. - - * If you perused the dump of opcodes in *note Miscellaneous Debugger - Commands:: (or if you are already familiar with 'gawk' internals), - you will realize that much of the internal manipulation of data in - 'gawk', as in many interpreters, is done on a stack. 'Op_push', - 'Op_pop', and the like are the "bread and butter" of most 'gawk' - code. - - Unfortunately, as of now, the 'gawk' debugger does not allow you to - examine the stack's contents. That is, the intermediate results of - expression evaluation are on the stack, but cannot be printed. - Rather, only variables that are defined in the program can be - printed. Of course, a workaround for this is to use more explicit - variables at the debugging stage and then change back to obscure, - perhaps more optimal code later. - - * There is no way to look "inside" the process of compiling regular - expressions to see if you got it right. As an 'awk' programmer, - you are expected to know the meaning of '/[^[:alnum:][:blank:]]/'. - - * The 'gawk' debugger is designed to be used by running a program - (with all its parameters) on the command line, as described in - *note Debugger Invocation::. There is no way (as of now) to attach - or "break into" a running program. This seems reasonable for a - language that is used mainly for quickly executing, short programs. - - * The 'gawk' debugger only accepts source code supplied with the '-f' - option. - - One other point is worth discussing. Conventional debuggers run in a -separate process (and thus address space) from the programs that they -debug (the "debuggee", if you will). - - The 'gawk' debugger is different; it is an integrated part of 'gawk' -itself. This makes it possible, in rare cases, for 'gawk' to become an -excellent demonstrator of Heisenberg Uncertainty physics, where the mere -act of observing something can change it. Consider the following:(1) - - $ cat test.awk - -| { print typeof($1), typeof($2) } - $ cat test.data - -| abc 123 - $ gawk -f test.awk test.data - -| strnum strnum - - This is all as expected: field data has the STRNUM attribute (*note -Variable Typing::). Now watch what happens when we run this program -under the debugger: - - $ gawk -D -f test.awk test.data - gawk> w $1 Set watchpoint on $1 - -| Watchpoint 1: $1 - gawk> w $2 Set watchpoint on $2 - -| Watchpoint 2: $2 - gawk> r Start the program - -| Starting program: - -| Stopping in Rule ... - -| Watchpoint 1: $1 Watchpoint fires - -| Old value: "" - -| New value: "abc" - -| main() at `test.awk':1 - -| 1 { print typeof($1), typeof($2) } - gawk> n Keep going ... - -| Watchpoint 2: $2 Watchpoint fires - -| Old value: "" - -| New value: "123" - -| main() at `test.awk':1 - -| 1 { print typeof($1), typeof($2) } - gawk> n Get result from typeof() - -| strnum number Result for $2 isn't right - -| Program exited normally with exit value: 0 - gawk> quit - - In this case, the act of comparing the new value of '$2' with the old -one caused 'gawk' to evaluate it and determine that it is indeed a -number, and this is reflected in the result of 'typeof()'. - - Cases like this where the debugger is not transparent to the -program's execution should be rare. If you encounter one, please report -it (*note Bugs::). - - ---------- Footnotes ---------- - - (1) Thanks to Hermann Peifer for this example. - - -File: gawk.info, Node: Debugging Summary, Prev: Limitations, Up: Debugger - -14.6 Summary -============ - - * Programs rarely work correctly the first time. Finding bugs is - called debugging, and a program that helps you find bugs is a - debugger. 'gawk' has a built-in debugger that works very similarly - to the GNU Debugger, GDB. - - * Debuggers let you step through your program one statement at a - time, examine and change variable and array values, and do a number - of other things that let you understand what your program is - actually doing (as opposed to what it is supposed to do). - - * Like most debuggers, the 'gawk' debugger works in terms of stack - frames, and lets you set both breakpoints (stop at a point in the - code) and watchpoints (stop when a data value changes). - - * The debugger command set is fairly complete, providing control over - breakpoints, execution, viewing and changing data, working with the - stack, getting information, and other tasks. - - * If the GNU Readline library is available when 'gawk' is compiled, - it is used by the debugger to provide command-line history and - editing. - - * Usually, the debugger does not not affect the program being - debugged, but occasionally it can. - - -File: gawk.info, Node: Arbitrary Precision Arithmetic, Next: Dynamic Extensions, Prev: Debugger, Up: Top - -15 Arithmetic and Arbitrary-Precision Arithmetic with 'gawk' -************************************************************ - -This major node introduces some basic concepts relating to how computers -do arithmetic and defines some important terms. It then proceeds to -describe floating-point arithmetic, which is what 'awk' uses for all its -computations, including a discussion of arbitrary-precision -floating-point arithmetic, which is a feature available only in 'gawk'. -It continues on to present arbitrary-precision integers, and concludes -with a description of some points where 'gawk' and the POSIX standard -are not quite in agreement. - - NOTE: Most users of 'gawk' can safely skip this chapter. But if - you want to do scientific calculations with 'gawk', this is the - place to be. - -* Menu: - -* Computer Arithmetic:: A quick intro to computer math. -* Math Definitions:: Defining terms used. -* MPFR features:: The MPFR features in 'gawk'. -* FP Math Caution:: Things to know. -* Arbitrary Precision Integers:: Arbitrary Precision Integer Arithmetic with - 'gawk'. -* POSIX Floating Point Problems:: Standards Versus Existing Practice. -* Floating point summary:: Summary of floating point discussion. - - -File: gawk.info, Node: Computer Arithmetic, Next: Math Definitions, Up: Arbitrary Precision Arithmetic - -15.1 A General Description of Computer Arithmetic -================================================= - -Until now, we have worked with data as either numbers or strings. -Ultimately, however, computers represent everything in terms of "binary -digits", or "bits". A decimal digit can take on any of 10 values: zero -through nine. A binary digit can take on any of two values, zero or -one. Using binary, computers (and computer software) can represent and -manipulate numerical and character data. In general, the more bits you -can use to represent a particular thing, the greater the range of -possible values it can take on. - - Modern computers support at least two, and often more, ways to do -arithmetic. Each kind of arithmetic uses a different representation -(organization of the bits) for the numbers. The kinds of arithmetic -that interest us are: - -Decimal arithmetic - This is the kind of arithmetic you learned in elementary school, - using paper and pencil (and/or a calculator). In theory, numbers - can have an arbitrary number of digits on either side (or both - sides) of the decimal point, and the results of a computation are - always exact. - - Some modern systems can do decimal arithmetic in hardware, but - usually you need a special software library to provide access to - these instructions. There are also libraries that do decimal - arithmetic entirely in software. - - Despite the fact that some users expect 'gawk' to be performing - decimal arithmetic,(1) it does not do so. - -Integer arithmetic - In school, integer values were referred to as "whole" numbers--that - is, numbers without any fractional part, such as 1, 42, or -17. - The advantage to integer numbers is that they represent values - exactly. The disadvantage is that their range is limited. - - In computers, integer values come in two flavors: "signed" and - "unsigned". Signed values may be negative or positive, whereas - unsigned values are always greater than or equal to zero. - - In computer systems, integer arithmetic is exact, but the possible - range of values is limited. Integer arithmetic is generally faster - than floating-point arithmetic. - -Floating-point arithmetic - Floating-point numbers represent what were called in school "real" - numbers (i.e., those that have a fractional part, such as - 3.1415927). The advantage to floating-point numbers is that they - can represent a much larger range of values than can integers. The - disadvantage is that there are numbers that they cannot represent - exactly. - - Modern systems support floating-point arithmetic in hardware, with - a limited range of values. There are software libraries that allow - the use of arbitrary-precision floating-point calculations. - - POSIX 'awk' uses "double-precision" floating-point numbers, which - can hold more digits than "single-precision" floating-point - numbers. 'gawk' has facilities for performing arbitrary-precision - floating-point arithmetic, which we describe in more detail - shortly. - - Computers work with integer and floating-point values of different -ranges. Integer values are usually either 32 or 64 bits in size. -Single-precision floating-point values occupy 32 bits, whereas -double-precision floating-point values occupy 64 bits. Floating-point -values are always signed. The possible ranges of values are shown in -*note Table 15.1: table-numeric-ranges. - -Numeric representation Minimum value Maximum value ---------------------------------------------------------------------------- -32-bit signed integer -2,147,483,648 2,147,483,647 -32-bit unsigned 0 4,294,967,295 -integer -64-bit signed integer -9,223,372,036,854,775,8089,223,372,036,854,775,807 -64-bit unsigned 0 18,446,744,073,709,551,615 -integer -Single-precision 1.175494e-38 3.402823e38 -floating point -(approximate) -Double-precision 2.225074e-308 1.797693e308 -floating point -(approximate) - -Table 15.1: Value ranges for different numeric representations - - ---------- Footnotes ---------- - - (1) We don't know why they expect this, but they do. - - -File: gawk.info, Node: Math Definitions, Next: MPFR features, Prev: Computer Arithmetic, Up: Arbitrary Precision Arithmetic - -15.2 Other Stuff to Know -======================== - -The rest of this major node uses a number of terms. Here are some -informal definitions that should help you work your way through the -material here: - -"Accuracy" - A floating-point calculation's accuracy is how close it comes to - the real (paper and pencil) value. - -"Error" - The difference between what the result of a computation "should be" - and what it actually is. It is best to minimize error as much as - possible. - -"Exponent" - The order of magnitude of a value; some number of bits in a - floating-point value store the exponent. - -"Inf" - A special value representing infinity. Operations involving - another number and infinity produce infinity. - -"NaN" - "Not a number."(1) A special value that results from attempting a - calculation that has no answer as a real number. In such a case, - programs can either receive a floating-point exception, or get - 'NaN' back as the result. The IEEE 754 standard recommends that - systems return 'NaN'. Some examples: - - 'sqrt(-1)' - This makes sense in the range of complex numbers, but not in - the range of real numbers, so the result is 'NaN'. - - 'log(-8)' - -8 is out of the domain of 'log()', so the result is 'NaN'. - -"Normalized" - How the significand (see later in this list) is usually stored. - The value is adjusted so that the first bit is one, and then that - leading one is assumed instead of physically stored. This provides - one extra bit of precision. - -"Precision" - The number of bits used to represent a floating-point number. The - more bits, the more digits you can represent. Binary and decimal - precisions are related approximately, according to the formula: - - PREC = 3.322 * DPS - - Here, _prec_ denotes the binary precision (measured in bits) and - _dps_ (short for decimal places) is the decimal digits. - -"Rounding mode" - How numbers are rounded up or down when necessary. More details - are provided later. - -"Significand" - A floating-point value consists of the significand multiplied by 10 - to the power of the exponent. For example, in '1.2345e67', the - significand is '1.2345'. - -"Stability" - From the Wikipedia article on numerical stability - (http://en.wikipedia.org/wiki/Numerical_stability): "Calculations - that can be proven not to magnify approximation errors are called - "numerically stable"." - - See the Wikipedia article on accuracy and precision -(http://en.wikipedia.org/wiki/Accuracy_and_precision) for more -information on some of those terms. - - On modern systems, floating-point hardware uses the representation -and operations defined by the IEEE 754 standard. Three of the standard -IEEE 754 types are 32-bit single precision, 64-bit double precision, and -128-bit quadruple precision. The standard also specifies extended -precision formats to allow greater precisions and larger exponent -ranges. ('awk' uses only the 64-bit double-precision format.) - - *note Table 15.2: table-ieee-formats. lists the precision and -exponent field values for the basic IEEE 754 binary formats. - -Name Total bits Precision Minimum Maximum - exponent exponent ---------------------------------------------------------------------------- -Single 32 24 -126 +127 -Double 64 53 -1022 +1023 -Quadruple 128 113 -16382 +16383 - -Table 15.2: Basic IEEE format values - - NOTE: The precision numbers include the implied leading one that - gives them one extra bit of significand. - - ---------- Footnotes ---------- - - (1) Thanks to Michael Brennan for this description, which we have -paraphrased, and for the examples. - - -File: gawk.info, Node: MPFR features, Next: FP Math Caution, Prev: Math Definitions, Up: Arbitrary Precision Arithmetic - -15.3 Arbitrary-Precision Arithmetic Features in 'gawk' -====================================================== - -By default, 'gawk' uses the double-precision floating-point values -supplied by the hardware of the system it runs on. However, if it was -compiled to do so, and the '-M' command-line option is supplied, 'gawk' -uses the GNU MPFR (http://www.mpfr.org) and GNU MP (http://gmplib.org) -(GMP) libraries for arbitrary-precision arithmetic on numbers. You can -see if MPFR support is available like so: - - $ gawk --version - -| GNU Awk 4.1.2, API: 1.1 (GNU MPFR 3.1.0-p3, GNU MP 5.0.2) - -| Copyright (C) 1989, 1991-2015 Free Software Foundation. - ... - -(You may see different version numbers than what's shown here. That's -OK; what's important is to see that GNU MPFR and GNU MP are listed in -the output.) - - Additionally, there are a few elements available in the 'PROCINFO' -array to provide information about the MPFR and GMP libraries (*note -Auto-set::). - - The MPFR library provides precise control over precisions and -rounding modes, and gives correctly rounded, reproducible, -platform-independent results. With the '-M' command-line option, all -floating-point arithmetic operators and numeric functions can yield -results to any desired precision level supported by MPFR. - - Two predefined variables, 'PREC' and 'ROUNDMODE', provide control -over the working precision and the rounding mode. The precision and the -rounding mode are set globally for every operation to follow. *Note -Setting precision:: and *note Setting the rounding mode:: for more -information. - - -File: gawk.info, Node: FP Math Caution, Next: Arbitrary Precision Integers, Prev: MPFR features, Up: Arbitrary Precision Arithmetic - -15.4 Floating-Point Arithmetic: Caveat Emptor! -============================================== - - Math class is tough! - -- _Teen Talk Barbie, July 1992_ - - This minor node provides a high-level overview of the issues involved -when doing lots of floating-point arithmetic.(1) The discussion applies -to both hardware and arbitrary-precision floating-point arithmetic. - - CAUTION: The material here is purposely general. If you need to do - serious computer arithmetic, you should do some research first, and - not rely just on what we tell you. - -* Menu: - -* Inexactness of computations:: Floating point math is not exact. -* Getting Accuracy:: Getting more accuracy takes some work. -* Try To Round:: Add digits and round. -* Setting precision:: How to set the precision. -* Setting the rounding mode:: How to set the rounding mode. - - ---------- Footnotes ---------- - - (1) There is a very nice paper on floating-point arithmetic -(http://www.validlab.com/goldberg/paper.pdf) by David Goldberg, "What -Every Computer Scientist Should Know About Floating-Point Arithmetic," -'ACM Computing Surveys' *23*, 1 (1991-03): 5-48. This is worth reading -if you are interested in the details, but it does require a background -in computer science. - - -File: gawk.info, Node: Inexactness of computations, Next: Getting Accuracy, Up: FP Math Caution - -15.4.1 Floating-Point Arithmetic Is Not Exact ---------------------------------------------- - -Binary floating-point representations and arithmetic are inexact. -Simple values like 0.1 cannot be precisely represented using binary -floating-point numbers, and the limited precision of floating-point -numbers means that slight changes in the order of operations or the -precision of intermediate storage can change the result. To make -matters worse, with arbitrary-precision floating-point arithmetic, you -can set the precision before starting a computation, but then you cannot -be sure of the number of significant decimal places in the final result. - -* Menu: - -* Inexact representation:: Numbers are not exactly represented. -* Comparing FP Values:: How to compare floating point values. -* Errors accumulate:: Errors get bigger as they go. - - -File: gawk.info, Node: Inexact representation, Next: Comparing FP Values, Up: Inexactness of computations - -15.4.1.1 Many Numbers Cannot Be Represented Exactly -................................................... - -So, before you start to write any code, you should think about what you -really want and what's really happening. Consider the two numbers in -the following example: - - x = 0.875 # 1/2 + 1/4 + 1/8 - y = 0.425 - - Unlike the number in 'y', the number stored in 'x' is exactly -representable in binary because it can be written as a finite sum of one -or more fractions whose denominators are all powers of two. When 'gawk' -reads a floating-point number from program source, it automatically -rounds that number to whatever precision your machine supports. If you -try to print the numeric content of a variable using an output format -string of '"%.17g"', it may not produce the same number as you assigned -to it: - - $ gawk 'BEGIN { x = 0.875; y = 0.425 - > printf("%0.17g, %0.17g\n", x, y) }' - -| 0.875, 0.42499999999999999 - - Often the error is so small you do not even notice it, and if you do, -you can always specify how much precision you would like in your output. -Usually this is a format string like '"%.15g"', which, when used in the -previous example, produces an output identical to the input. - - -File: gawk.info, Node: Comparing FP Values, Next: Errors accumulate, Prev: Inexact representation, Up: Inexactness of computations - -15.4.1.2 Be Careful Comparing Values -.................................... - -Because the underlying representation can be a little bit off from the -exact value, comparing floating-point values to see if they are exactly -equal is generally a bad idea. Here is an example where it does not -work like you would expect: - - $ gawk 'BEGIN { print (0.1 + 12.2 == 12.3) }' - -| 0 - - The general wisdom when comparing floating-point values is to see if -they are within some small range of each other (called a "delta", or -"tolerance"). You have to decide how small a delta is important to you. -Code to do this looks something like the following: - - delta = 0.00001 # for example - difference = abs(a) - abs(b) # subtract the two values - if (difference < delta) - # all ok - else - # not ok - -(We assume that you have a simple absolute value function named 'abs()' -defined elsewhere in your program.) - - -File: gawk.info, Node: Errors accumulate, Prev: Comparing FP Values, Up: Inexactness of computations - -15.4.1.3 Errors Accumulate -.......................... - -The loss of accuracy during a single computation with floating-point -numbers usually isn't enough to worry about. However, if you compute a -value that is the result of a sequence of floating-point operations, the -error can accumulate and greatly affect the computation itself. Here is -an attempt to compute the value of pi using one of its many series -representations: - - BEGIN { - x = 1.0 / sqrt(3.0) - n = 6 - for (i = 1; i < 30; i++) { - n = n * 2.0 - x = (sqrt(x * x + 1) - 1) / x - printf("%.15f\n", n * x) - } - } - - When run, the early errors propagate through later computations, -causing the loop to terminate prematurely after attempting to divide by -zero: - - $ gawk -f pi.awk - -| 3.215390309173475 - -| 3.159659942097510 - -| 3.146086215131467 - -| 3.142714599645573 - ... - -| 3.224515243534819 - -| 2.791117213058638 - -| 0.000000000000000 - error-> gawk: pi.awk:6: fatal: division by zero attempted - - Here is an additional example where the inaccuracies in internal -representations yield an unexpected result: - - $ gawk 'BEGIN { - > for (d = 1.1; d <= 1.5; d += 0.1) # loop five times (?) - > i++ - > print i - > }' - -| 4 - - -File: gawk.info, Node: Getting Accuracy, Next: Try To Round, Prev: Inexactness of computations, Up: FP Math Caution - -15.4.2 Getting the Accuracy You Need ------------------------------------- - -Can arbitrary-precision arithmetic give exact results? There are no -easy answers. The standard rules of algebra often do not apply when -using floating-point arithmetic. Among other things, the distributive -and associative laws do not hold completely, and order of operation may -be important for your computation. Rounding error, cumulative precision -loss, and underflow are often troublesome. - - When 'gawk' tests the expressions '0.1 + 12.2' and '12.3' for -equality using the machine double-precision arithmetic, it decides that -they are not equal! (*Note Comparing FP Values::.) You can get the -result you want by increasing the precision; 56 bits in this case does -the job: - - $ gawk -M -v PREC=56 'BEGIN { print (0.1 + 12.2 == 12.3) }' - -| 1 - - If adding more bits is good, perhaps adding even more bits of -precision is better? Here is what happens if we use an even larger -value of 'PREC': - - $ gawk -M -v PREC=201 'BEGIN { print (0.1 + 12.2 == 12.3) }' - -| 0 - - This is not a bug in 'gawk' or in the MPFR library. It is easy to -forget that the finite number of bits used to store the value is often -just an approximation after proper rounding. The test for equality -succeeds if and only if _all_ bits in the two operands are exactly the -same. Because this is not necessarily true after floating-point -computations with a particular precision and effective rounding mode, a -straight test for equality may not work. Instead, compare the two -numbers to see if they are within the desirable delta of each other. - - In applications where 15 or fewer decimal places suffice, hardware -double-precision arithmetic can be adequate, and is usually much faster. -But you need to keep in mind that every floating-point operation can -suffer a new rounding error with catastrophic consequences, as -illustrated by our earlier attempt to compute the value of pi. Extra -precision can greatly enhance the stability and the accuracy of your -computation in such cases. - - Additionally, you should understand that repeated addition is not -necessarily equivalent to multiplication in floating-point arithmetic. -In the example in *note Errors accumulate::: - - $ gawk 'BEGIN { - > for (d = 1.1; d <= 1.5; d += 0.1) # loop five times (?) - > i++ - > print i - > }' - -| 4 - -you may or may not succeed in getting the correct result by choosing an -arbitrarily large value for 'PREC'. Reformulation of the problem at -hand is often the correct approach in such situations. - - -File: gawk.info, Node: Try To Round, Next: Setting precision, Prev: Getting Accuracy, Up: FP Math Caution - -15.4.3 Try a Few Extra Bits of Precision and Rounding ------------------------------------------------------ - -Instead of arbitrary-precision floating-point arithmetic, often all you -need is an adjustment of your logic or a different order for the -operations in your calculation. The stability and the accuracy of the -computation of pi in the earlier example can be enhanced by using the -following simple algebraic transformation: - - (sqrt(x * x + 1) - 1) / x == x / (sqrt(x * x + 1) + 1) - -After making this change, the program converges to pi in under 30 -iterations: - - $ gawk -f pi2.awk - -| 3.215390309173473 - -| 3.159659942097501 - -| 3.146086215131436 - -| 3.142714599645370 - -| 3.141873049979825 - ... - -| 3.141592653589797 - -| 3.141592653589797 - - -File: gawk.info, Node: Setting precision, Next: Setting the rounding mode, Prev: Try To Round, Up: FP Math Caution - -15.4.4 Setting the Precision ----------------------------- - -'gawk' uses a global working precision; it does not keep track of the -precision or accuracy of individual numbers. Performing an arithmetic -operation or calling a built-in function rounds the result to the -current working precision. The default working precision is 53 bits, -which you can modify using the predefined variable 'PREC'. You can also -set the value to one of the predefined case-insensitive strings shown in -*note Table 15.3: table-predefined-precision-strings, to emulate an IEEE -754 binary format. - -'PREC' IEEE 754 binary format ---------------------------------------------------- -'"half"' 16-bit half-precision -'"single"' Basic 32-bit single precision -'"double"' Basic 64-bit double precision -'"quad"' Basic 128-bit quadruple precision -'"oct"' 256-bit octuple precision - -Table 15.3: Predefined precision strings for 'PREC' - - The following example illustrates the effects of changing precision -on arithmetic operations: - - $ gawk -M -v PREC=100 'BEGIN { x = 1.0e-400; print x + 0 - > PREC = "double"; print x + 0 }' - -| 1e-400 - -| 0 - - CAUTION: Be wary of floating-point constants! When reading a - floating-point constant from program source code, 'gawk' uses the - default precision (that of a C 'double'), unless overridden by an - assignment to the special variable 'PREC' on the command line, to - store it internally as an MPFR number. Changing the precision - using 'PREC' in the program text does _not_ change the precision of - a constant. - - If you need to represent a floating-point constant at a higher - precision than the default and cannot use a command-line assignment - to 'PREC', you should either specify the constant as a string, or - as a rational number, whenever possible. The following example - illustrates the differences among various ways to print a - floating-point constant: - - $ gawk -M 'BEGIN { PREC = 113; printf("%0.25f\n", 0.1) }' - -| 0.1000000000000000055511151 - $ gawk -M -v PREC=113 'BEGIN { printf("%0.25f\n", 0.1) }' - -| 0.1000000000000000000000000 - $ gawk -M 'BEGIN { PREC = 113; printf("%0.25f\n", "0.1") }' - -| 0.1000000000000000000000000 - $ gawk -M 'BEGIN { PREC = 113; printf("%0.25f\n", 1/10) }' - -| 0.1000000000000000000000000 - - -File: gawk.info, Node: Setting the rounding mode, Prev: Setting precision, Up: FP Math Caution - -15.4.5 Setting the Rounding Mode --------------------------------- - -The 'ROUNDMODE' variable provides program-level control over the -rounding mode. The correspondence between 'ROUNDMODE' and the IEEE -rounding modes is shown in *note Table 15.4: table-gawk-rounding-modes. - -Rounding mode IEEE name 'ROUNDMODE' ---------------------------------------------------------------------------- -Round to nearest, ties to even 'roundTiesToEven' '"N"' or '"n"' -Round toward positive infinity 'roundTowardPositive' '"U"' or '"u"' -Round toward negative infinity 'roundTowardNegative' '"D"' or '"d"' -Round toward zero 'roundTowardZero' '"Z"' or '"z"' -Round to nearest, ties away 'roundTiesToAway' '"A"' or '"a"' -from zero - -Table 15.4: 'gawk' rounding modes - - 'ROUNDMODE' has the default value '"N"', which selects the IEEE 754 -rounding mode 'roundTiesToEven'. In *note Table 15.4: -table-gawk-rounding-modes, the value '"A"' selects 'roundTiesToAway'. -This is only available if your version of the MPFR library supports it; -otherwise, setting 'ROUNDMODE' to '"A"' has no effect. - - The default mode 'roundTiesToEven' is the most preferred, but the -least intuitive. This method does the obvious thing for most values, by -rounding them up or down to the nearest digit. For example, rounding -1.132 to two digits yields 1.13, and rounding 1.157 yields 1.16. - - However, when it comes to rounding a value that is exactly halfway -between, things do not work the way you probably learned in school. In -this case, the number is rounded to the nearest even digit. So rounding -0.125 to two digits rounds down to 0.12, but rounding 0.6875 to three -digits rounds up to 0.688. You probably have already encountered this -rounding mode when using 'printf' to format floating-point numbers. For -example: - - BEGIN { - x = -4.5 - for (i = 1; i < 10; i++) { - x += 1.0 - printf("%4.1f => %2.0f\n", x, x) - } - } - -produces the following output when run on the author's system:(1) - - -3.5 => -4 - -2.5 => -2 - -1.5 => -2 - -0.5 => 0 - 0.5 => 0 - 1.5 => 2 - 2.5 => 2 - 3.5 => 4 - 4.5 => 4 - - The theory behind 'roundTiesToEven' is that it more or less evenly -distributes upward and downward rounds of exact halves, which might -cause any accumulating round-off error to cancel itself out. This is -the default rounding mode for IEEE 754 computing functions and -operators. - - The other rounding modes are rarely used. Rounding toward positive -infinity ('roundTowardPositive') and toward negative infinity -('roundTowardNegative') are often used to implement interval arithmetic, -where you adjust the rounding mode to calculate upper and lower bounds -for the range of output. The 'roundTowardZero' mode can be used for -converting floating-point numbers to integers. The rounding mode -'roundTiesToAway' rounds the result to the nearest number and selects -the number with the larger magnitude if a tie occurs. - - Some numerical analysts will tell you that your choice of rounding -style has tremendous impact on the final outcome, and advise you to wait -until final output for any rounding. Instead, you can often avoid -round-off error problems by setting the precision initially to some -value sufficiently larger than the final desired precision, so that the -accumulation of round-off error does not influence the outcome. If you -suspect that results from your computation are sensitive to accumulation -of round-off error, look for a significant difference in output when you -change the rounding mode to be sure. - - ---------- Footnotes ---------- - - (1) It is possible for the output to be completely different if the C -library in your system does not use the IEEE 754 even-rounding rule to -round halfway cases for 'printf'. - - -File: gawk.info, Node: Arbitrary Precision Integers, Next: POSIX Floating Point Problems, Prev: FP Math Caution, Up: Arbitrary Precision Arithmetic - -15.5 Arbitrary-Precision Integer Arithmetic with 'gawk' -======================================================= - -When given the '-M' option, 'gawk' performs all integer arithmetic using -GMP arbitrary-precision integers. Any number that looks like an integer -in a source or data file is stored as an arbitrary-precision integer. -The size of the integer is limited only by the available memory. For -example, the following computes 5^4^3^2, the result of which is beyond -the limits of ordinary hardware double-precision floating-point values: - - $ gawk -M 'BEGIN { - > x = 5^4^3^2 - > print "number of digits =", length(x) - > print substr(x, 1, 20), "...", substr(x, length(x) - 19, 20) - > }' - -| number of digits = 183231 - -| 62060698786608744707 ... 92256259918212890625 - - If instead you were to compute the same value using -arbitrary-precision floating-point values, the precision needed for -correct output (using the formula 'prec = 3.322 * dps') would be 3.322 x -183231, or 608693. - - The result from an arithmetic operation with an integer and a -floating-point value is a floating-point value with a precision equal to -the working precision. The following program calculates the eighth term -in Sylvester's sequence(1) using a recurrence: - - $ gawk -M 'BEGIN { - > s = 2.0 - > for (i = 1; i <= 7; i++) - > s = s * (s - 1) + 1 - > print s - > }' - -| 113423713055421845118910464 - - The output differs from the actual number, -113,423,713,055,421,844,361,000,443, because the default precision of 53 -bits is not enough to represent the floating-point results exactly. You -can either increase the precision (100 bits is enough in this case), or -replace the floating-point constant '2.0' with an integer, to perform -all computations using integer arithmetic to get the correct output. - - Sometimes 'gawk' must implicitly convert an arbitrary-precision -integer into an arbitrary-precision floating-point value. This is -primarily because the MPFR library does not always provide the relevant -interface to process arbitrary-precision integers or mixed-mode numbers -as needed by an operation or function. In such a case, the precision is -set to the minimum value necessary for exact conversion, and the working -precision is not used for this purpose. If this is not what you need or -want, you can employ a subterfuge and convert the integer to floating -point first, like this: - - gawk -M 'BEGIN { n = 13; print (n + 0.0) % 2.0 }' - - You can avoid this issue altogether by specifying the number as a -floating-point value to begin with: - - gawk -M 'BEGIN { n = 13.0; print n % 2.0 }' - - Note that for this particular example, it is likely best to just use -the following: - - gawk -M 'BEGIN { n = 13; print n % 2 }' - - When dividing two arbitrary precision integers with either '/' or -'%', the result is typically an arbitrary precision floating point value -(unless the denominator evenly divides into the numerator). In order to -do integer division or remainder with arbitrary precision integers, use -the built-in 'intdiv()' function (*note Numeric Functions::). - - You can simulate the 'intdiv()' function in standard 'awk' using this -user-defined function: - - # intdiv --- do integer division - - function intdiv(numerator, denominator, result) - { - split("", result) - - numerator = int(numerator) - denominator = int(denominator) - result["quotient"] = int(numerator / denominator) - result["remainder"] = int(numerator % denominator) - - return 0.0 - } - - The following example program, contributed by Katie Wasserman, uses -'intdiv()' to compute the digits of pi to as many places as you choose -to set: - - # pi.awk --- compute the digits of pi - - BEGIN { - digits = 100000 - two = 2 * 10 ^ digits - pi = two - for (m = digits * 4; m > 0; --m) { - d = m * 2 + 1 - x = pi * m - intdiv(x, d, result) - pi = result["quotient"] - pi = pi + two - } - print pi - } - - When asked about the algorithm used, Katie replied: - - It's not that well known but it's not that obscure either. It's - Euler's modification to Newton's method for calculating pi. Take a - look at lines (23) - (25) here: - <http://mathworld.wolfram.com/PiFormulas.html>. - - The algorithm I wrote simply expands the multiply by 2 and works - from the innermost expression outwards. I used this to program HP - calculators because it's quite easy to modify for tiny memory - devices with smallish word sizes. See - <http://www.hpmuseum.org/cgi-sys/cgiwrap/hpmuseum/articles.cgi?read=899>. - - ---------- Footnotes ---------- - - (1) Weisstein, Eric W. 'Sylvester's Sequence'. From MathWorld--A -Wolfram Web Resource -(<http://mathworld.wolfram.com/SylvestersSequence.html>). - - -File: gawk.info, Node: POSIX Floating Point Problems, Next: Floating point summary, Prev: Arbitrary Precision Integers, Up: Arbitrary Precision Arithmetic - -15.6 Standards Versus Existing Practice -======================================= - -Historically, 'awk' has converted any nonnumeric-looking string to the -numeric value zero, when required. Furthermore, the original definition -of the language and the original POSIX standards specified that 'awk' -only understands decimal numbers (base 10), and not octal (base 8) or -hexadecimal numbers (base 16). - - Changes in the language of the 2001 and 2004 POSIX standards can be -interpreted to imply that 'awk' should support additional features. -These features are: - - * Interpretation of floating-point data values specified in - hexadecimal notation (e.g., '0xDEADBEEF'). (Note: data values, - _not_ source code constants.) - - * Support for the special IEEE 754 floating-point values "not a - number" (NaN), positive infinity ("inf"), and negative infinity - ("-inf"). In particular, the format for these values is as - specified by the ISO 1999 C standard, which ignores case and can - allow implementation-dependent additional characters after the - 'nan' and allow either 'inf' or 'infinity'. - - The first problem is that both of these are clear changes to -historical practice: - - * The 'gawk' maintainer feels that supporting hexadecimal - floating-point values, in particular, is ugly, and was never - intended by the original designers to be part of the language. - - * Allowing completely alphabetic strings to have valid numeric values - is also a very severe departure from historical practice. - - The second problem is that the 'gawk' maintainer feels that this -interpretation of the standard, which required a certain amount of -"language lawyering" to arrive at in the first place, was not even -intended by the standard developers. In other words, "We see how you -got where you are, but we don't think that that's where you want to be." - - Recognizing these issues, but attempting to provide compatibility -with the earlier versions of the standard, the 2008 POSIX standard added -explicit wording to allow, but not require, that 'awk' support -hexadecimal floating-point values and special values for "not a number" -and infinity. - - Although the 'gawk' maintainer continues to feel that providing those -features is inadvisable, nevertheless, on systems that support IEEE -floating point, it seems reasonable to provide _some_ way to support NaN -and infinity values. The solution implemented in 'gawk' is as follows: - - * With the '--posix' command-line option, 'gawk' becomes "hands off." - String values are passed directly to the system library's - 'strtod()' function, and if it successfully returns a numeric - value, that is what's used.(1) By definition, the results are not - portable across different systems. They are also a little - surprising: - - $ echo nanny | gawk --posix '{ print $1 + 0 }' - -| nan - $ echo 0xDeadBeef | gawk --posix '{ print $1 + 0 }' - -| 3735928559 - - * Without '--posix', 'gawk' interprets the four string values '+inf', - '-inf', '+nan', and '-nan' specially, producing the corresponding - special numeric values. The leading sign acts a signal to 'gawk' - (and the user) that the value is really numeric. Hexadecimal - floating point is not supported (unless you also use - '--non-decimal-data', which is _not_ recommended). For example: - - $ echo nanny | gawk '{ print $1 + 0 }' - -| 0 - $ echo +nan | gawk '{ print $1 + 0 }' - -| nan - $ echo 0xDeadBeef | gawk '{ print $1 + 0 }' - -| 0 - - 'gawk' ignores case in the four special values. Thus, '+nan' and - '+NaN' are the same. - - ---------- Footnotes ---------- - - (1) You asked for it, you got it. - - -File: gawk.info, Node: Floating point summary, Prev: POSIX Floating Point Problems, Up: Arbitrary Precision Arithmetic - -15.7 Summary -============ - - * Most computer arithmetic is done using either integers or - floating-point values. Standard 'awk' uses double-precision - floating-point values. - - * In the early 1990s Barbie mistakenly said, "Math class is tough!" - Although math isn't tough, floating-point arithmetic isn't the same - as pencil-and-paper math, and care must be taken: - - - Not all numbers can be represented exactly. - - - Comparing values should use a delta, instead of being done - directly with '==' and '!='. - - - Errors accumulate. - - - Operations are not always truly associative or distributive. - - * Increasing the accuracy can help, but it is not a panacea. - - * Often, increasing the accuracy and then rounding to the desired - number of digits produces reasonable results. - - * Use '-M' (or '--bignum') to enable MPFR arithmetic. Use 'PREC' to - set the precision in bits, and 'ROUNDMODE' to set the IEEE 754 - rounding mode. - - * With '-M', 'gawk' performs arbitrary-precision integer arithmetic - using the GMP library. This is faster and more space-efficient - than using MPFR for the same calculations. - - * There are several areas with respect to floating-point numbers - where 'gawk' disagrees with the POSIX standard. It pays to be - aware of them. - - * Overall, there is no need to be unduly suspicious about the results - from floating-point arithmetic. The lesson to remember is that - floating-point arithmetic is always more complex than arithmetic - using pencil and paper. In order to take advantage of the power of - floating-point arithmetic, you need to know its limitations and - work within them. For most casual use of floating-point - arithmetic, you will often get the expected result if you simply - round the display of your final results to the correct number of - significant decimal digits. - - * As general advice, avoid presenting numerical data in a manner that - implies better precision than is actually the case. - - -File: gawk.info, Node: Dynamic Extensions, Next: Language History, Prev: Arbitrary Precision Arithmetic, Up: Top - -16 Writing Extensions for 'gawk' -******************************** - -It is possible to add new functions written in C or C++ to 'gawk' using -dynamically loaded libraries. This facility is available on systems -that support the C 'dlopen()' and 'dlsym()' functions. This major node -describes how to create extensions using code written in C or C++. - - If you don't know anything about C programming, you can safely skip -this major node, although you may wish to review the documentation on -the extensions that come with 'gawk' (*note Extension Samples::), and -the information on the 'gawkextlib' project (*note gawkextlib::). The -sample extensions are automatically built and installed when 'gawk' is. - - NOTE: When '--sandbox' is specified, extensions are disabled (*note - Options::). - -* Menu: - -* Extension Intro:: What is an extension. -* Plugin License:: A note about licensing. -* Extension Mechanism Outline:: An outline of how it works. -* Extension API Description:: A full description of the API. -* Finding Extensions:: How 'gawk' finds compiled extensions. -* Extension Example:: Example C code for an extension. -* Extension Samples:: The sample extensions that ship with - 'gawk'. -* gawkextlib:: The 'gawkextlib' project. -* Extension summary:: Extension summary. -* Extension Exercises:: Exercises. - - -File: gawk.info, Node: Extension Intro, Next: Plugin License, Up: Dynamic Extensions - -16.1 Introduction -================= - -An "extension" (sometimes called a "plug-in") is a piece of external -compiled code that 'gawk' can load at runtime to provide additional -functionality, over and above the built-in capabilities described in the -rest of this Info file. - - Extensions are useful because they allow you (of course) to extend -'gawk''s functionality. For example, they can provide access to system -calls (such as 'chdir()' to change directory) and to other C library -routines that could be of use. As with most software, "the sky is the -limit"; if you can imagine something that you might want to do and can -write in C or C++, you can write an extension to do it! - - Extensions are written in C or C++, using the "application -programming interface" (API) defined for this purpose by the 'gawk' -developers. The rest of this major node explains the facilities that -the API provides and how to use them, and presents a small example -extension. In addition, it documents the sample extensions included in -the 'gawk' distribution and describes the 'gawkextlib' project. *Note -Extension Design::, for a discussion of the extension mechanism goals -and design. - - -File: gawk.info, Node: Plugin License, Next: Extension Mechanism Outline, Prev: Extension Intro, Up: Dynamic Extensions - -16.2 Extension Licensing -======================== - -Every dynamic extension must be distributed under a license that is -compatible with the GNU GPL (*note Copying::). - - In order for the extension to tell 'gawk' that it is properly -licensed, the extension must define the global symbol -'plugin_is_GPL_compatible'. If this symbol does not exist, 'gawk' emits -a fatal error and exits when it tries to load your extension. - - The declared type of the symbol should be 'int'. It does not need to -be in any allocated section, though. The code merely asserts that the -symbol exists in the global scope. Something like this is enough: - - int plugin_is_GPL_compatible; - - -File: gawk.info, Node: Extension Mechanism Outline, Next: Extension API Description, Prev: Plugin License, Up: Dynamic Extensions - -16.3 How It Works at a High Level -================================= - -Communication between 'gawk' and an extension is two-way. First, when -an extension is loaded, 'gawk' passes it a pointer to a 'struct' whose -fields are function pointers. This is shown in *note Figure 16.1: -figure-load-extension. - - - Struct - +---+ - | | - +---+ - +---------------| | - | +---+ dl_load(api_p, id); - | | | ___________________ - | +---+ | - | +---------| | __________________ | - | | +---+ || - | | | | || - | | +---+ || - | | +---| | || - | | | +---+ \\ || / - | | | \\ / - v v v \\/ -+-------+-+---+-+---+-+------------------+--------------------+ -| |x| |x| |x| |OOOOOOOOOOOOOOOOOOOO| -| |x| |x| |x| |OOOOOOOOOOOOOOOOOOOO| -| |x| |x| |x| |OOOOOOOOOOOOOOOOOOOO| -+-------+-+---+-+---+-+------------------+--------------------+ - - gawk Main Program Address Space Extension" - -Figure 16.1: Loading the extension - - The extension can call functions inside 'gawk' through these function -pointers, at runtime, without needing (link-time) access to 'gawk''s -symbols. One of these function pointers is to a function for -"registering" new functions. This is shown in *note Figure 16.2: -figure-register-new-function. - - - - +--------------------------------------------+ - | | - V | -+-------+-+---+-+---+-+------------------+--------------+-+---+ -| |x| |x| |x| |OOOOOOOOOOOOOO|X|OOO| -| |x| |x| |x| |OOOOOOOOOOOOOO|X|OOO| -| |x| |x| |x| |OOOOOOOOOOOOOO|X|OOO| -+-------+-+---+-+---+-+------------------+--------------+-+---+ - - gawk Main Program Address Space Extension" - -Figure 16.2: Registering a new function - - In the other direction, the extension registers its new functions -with 'gawk' by passing function pointers to the functions that provide -the new feature ('do_chdir()', for example). 'gawk' associates the -function pointer with a name and can then call it, using a defined -calling convention. This is shown in *note Figure 16.3: -figure-call-new-function. - - - chdir(\"/path\") (*fnptr)(1); - } - +--------------------------------------------+ - | | - | V -+-------+-+---+-+---+-+------------------+--------------+-+---+ -| |x| |x| |x| |OOOOOOOOOOOOOO|X|OOO| -| |x| |x| |x| |OOOOOOOOOOOOOO|X|OOO| -| |x| |x| |x| |OOOOOOOOOOOOOO|X|OOO| -+-------+-+---+-+---+-+------------------+--------------+-+---+ - - gawk Main Program Address Space Extension" - -Figure 16.3: Calling the new function - - The 'do_XXX()' function, in turn, then uses the function pointers in -the API 'struct' to do its work, such as updating variables or arrays, -printing messages, setting 'ERRNO', and so on. - - Convenience macros make calling through the function pointers look -like regular function calls so that extension code is quite readable and -understandable. - - Although all of this sounds somewhat complicated, the result is that -extension code is quite straightforward to write and to read. You can -see this in the sample extension 'filefuncs.c' (*note Extension -Example::) and also in the 'testext.c' code for testing the APIs. - - Some other bits and pieces: - - * The API provides access to 'gawk''s 'do_XXX' values, reflecting - command-line options, like 'do_lint', 'do_profiling', and so on - (*note Extension API Variables::). These are informational: an - extension cannot affect their values inside 'gawk'. In addition, - attempting to assign to them produces a compile-time error. - - * The API also provides major and minor version numbers, so that an - extension can check if the 'gawk' it is loaded with supports the - facilities it was compiled with. (Version mismatches "shouldn't" - happen, but we all know how _that_ goes.) *Note Extension - Versioning:: for details. - - -File: gawk.info, Node: Extension API Description, Next: Finding Extensions, Prev: Extension Mechanism Outline, Up: Dynamic Extensions - -16.4 API Description -==================== - -C or C++ code for an extension must include the header file 'gawkapi.h', -which declares the functions and defines the data types used to -communicate with 'gawk'. This (rather large) minor node describes the -API in detail. - -* Menu: - -* Extension API Functions Introduction:: Introduction to the API functions. -* General Data Types:: The data types. -* Memory Allocation Functions:: Functions for allocating memory. -* Constructor Functions:: Functions for creating values. -* Registration Functions:: Functions to register things with - 'gawk'. -* Printing Messages:: Functions for printing messages. -* Updating ERRNO:: Functions for updating 'ERRNO'. -* Requesting Values:: How to get a value. -* Accessing Parameters:: Functions for accessing parameters. -* Symbol Table Access:: Functions for accessing global - variables. -* Array Manipulation:: Functions for working with arrays. -* Redirection API:: How to access and manipulate redirections. -* Extension API Variables:: Variables provided by the API. -* Extension API Boilerplate:: Boilerplate code for using the API. - - -File: gawk.info, Node: Extension API Functions Introduction, Next: General Data Types, Up: Extension API Description - -16.4.1 Introduction -------------------- - -Access to facilities within 'gawk' is achieved by calling through -function pointers passed into your extension. - - API function pointers are provided for the following kinds of -operations: - - * Allocating, reallocating, and releasing memory. - - * Registration functions. You may register: - - - Extension functions - - Exit callbacks - - A version string - - Input parsers - - Output wrappers - - Two-way processors - - All of these are discussed in detail later in this major node. - - * Printing fatal, warning, and "lint" warning messages. - - * Updating 'ERRNO', or unsetting it. - - * Accessing parameters, including converting an undefined parameter - into an array. - - * Symbol table access: retrieving a global variable, creating one, or - changing one. - - * Creating and releasing cached values; this provides an efficient - way to use values for multiple variables and can be a big - performance win. - - * Manipulating arrays: - - - Retrieving, adding, deleting, and modifying elements - - - Getting the count of elements in an array - - - Creating a new array - - - Clearing an array - - - Flattening an array for easy C-style looping over all its - indices and elements - - * Accessing and manipulating redirections. - - Some points about using the API: - - * The following types, macros, and/or functions are referenced in - 'gawkapi.h'. For correct use, you must therefore include the - corresponding standard header file _before_ including 'gawkapi.h': - - C entity Header file - ------------------------------------------- - 'EOF' '<stdio.h>' - Values for 'errno' '<errno.h>' - 'FILE' '<stdio.h>' - 'NULL' '<stddef.h>' - 'memcpy()' '<string.h>' - 'memset()' '<string.h>' - 'size_t' '<sys/types.h>' - 'struct stat' '<sys/stat.h>' - - Due to portability concerns, especially to systems that are not - fully standards-compliant, it is your responsibility to include the - correct files in the correct way. This requirement is necessary in - order to keep 'gawkapi.h' clean, instead of becoming a portability - hodge-podge as can be seen in some parts of the 'gawk' source code. - - * The 'gawkapi.h' file may be included more than once without ill - effect. Doing so, however, is poor coding practice. - - * Although the API only uses ISO C 90 features, there is an - exception; the "constructor" functions use the 'inline' keyword. - If your compiler does not support this keyword, you should either - place '-Dinline=''' on your command line or use the GNU Autotools - and include a 'config.h' file in your extensions. - - * All pointers filled in by 'gawk' point to memory managed by 'gawk' - and should be treated by the extension as read-only. Memory for - _all_ strings passed into 'gawk' from the extension _must_ come - from calling one of 'gawk_malloc()', 'gawk_calloc()', or - 'gawk_realloc()', and is managed by 'gawk' from then on. - - * The API defines several simple 'struct's that map values as seen - from 'awk'. A value can be a 'double', a string, or an array (as - in multidimensional arrays, or when creating a new array). String - values maintain both pointer and length, because embedded NUL - characters are allowed. - - NOTE: By intent, strings are maintained using the current - multibyte encoding (as defined by 'LC_XXX' environment - variables) and not using wide characters. This matches how - 'gawk' stores strings internally and also how characters are - likely to be input into and output from files. - - * When retrieving a value (such as a parameter or that of a global - variable or array element), the extension requests a specific type - (number, string, scalar, value cookie, array, or "undefined"). - When the request is "undefined," the returned value will have the - real underlying type. - - However, if the request and actual type don't match, the access - function returns "false" and fills in the type of the actual value - that is there, so that the extension can, e.g., print an error - message (such as "scalar passed where array expected"). - - You may call the API functions by using the function pointers -directly, but the interface is not so pretty. To make extension code -look more like regular code, the 'gawkapi.h' header file defines several -macros that you should use in your code. This minor node presents the -macros as if they were functions. - - -File: gawk.info, Node: General Data Types, Next: Memory Allocation Functions, Prev: Extension API Functions Introduction, Up: Extension API Description - -16.4.2 General-Purpose Data Types ---------------------------------- - - I have a true love/hate relationship with unions. - -- _Arnold Robbins_ - - That's the thing about unions: the compiler will arrange things so - they can accommodate both love and hate. - -- _Chet Ramey_ - - The extension API defines a number of simple types and structures for -general-purpose use. Additional, more specialized, data structures are -introduced in subsequent minor nodes, together with the functions that -use them. - - The general-purpose types and structures are as follows: - -'typedef void *awk_ext_id_t;' - A value of this type is received from 'gawk' when an extension is - loaded. That value must then be passed back to 'gawk' as the first - parameter of each API function. - -'#define awk_const ...' - This macro expands to 'const' when compiling an extension, and to - nothing when compiling 'gawk' itself. This makes certain fields in - the API data structures unwritable from extension code, while - allowing 'gawk' to use them as it needs to. - -'typedef enum awk_bool {' -' awk_false = 0,' -' awk_true' -'} awk_bool_t;' - A simple Boolean type. - -'typedef struct awk_string {' -' char *str; /* data */' -' size_t len; /* length thereof, in chars */' -'} awk_string_t;' - This represents a mutable string. 'gawk' owns the memory pointed - to if it supplied the value. Otherwise, it takes ownership of the - memory pointed to. _Such memory must come from calling one of the - 'gawk_malloc()', 'gawk_calloc()', or 'gawk_realloc()' functions!_ - - As mentioned earlier, strings are maintained using the current - multibyte encoding. - -'typedef enum {' -' AWK_UNDEFINED,' -' AWK_NUMBER,' -' AWK_STRING,' -' AWK_ARRAY,' -' AWK_SCALAR, /* opaque access to a variable */' -' AWK_VALUE_COOKIE /* for updating a previously created value */' -'} awk_valtype_t;' - This 'enum' indicates the type of a value. It is used in the - following 'struct'. - -'typedef struct awk_value {' -' awk_valtype_t val_type;' -' union {' -' awk_string_t s;' -' double d;' -' awk_array_t a;' -' awk_scalar_t scl;' -' awk_value_cookie_t vc;' -' } u;' -'} awk_value_t;' - An "'awk' value." The 'val_type' member indicates what kind of - value the 'union' holds, and each member is of the appropriate - type. - -'#define str_value u.s' -'#define num_value u.d' -'#define array_cookie u.a' -'#define scalar_cookie u.scl' -'#define value_cookie u.vc' - Using these macros makes accessing the fields of the 'awk_value_t' - more readable. - -'typedef void *awk_scalar_t;' - Scalars can be represented as an opaque type. These values are - obtained from 'gawk' and then passed back into it. This is - discussed in a general fashion in the text following this list, and - in more detail in *note Symbol table by cookie::. - -'typedef void *awk_value_cookie_t;' - A "value cookie" is an opaque type representing a cached value. - This is also discussed in a general fashion in the text following - this list, and in more detail in *note Cached values::. - - Scalar values in 'awk' are either numbers or strings. The -'awk_value_t' struct represents values. The 'val_type' member indicates -what is in the 'union'. - - Representing numbers is easy--the API uses a C 'double'. Strings -require more work. Because 'gawk' allows embedded NUL bytes in string -values, a string must be represented as a pair containing a data pointer -and length. This is the 'awk_string_t' type. - - Identifiers (i.e., the names of global variables) can be associated -with either scalar values or with arrays. In addition, 'gawk' provides -true arrays of arrays, where any given array element can itself be an -array. Discussion of arrays is delayed until *note Array -Manipulation::. - - The various macros listed earlier make it easier to use the elements -of the 'union' as if they were fields in a 'struct'; this is a common -coding practice in C. Such code is easier to write and to read, but it -remains _your_ responsibility to make sure that the 'val_type' member -correctly reflects the type of the value in the 'awk_value_t' struct. - - Conceptually, the first three members of the 'union' (number, string, -and array) are all that is needed for working with 'awk' values. -However, because the API provides routines for accessing and changing -the value of a global scalar variable only by using the variable's name, -there is a performance penalty: 'gawk' must find the variable each time -it is accessed and changed. This turns out to be a real issue, not just -a theoretical one. - - Thus, if you know that your extension will spend considerable time -reading and/or changing the value of one or more scalar variables, you -can obtain a "scalar cookie"(1) object for that variable, and then use -the cookie for getting the variable's value or for changing the -variable's value. The 'awk_scalar_t' type holds a scalar cookie, and -the 'scalar_cookie' macro provides access to the value of that type in -the 'awk_value_t' struct. Given a scalar cookie, 'gawk' can directly -retrieve or modify the value, as required, without having to find it -first. - - The 'awk_value_cookie_t' type and 'value_cookie' macro are similar. -If you know that you wish to use the same numeric or string _value_ for -one or more variables, you can create the value once, retaining a "value -cookie" for it, and then pass in that value cookie whenever you wish to -set the value of a variable. This saves storage space within the -running 'gawk' process and reduces the time needed to create the value. - - ---------- Footnotes ---------- - - (1) See the "cookie" entry in the Jargon file -(http://catb.org/jargon/html/C/cookie.html) for a definition of -"cookie", and the "magic cookie" entry in the Jargon file -(http://catb.org/jargon/html/M/magic-cookie.html) for a nice example. -See also the entry for "Cookie" in the *note Glossary::. - - -File: gawk.info, Node: Memory Allocation Functions, Next: Constructor Functions, Prev: General Data Types, Up: Extension API Description - -16.4.3 Memory Allocation Functions and Convenience Macros ---------------------------------------------------------- - -The API provides a number of "memory allocation" functions for -allocating memory that can be passed to 'gawk', as well as a number of -convenience macros. This node presents them all as function prototypes, -in the way that extension code would use them: - -'void *gawk_malloc(size_t size);' - Call the correct version of 'malloc()' to allocate storage that may - be passed to 'gawk'. - -'void *gawk_calloc(size_t nmemb, size_t size);' - Call the correct version of 'calloc()' to allocate storage that may - be passed to 'gawk'. - -'void *gawk_realloc(void *ptr, size_t size);' - Call the correct version of 'realloc()' to allocate storage that - may be passed to 'gawk'. - -'void gawk_free(void *ptr);' - Call the correct version of 'free()' to release storage that was - allocated with 'gawk_malloc()', 'gawk_calloc()', or - 'gawk_realloc()'. - - The API has to provide these functions because it is possible for an -extension to be compiled and linked against a different version of the C -library than was used for the 'gawk' executable.(1) If 'gawk' were to -use its version of 'free()' when the memory came from an unrelated -version of 'malloc()', unexpected behavior would likely result. - - Two convenience macros may be used for allocating storage from -'gawk_malloc()' and 'gawk_realloc()'. If the allocation fails, they -cause 'gawk' to exit with a fatal error message. They should be used as -if they were procedure calls that do not return a value: - -'#define emalloc(pointer, type, size, message) ...' - The arguments to this macro are as follows: - - 'pointer' - The pointer variable to point at the allocated storage. - - 'type' - The type of the pointer variable. This is used to create a - cast for the call to 'gawk_malloc()'. - - 'size' - The total number of bytes to be allocated. - - 'message' - A message to be prefixed to the fatal error message. - Typically this is the name of the function using the macro. - - For example, you might allocate a string value like so: - - awk_value_t result; - char *message; - const char greet[] = "Don't Panic!"; - - emalloc(message, char *, sizeof(greet), "myfunc"); - strcpy(message, greet); - make_malloced_string(message, strlen(message), & result); - -'#define erealloc(pointer, type, size, message) ...' - This is like 'emalloc()', but it calls 'gawk_realloc()' instead of - 'gawk_malloc()'. The arguments are the same as for the 'emalloc()' - macro. - - ---------- Footnotes ---------- - - (1) This is more common on MS-Windows systems, but it can happen on -Unix-like systems as well. - - -File: gawk.info, Node: Constructor Functions, Next: Registration Functions, Prev: Memory Allocation Functions, Up: Extension API Description - -16.4.4 Constructor Functions ----------------------------- - -The API provides a number of "constructor" functions for creating string -and numeric values, as well as a number of convenience macros. This -node presents them all as function prototypes, in the way that extension -code would use them: - -'static inline awk_value_t *' -'make_const_string(const char *string, size_t length, awk_value_t *result);' - This function creates a string value in the 'awk_value_t' variable - pointed to by 'result'. It expects 'string' to be a C string - constant (or other string data), and automatically creates a _copy_ - of the data for storage in 'result'. It returns 'result'. - -'static inline awk_value_t *' -'make_malloced_string(const char *string, size_t length, awk_value_t *result);' - This function creates a string value in the 'awk_value_t' variable - pointed to by 'result'. It expects 'string' to be a 'char *' value - pointing to data previously obtained from 'gawk_malloc()', - 'gawk_calloc()', or 'gawk_realloc()'. The idea here is that the - data is passed directly to 'gawk', which assumes responsibility for - it. It returns 'result'. - -'static inline awk_value_t *' -'make_null_string(awk_value_t *result);' - This specialized function creates a null string (the "undefined" - value) in the 'awk_value_t' variable pointed to by 'result'. It - returns 'result'. - -'static inline awk_value_t *' -'make_number(double num, awk_value_t *result);' - This function simply creates a numeric value in the 'awk_value_t' - variable pointed to by 'result'. - - -File: gawk.info, Node: Registration Functions, Next: Printing Messages, Prev: Constructor Functions, Up: Extension API Description - -16.4.5 Registration Functions ------------------------------ - -This minor node describes the API functions for registering parts of -your extension with 'gawk'. - -* Menu: - -* Extension Functions:: Registering extension functions. -* Exit Callback Functions:: Registering an exit callback. -* Extension Version String:: Registering a version string. -* Input Parsers:: Registering an input parser. -* Output Wrappers:: Registering an output wrapper. -* Two-way processors:: Registering a two-way processor. - - -File: gawk.info, Node: Extension Functions, Next: Exit Callback Functions, Up: Registration Functions - -16.4.5.1 Registering An Extension Function -.......................................... - -Extension functions are described by the following record: - - typedef struct awk_ext_func { - const char *name; - awk_value_t *(*function)(int num_actual_args, awk_value_t *result); - size_t max_expected_args; - } awk_ext_func_t; - - The fields are: - -'const char *name;' - The name of the new function. 'awk'-level code calls the function - by this name. This is a regular C string. - - Function names must obey the rules for 'awk' identifiers. That is, - they must begin with either an English letter or an underscore, - which may be followed by any number of letters, digits, and - underscores. Letter case in function names is significant. - -'awk_value_t *(*function)(int num_actual_args, awk_value_t *result);' - This is a pointer to the C function that provides the extension's - functionality. The function must fill in '*result' with either a - number or a string. 'gawk' takes ownership of any string memory. - As mentioned earlier, string memory _must_ come from one of - 'gawk_malloc()', 'gawk_calloc()', or 'gawk_realloc()'. - - The 'num_actual_args' argument tells the C function how many actual - parameters were passed from the calling 'awk' code. - - The function must return the value of 'result'. This is for the - convenience of the calling code inside 'gawk'. - -'size_t max_expected_args;' - This is the maximum number of arguments the function expects to - receive. Each extension function may decide what to do if the - number of arguments isn't what it expected. As with real 'awk' - functions, it is likely OK to ignore extra arguments. This value - does not affect actual program execution. - - Extension functions should compare this value to the number of - actual arguments passed and possibly issue a lint warning if there - is an undesirable mismatch. Of course, if '--lint=fatal' is used, - this would cause the program to exit. - - Once you have a record representing your extension function, you -register it with 'gawk' using this API function: - -'awk_bool_t add_ext_func(const char *namespace, const awk_ext_func_t *func);' - This function returns true upon success, false otherwise. The - 'namespace' parameter is currently not used; you should pass in an - empty string ('""'). The 'func' pointer is the address of a - 'struct' representing your function, as just described. - - -File: gawk.info, Node: Exit Callback Functions, Next: Extension Version String, Prev: Extension Functions, Up: Registration Functions - -16.4.5.2 Registering An Exit Callback Function -.............................................. - -An "exit callback" function is a function that 'gawk' calls before it -exits. Such functions are useful if you have general "cleanup" tasks -that should be performed in your extension (such as closing database -connections or other resource deallocations). You can register such a -function with 'gawk' using the following function: - -'void awk_atexit(void (*funcp)(void *data, int exit_status),' -' void *arg0);' - The parameters are: - - 'funcp' - A pointer to the function to be called before 'gawk' exits. - The 'data' parameter will be the original value of 'arg0'. - The 'exit_status' parameter is the exit status value that - 'gawk' intends to pass to the 'exit()' system call. - - 'arg0' - A pointer to private data that 'gawk' saves in order to pass - to the function pointed to by 'funcp'. - - Exit callback functions are called in last-in, first-out (LIFO) -order--that is, in the reverse order in which they are registered with -'gawk'. - - -File: gawk.info, Node: Extension Version String, Next: Input Parsers, Prev: Exit Callback Functions, Up: Registration Functions - -16.4.5.3 Registering An Extension Version String -................................................ - -You can register a version string that indicates the name and version of -your extension with 'gawk', as follows: - -'void register_ext_version(const char *version);' - Register the string pointed to by 'version' with 'gawk'. Note that - 'gawk' does _not_ copy the 'version' string, so it should not be - changed. - - 'gawk' prints all registered extension version strings when it is -invoked with the '--version' option. - - -File: gawk.info, Node: Input Parsers, Next: Output Wrappers, Prev: Extension Version String, Up: Registration Functions - -16.4.5.4 Customized Input Parsers -................................. - -By default, 'gawk' reads text files as its input. It uses the value of -'RS' to find the end of the record, and then uses 'FS' (or 'FIELDWIDTHS' -or 'FPAT') to split it into fields (*note Reading Files::). -Additionally, it sets the value of 'RT' (*note Built-in Variables::). - - If you want, you can provide your own custom input parser. An input -parser's job is to return a record to the 'gawk' record-processing code, -along with indicators for the value and length of the data to be used -for 'RT', if any. - - To provide an input parser, you must first provide two functions -(where XXX is a prefix name for your extension): - -'awk_bool_t XXX_can_take_file(const awk_input_buf_t *iobuf);' - This function examines the information available in 'iobuf' (which - we discuss shortly). Based on the information there, it decides if - the input parser should be used for this file. If so, it should - return true. Otherwise, it should return false. It should not - change any state (variable values, etc.) within 'gawk'. - -'awk_bool_t XXX_take_control_of(awk_input_buf_t *iobuf);' - When 'gawk' decides to hand control of the file over to the input - parser, it calls this function. This function in turn must fill in - certain fields in the 'awk_input_buf_t' structure and ensure that - certain conditions are true. It should then return true. If an - error of some kind occurs, it should not fill in any fields and - should return false; then 'gawk' will not use the input parser. - The details are presented shortly. - - Your extension should package these functions inside an -'awk_input_parser_t', which looks like this: - - typedef struct awk_input_parser { - const char *name; /* name of parser */ - awk_bool_t (*can_take_file)(const awk_input_buf_t *iobuf); - awk_bool_t (*take_control_of)(awk_input_buf_t *iobuf); - awk_const struct awk_input_parser *awk_const next; /* for gawk */ - } awk_input_parser_t; - - The fields are: - -'const char *name;' - The name of the input parser. This is a regular C string. - -'awk_bool_t (*can_take_file)(const awk_input_buf_t *iobuf);' - A pointer to your 'XXX_can_take_file()' function. - -'awk_bool_t (*take_control_of)(awk_input_buf_t *iobuf);' - A pointer to your 'XXX_take_control_of()' function. - -'awk_const struct input_parser *awk_const next;' - This is for use by 'gawk'; therefore it is marked 'awk_const' so - that the extension cannot modify it. - - The steps are as follows: - - 1. Create a 'static awk_input_parser_t' variable and initialize it - appropriately. - - 2. When your extension is loaded, register your input parser with - 'gawk' using the 'register_input_parser()' API function (described - next). - - An 'awk_input_buf_t' looks like this: - - typedef struct awk_input { - const char *name; /* filename */ - int fd; /* file descriptor */ - #define INVALID_HANDLE (-1) - void *opaque; /* private data for input parsers */ - int (*get_record)(char **out, struct awk_input *iobuf, - int *errcode, char **rt_start, size_t *rt_len); - ssize_t (*read_func)(); - void (*close_func)(struct awk_input *iobuf); - struct stat sbuf; /* stat buf */ - } awk_input_buf_t; - - The fields can be divided into two categories: those for use -(initially, at least) by 'XXX_can_take_file()', and those for use by -'XXX_take_control_of()'. The first group of fields and their uses are -as follows: - -'const char *name;' - The name of the file. - -'int fd;' - A file descriptor for the file. If 'gawk' was able to open the - file, then 'fd' will _not_ be equal to 'INVALID_HANDLE'. - Otherwise, it will. - -'struct stat sbuf;' - If the file descriptor is valid, then 'gawk' will have filled in - this structure via a call to the 'fstat()' system call. - - The 'XXX_can_take_file()' function should examine these fields and -decide if the input parser should be used for the file. The decision -can be made based upon 'gawk' state (the value of a variable defined -previously by the extension and set by 'awk' code), the name of the -file, whether or not the file descriptor is valid, the information in -the 'struct stat', or any combination of these factors. - - Once 'XXX_can_take_file()' has returned true, and 'gawk' has decided -to use your input parser, it calls 'XXX_take_control_of()'. That -function then fills either the 'get_record' field or the 'read_func' -field in the 'awk_input_buf_t'. It must also ensure that 'fd' is _not_ -set to 'INVALID_HANDLE'. The following list describes the fields that -may be filled by 'XXX_take_control_of()': - -'void *opaque;' - This is used to hold any state information needed by the input - parser for this file. It is "opaque" to 'gawk'. The input parser - is not required to use this pointer. - -'int (*get_record)(char **out,' -' struct awk_input *iobuf,' -' int *errcode,' -' char **rt_start,' -' size_t *rt_len);' - This function pointer should point to a function that creates the - input records. Said function is the core of the input parser. Its - behavior is described in the text following this list. - -'ssize_t (*read_func)();' - This function pointer should point to a function that has the same - behavior as the standard POSIX 'read()' system call. It is an - alternative to the 'get_record' pointer. Its behavior is also - described in the text following this list. - -'void (*close_func)(struct awk_input *iobuf);' - This function pointer should point to a function that does the - "teardown." It should release any resources allocated by - 'XXX_take_control_of()'. It may also close the file. If it does - so, it should set the 'fd' field to 'INVALID_HANDLE'. - - If 'fd' is still not 'INVALID_HANDLE' after the call to this - function, 'gawk' calls the regular 'close()' system call. - - Having a "teardown" function is optional. If your input parser - does not need it, do not set this field. Then, 'gawk' calls the - regular 'close()' system call on the file descriptor, so it should - be valid. - - The 'XXX_get_record()' function does the work of creating input -records. The parameters are as follows: - -'char **out' - This is a pointer to a 'char *' variable that is set to point to - the record. 'gawk' makes its own copy of the data, so the - extension must manage this storage. - -'struct awk_input *iobuf' - This is the 'awk_input_buf_t' for the file. The fields should be - used for reading data ('fd') and for managing private state - ('opaque'), if any. - -'int *errcode' - If an error occurs, '*errcode' should be set to an appropriate code - from '<errno.h>'. - -'char **rt_start' -'size_t *rt_len' - If the concept of a "record terminator" makes sense, then - '*rt_start' should be set to point to the data to be used for 'RT', - and '*rt_len' should be set to the length of the data. Otherwise, - '*rt_len' should be set to zero. 'gawk' makes its own copy of this - data, so the extension must manage this storage. - - The return value is the length of the buffer pointed to by '*out', or -'EOF' if end-of-file was reached or an error occurred. - - It is guaranteed that 'errcode' is a valid pointer, so there is no -need to test for a 'NULL' value. 'gawk' sets '*errcode' to zero, so -there is no need to set it unless an error occurs. - - If an error does occur, the function should return 'EOF' and set -'*errcode' to a value greater than zero. In that case, if '*errcode' -does not equal zero, 'gawk' automatically updates the 'ERRNO' variable -based on the value of '*errcode'. (In general, setting '*errcode = -errno' should do the right thing.) - - As an alternative to supplying a function that returns an input -record, you may instead supply a function that simply reads bytes, and -let 'gawk' parse the data into records. If you do so, the data should -be returned in the multibyte encoding of the current locale. Such a -function should follow the same behavior as the 'read()' system call, -and you fill in the 'read_func' pointer with its address in the -'awk_input_buf_t' structure. - - By default, 'gawk' sets the 'read_func' pointer to point to the -'read()' system call. So your extension need not set this field -explicitly. - - NOTE: You must choose one method or the other: either a function - that returns a record, or one that returns raw data. In - particular, if you supply a function to get a record, 'gawk' will - call it, and will never call the raw read function. - - 'gawk' ships with a sample extension that reads directories, -returning records for each entry in a directory (*note Extension Sample -Readdir::). You may wish to use that code as a guide for writing your -own input parser. - - When writing an input parser, you should think about (and document) -how it is expected to interact with 'awk' code. You may want it to -always be called, and to take effect as appropriate (as the 'readdir' -extension does). Or you may want it to take effect based upon the value -of an 'awk' variable, as the XML extension from the 'gawkextlib' project -does (*note gawkextlib::). In the latter case, code in a 'BEGINFILE' -rule can look at 'FILENAME' and 'ERRNO' to decide whether or not to -activate an input parser (*note BEGINFILE/ENDFILE::). - - You register your input parser with the following function: - -'void register_input_parser(awk_input_parser_t *input_parser);' - Register the input parser pointed to by 'input_parser' with 'gawk'. - - -File: gawk.info, Node: Output Wrappers, Next: Two-way processors, Prev: Input Parsers, Up: Registration Functions - -16.4.5.5 Customized Output Wrappers -................................... - -An "output wrapper" is the mirror image of an input parser. It allows -an extension to take over the output to a file opened with the '>' or -'>>' I/O redirection operators (*note Redirection::). - - The output wrapper is very similar to the input parser structure: - - typedef struct awk_output_wrapper { - const char *name; /* name of the wrapper */ - awk_bool_t (*can_take_file)(const awk_output_buf_t *outbuf); - awk_bool_t (*take_control_of)(awk_output_buf_t *outbuf); - awk_const struct awk_output_wrapper *awk_const next; /* for gawk */ - } awk_output_wrapper_t; - - The members are as follows: - -'const char *name;' - This is the name of the output wrapper. - -'awk_bool_t (*can_take_file)(const awk_output_buf_t *outbuf);' - This points to a function that examines the information in the - 'awk_output_buf_t' structure pointed to by 'outbuf'. It should - return true if the output wrapper wants to take over the file, and - false otherwise. It should not change any state (variable values, - etc.) within 'gawk'. - -'awk_bool_t (*take_control_of)(awk_output_buf_t *outbuf);' - The function pointed to by this field is called when 'gawk' decides - to let the output wrapper take control of the file. It should fill - in appropriate members of the 'awk_output_buf_t' structure, as - described next, and return true if successful, false otherwise. - -'awk_const struct output_wrapper *awk_const next;' - This is for use by 'gawk'; therefore it is marked 'awk_const' so - that the extension cannot modify it. - - The 'awk_output_buf_t' structure looks like this: - - typedef struct awk_output_buf { - const char *name; /* name of output file */ - const char *mode; /* mode argument to fopen */ - FILE *fp; /* stdio file pointer */ - awk_bool_t redirected; /* true if a wrapper is active */ - void *opaque; /* for use by output wrapper */ - size_t (*gawk_fwrite)(const void *buf, size_t size, size_t count, - FILE *fp, void *opaque); - int (*gawk_fflush)(FILE *fp, void *opaque); - int (*gawk_ferror)(FILE *fp, void *opaque); - int (*gawk_fclose)(FILE *fp, void *opaque); - } awk_output_buf_t; - - Here too, your extension will define 'XXX_can_take_file()' and -'XXX_take_control_of()' functions that examine and update data members -in the 'awk_output_buf_t'. The data members are as follows: - -'const char *name;' - The name of the output file. - -'const char *mode;' - The mode string (as would be used in the second argument to - 'fopen()') with which the file was opened. - -'FILE *fp;' - The 'FILE' pointer from '<stdio.h>'. 'gawk' opens the file before - attempting to find an output wrapper. - -'awk_bool_t redirected;' - This field must be set to true by the 'XXX_take_control_of()' - function. - -'void *opaque;' - This pointer is opaque to 'gawk'. The extension should use it to - store a pointer to any private data associated with the file. - -'size_t (*gawk_fwrite)(const void *buf, size_t size, size_t count,' -' FILE *fp, void *opaque);' -'int (*gawk_fflush)(FILE *fp, void *opaque);' -'int (*gawk_ferror)(FILE *fp, void *opaque);' -'int (*gawk_fclose)(FILE *fp, void *opaque);' - These pointers should be set to point to functions that perform the - equivalent function as the '<stdio.h>' functions do, if - appropriate. 'gawk' uses these function pointers for all output. - 'gawk' initializes the pointers to point to internal "pass-through" - functions that just call the regular '<stdio.h>' functions, so an - extension only needs to redefine those functions that are - appropriate for what it does. - - The 'XXX_can_take_file()' function should make a decision based upon -the 'name' and 'mode' fields, and any additional state (such as 'awk' -variable values) that is appropriate. - - When 'gawk' calls 'XXX_take_control_of()', that function should fill -in the other fields as appropriate, except for 'fp', which it should -just use normally. - - You register your output wrapper with the following function: - -'void register_output_wrapper(awk_output_wrapper_t *output_wrapper);' - Register the output wrapper pointed to by 'output_wrapper' with - 'gawk'. - - -File: gawk.info, Node: Two-way processors, Prev: Output Wrappers, Up: Registration Functions - -16.4.5.6 Customized Two-way Processors -...................................... - -A "two-way processor" combines an input parser and an output wrapper for -two-way I/O with the '|&' operator (*note Redirection::). It makes -identical use of the 'awk_input_parser_t' and 'awk_output_buf_t' -structures as described earlier. - - A two-way processor is represented by the following structure: - - typedef struct awk_two_way_processor { - const char *name; /* name of the two-way processor */ - awk_bool_t (*can_take_two_way)(const char *name); - awk_bool_t (*take_control_of)(const char *name, - awk_input_buf_t *inbuf, - awk_output_buf_t *outbuf); - awk_const struct awk_two_way_processor *awk_const next; /* for gawk */ - } awk_two_way_processor_t; - - The fields are as follows: - -'const char *name;' - The name of the two-way processor. - -'awk_bool_t (*can_take_two_way)(const char *name);' - The function pointed to by this field should return true if it - wants to take over two-way I/O for this file name. It should not - change any state (variable values, etc.) within 'gawk'. - -'awk_bool_t (*take_control_of)(const char *name,' -' awk_input_buf_t *inbuf,' -' awk_output_buf_t *outbuf);' - The function pointed to by this field should fill in the - 'awk_input_buf_t' and 'awk_output_buf_t' structures pointed to by - 'inbuf' and 'outbuf', respectively. These structures were - described earlier. - -'awk_const struct two_way_processor *awk_const next;' - This is for use by 'gawk'; therefore it is marked 'awk_const' so - that the extension cannot modify it. - - As with the input parser and output processor, you provide "yes I can -take this" and "take over for this" functions, 'XXX_can_take_two_way()' -and 'XXX_take_control_of()'. - - You register your two-way processor with the following function: - -'void register_two_way_processor(awk_two_way_processor_t *two_way_processor);' - Register the two-way processor pointed to by 'two_way_processor' - with 'gawk'. - - -File: gawk.info, Node: Printing Messages, Next: Updating ERRNO, Prev: Registration Functions, Up: Extension API Description - -16.4.6 Printing Messages ------------------------- - -You can print different kinds of warning messages from your extension, -as described here. Note that for these functions, you must pass in the -extension ID received from 'gawk' when the extension was loaded:(1) - -'void fatal(awk_ext_id_t id, const char *format, ...);' - Print a message and then cause 'gawk' to exit immediately. - -'void nonfatal(awk_ext_id_t id, const char *format, ...);' - Print a nonfatal error message. - -'void warning(awk_ext_id_t id, const char *format, ...);' - Print a warning message. - -'void lintwarn(awk_ext_id_t id, const char *format, ...);' - Print a "lint warning." Normally this is the same as printing a - warning message, but if 'gawk' was invoked with '--lint=fatal', - then lint warnings become fatal error messages. - - All of these functions are otherwise like the C 'printf()' family of -functions, where the 'format' parameter is a string with literal -characters and formatting codes intermixed. - - ---------- Footnotes ---------- - - (1) Because the API uses only ISO C 90 features, it cannot make use -of the ISO C 99 variadic macro feature to hide that parameter. More's -the pity. - - -File: gawk.info, Node: Updating ERRNO, Next: Requesting Values, Prev: Printing Messages, Up: Extension API Description - -16.4.7 Updating 'ERRNO' ------------------------ - -The following functions allow you to update the 'ERRNO' variable: - -'void update_ERRNO_int(int errno_val);' - Set 'ERRNO' to the string equivalent of the error code in - 'errno_val'. The value should be one of the defined error codes in - '<errno.h>', and 'gawk' turns it into a (possibly translated) - string using the C 'strerror()' function. - -'void update_ERRNO_string(const char *string);' - Set 'ERRNO' directly to the string value of 'ERRNO'. 'gawk' makes - a copy of the value of 'string'. - -'void unset_ERRNO(void);' - Unset 'ERRNO'. - - -File: gawk.info, Node: Requesting Values, Next: Accessing Parameters, Prev: Updating ERRNO, Up: Extension API Description - -16.4.8 Requesting Values ------------------------- - -All of the functions that return values from 'gawk' work in the same -way. You pass in an 'awk_valtype_t' value to indicate what kind of -value you expect. If the actual value matches what you requested, the -function returns true and fills in the 'awk_value_t' result. Otherwise, -the function returns false, and the 'val_type' member indicates the type -of the actual value. You may then print an error message or reissue the -request for the actual value type, as appropriate. This behavior is -summarized in *note Table 16.1: table-value-types-returned. - - Type of Actual Value --------------------------------------------------------------------------- - String Number Array Undefined ------------------------------------------------------------------------------- - String String String False False - Number Number if Number False False - can be - converted, - else false -Type Array False False Array False -Requested Scalar Scalar Scalar False False - Undefined String Number Array Undefined - Value False False False False - cookie - -Table 16.1: API value types returned - - -File: gawk.info, Node: Accessing Parameters, Next: Symbol Table Access, Prev: Requesting Values, Up: Extension API Description - -16.4.9 Accessing and Updating Parameters ----------------------------------------- - -Two functions give you access to the arguments (parameters) passed to -your extension function. They are: - -'awk_bool_t get_argument(size_t count,' -' awk_valtype_t wanted,' -' awk_value_t *result);' - Fill in the 'awk_value_t' structure pointed to by 'result' with the - 'count'th argument. Return true if the actual type matches - 'wanted', and false otherwise. In the latter case, - 'result->val_type' indicates the actual type (*note Table 16.1: - table-value-types-returned.). Counts are zero-based--the first - argument is numbered zero, the second one, and so on. 'wanted' - indicates the type of value expected. - -'awk_bool_t set_argument(size_t count, awk_array_t array);' - Convert a parameter that was undefined into an array; this provides - call by reference for arrays. Return false if 'count' is too big, - or if the argument's type is not undefined. *Note Array - Manipulation:: for more information on creating arrays. - - -File: gawk.info, Node: Symbol Table Access, Next: Array Manipulation, Prev: Accessing Parameters, Up: Extension API Description - -16.4.10 Symbol Table Access ---------------------------- - -Two sets of routines provide access to global variables, and one set -allows you to create and release cached values. - -* Menu: - -* Symbol table by name:: Accessing variables by name. -* Symbol table by cookie:: Accessing variables by "cookie". -* Cached values:: Creating and using cached values. - - -File: gawk.info, Node: Symbol table by name, Next: Symbol table by cookie, Up: Symbol Table Access - -16.4.10.1 Variable Access and Update by Name -............................................ - -The following routines provide the ability to access and update global -'awk'-level variables by name. In compiler terminology, identifiers of -different kinds are termed "symbols", thus the "sym" in the routines' -names. The data structure that stores information about symbols is -termed a "symbol table". The functions are as follows: - -'awk_bool_t sym_lookup(const char *name,' -' awk_valtype_t wanted,' -' awk_value_t *result);' - Fill in the 'awk_value_t' structure pointed to by 'result' with the - value of the variable named by the string 'name', which is a - regular C string. 'wanted' indicates the type of value expected. - Return true if the actual type matches 'wanted', and false - otherwise. In the latter case, 'result->val_type' indicates the - actual type (*note Table 16.1: table-value-types-returned.). - -'awk_bool_t sym_update(const char *name, awk_value_t *value);' - Update the variable named by the string 'name', which is a regular - C string. The variable is added to 'gawk''s symbol table if it is - not there. Return true if everything worked, and false otherwise. - - Changing types (scalar to array or vice versa) of an existing - variable is _not_ allowed, nor may this routine be used to update - an array. This routine cannot be used to update any of the - predefined variables (such as 'ARGC' or 'NF'). - - An extension can look up the value of 'gawk''s special variables. -However, with the exception of the 'PROCINFO' array, an extension cannot -change any of those variables. - - CAUTION: It is possible for the lookup of 'PROCINFO' to fail. This - happens if the 'awk' program being run does not reference - 'PROCINFO'; in this case, 'gawk' doesn't bother to create the array - and populate it. - - -File: gawk.info, Node: Symbol table by cookie, Next: Cached values, Prev: Symbol table by name, Up: Symbol Table Access - -16.4.10.2 Variable Access and Update by Cookie -.............................................. - -A "scalar cookie" is an opaque handle that provides access to a global -variable or array. It is an optimization that avoids looking up -variables in 'gawk''s symbol table every time access is needed. This -was discussed earlier, in *note General Data Types::. - - The following functions let you work with scalar cookies: - -'awk_bool_t sym_lookup_scalar(awk_scalar_t cookie,' -' awk_valtype_t wanted,' -' awk_value_t *result);' - Retrieve the current value of a scalar cookie. Once you have - obtained a scalar cookie using 'sym_lookup()', you can use this - function to get its value more efficiently. Return false if the - value cannot be retrieved. - -'awk_bool_t sym_update_scalar(awk_scalar_t cookie, awk_value_t *value);' - Update the value associated with a scalar cookie. Return false if - the new value is not of type 'AWK_STRING' or 'AWK_NUMBER'. Here - too, the predefined variables may not be updated. - - It is not obvious at first glance how to work with scalar cookies or -what their raison d'e^tre really is. In theory, the 'sym_lookup()' and -'sym_update()' routines are all you really need to work with variables. -For example, you might have code that looks up the value of a variable, -evaluates a condition, and then possibly changes the value of the -variable based on the result of that evaluation, like so: - - /* do_magic --- do something really great */ - - static awk_value_t * - do_magic(int nargs, awk_value_t *result) - { - awk_value_t value; - - if ( sym_lookup("MAGIC_VAR", AWK_NUMBER, & value) - && some_condition(value.num_value)) { - value.num_value += 42; - sym_update("MAGIC_VAR", & value); - } - - return make_number(0.0, result); - } - -This code looks (and is) simple and straightforward. So what's the -problem? - - Well, consider what happens if 'awk'-level code associated with your -extension calls the 'magic()' function (implemented in C by -'do_magic()'), once per record, while processing hundreds of thousands -or millions of records. The 'MAGIC_VAR' variable is looked up in the -symbol table once or twice per function call! - - The symbol table lookup is really pure overhead; it is considerably -more efficient to get a cookie that represents the variable, and use -that to get the variable's value and update it as needed.(1) - - Thus, the way to use cookies is as follows. First, install your -extension's variable in 'gawk''s symbol table using 'sym_update()', as -usual. Then get a scalar cookie for the variable using 'sym_lookup()': - - static awk_scalar_t magic_var_cookie; /* cookie for MAGIC_VAR */ - - static void - my_extension_init() - { - awk_value_t value; - - /* install initial value */ - sym_update("MAGIC_VAR", make_number(42.0, & value)); - - /* get the cookie */ - sym_lookup("MAGIC_VAR", AWK_SCALAR, & value); - - /* save the cookie */ - magic_var_cookie = value.scalar_cookie; - ... - } - - Next, use the routines in this minor node for retrieving and updating -the value through the cookie. Thus, 'do_magic()' now becomes something -like this: - - /* do_magic --- do something really great */ - - static awk_value_t * - do_magic(int nargs, awk_value_t *result) - { - awk_value_t value; - - if ( sym_lookup_scalar(magic_var_cookie, AWK_NUMBER, & value) - && some_condition(value.num_value)) { - value.num_value += 42; - sym_update_scalar(magic_var_cookie, & value); - } - ... - - return make_number(0.0, result); - } - - NOTE: The previous code omitted error checking for presentation - purposes. Your extension code should be more robust and carefully - check the return values from the API functions. - - ---------- Footnotes ---------- - - (1) The difference is measurable and quite real. Trust us. - - -File: gawk.info, Node: Cached values, Prev: Symbol table by cookie, Up: Symbol Table Access - -16.4.10.3 Creating and Using Cached Values -.......................................... - -The routines in this minor node allow you to create and release cached -values. Like scalar cookies, in theory, cached values are not -necessary. You can create numbers and strings using the functions in -*note Constructor Functions::. You can then assign those values to -variables using 'sym_update()' or 'sym_update_scalar()', as you like. - - However, you can understand the point of cached values if you -remember that _every_ string value's storage _must_ come from -'gawk_malloc()', 'gawk_calloc()', or 'gawk_realloc()'. If you have 20 -variables, all of which have the same string value, you must create 20 -identical copies of the string.(1) - - It is clearly more efficient, if possible, to create a value once, -and then tell 'gawk' to reuse the value for multiple variables. That is -what the routines in this minor node let you do. The functions are as -follows: - -'awk_bool_t create_value(awk_value_t *value, awk_value_cookie_t *result);' - Create a cached string or numeric value from 'value' for efficient - later assignment. Only values of type 'AWK_NUMBER' and - 'AWK_STRING' are allowed. Any other type is rejected. - 'AWK_UNDEFINED' could be allowed, but doing so would result in - inferior performance. - -'awk_bool_t release_value(awk_value_cookie_t vc);' - Release the memory associated with a value cookie obtained from - 'create_value()'. - - You use value cookies in a fashion similar to the way you use scalar -cookies. In the extension initialization routine, you create the value -cookie: - - static awk_value_cookie_t answer_cookie; /* static value cookie */ - - static void - my_extension_init() - { - awk_value_t value; - char *long_string; - size_t long_string_len; - - /* code from earlier */ - ... - /* ... fill in long_string and long_string_len ... */ - make_malloced_string(long_string, long_string_len, & value); - create_value(& value, & answer_cookie); /* create cookie */ - ... - } - - Once the value is created, you can use it as the value of any number -of variables: - - static awk_value_t * - do_magic(int nargs, awk_value_t *result) - { - awk_value_t new_value; - - ... /* as earlier */ - - value.val_type = AWK_VALUE_COOKIE; - value.value_cookie = answer_cookie; - sym_update("VAR1", & value); - sym_update("VAR2", & value); - ... - sym_update("VAR100", & value); - ... - } - -Using value cookies in this way saves considerable storage, as all of -'VAR1' through 'VAR100' share the same value. - - You might be wondering, "Is this sharing problematic? What happens -if 'awk' code assigns a new value to 'VAR1'; are all the others changed -too?" - - That's a great question. The answer is that no, it's not a problem. -Internally, 'gawk' uses "reference-counted strings". This means that -many variables can share the same string value, and 'gawk' keeps track -of the usage. When a variable's value changes, 'gawk' simply decrements -the reference count on the old value and updates the variable to use the -new value. - - Finally, as part of your cleanup action (*note Exit Callback -Functions::) you should release any cached values that you created, -using 'release_value()'. - - ---------- Footnotes ---------- - - (1) Numeric values are clearly less problematic, requiring only a C -'double' to store. - - -File: gawk.info, Node: Array Manipulation, Next: Redirection API, Prev: Symbol Table Access, Up: Extension API Description - -16.4.11 Array Manipulation --------------------------- - -The primary data structure(1) in 'awk' is the associative array (*note -Arrays::). Extensions need to be able to manipulate 'awk' arrays. The -API provides a number of data structures for working with arrays, -functions for working with individual elements, and functions for -working with arrays as a whole. This includes the ability to "flatten" -an array so that it is easy for C code to traverse every element in an -array. The array data structures integrate nicely with the data -structures for values to make it easy to both work with and create true -arrays of arrays (*note General Data Types::). - -* Menu: - -* Array Data Types:: Data types for working with arrays. -* Array Functions:: Functions for working with arrays. -* Flattening Arrays:: How to flatten arrays. -* Creating Arrays:: How to create and populate arrays. - - ---------- Footnotes ---------- - - (1) OK, the only data structure. - - -File: gawk.info, Node: Array Data Types, Next: Array Functions, Up: Array Manipulation - -16.4.11.1 Array Data Types -.......................... - -The data types associated with arrays are as follows: - -'typedef void *awk_array_t;' - If you request the value of an array variable, you get back an - 'awk_array_t' value. This value is opaque(1) to the extension; it - uniquely identifies the array but can only be used by passing it - into API functions or receiving it from API functions. This is - very similar to way 'FILE *' values are used with the '<stdio.h>' - library routines. - -'typedef struct awk_element {' -' /* convenience linked list pointer, not used by gawk */' -' struct awk_element *next;' -' enum {' -' AWK_ELEMENT_DEFAULT = 0, /* set by gawk */' -' AWK_ELEMENT_DELETE = 1 /* set by extension */' -' } flags;' -' awk_value_t index;' -' awk_value_t value;' -'} awk_element_t;' - The 'awk_element_t' is a "flattened" array element. 'awk' produces - an array of these inside the 'awk_flat_array_t' (see the next - item). Individual elements may be marked for deletion. New - elements must be added individually, one at a time, using the - separate API for that purpose. The fields are as follows: - - 'struct awk_element *next;' - This pointer is for the convenience of extension writers. It - allows an extension to create a linked list of new elements - that can then be added to an array in a loop that traverses - the list. - - 'enum { ... } flags;' - A set of flag values that convey information between the - extension and 'gawk'. Currently there is only one: - 'AWK_ELEMENT_DELETE'. Setting it causes 'gawk' to delete the - element from the original array upon release of the flattened - array. - - 'index' - 'value' - The index and value of the element, respectively. _All_ - memory pointed to by 'index' and 'value' belongs to 'gawk'. - -'typedef struct awk_flat_array {' -' awk_const void *awk_const opaque1; /* for use by gawk */' -' awk_const void *awk_const opaque2; /* for use by gawk */' -' awk_const size_t count; /* how many elements */' -' awk_element_t elements[1]; /* will be extended */' -'} awk_flat_array_t;' - This is a flattened array. When an extension gets one of these - from 'gawk', the 'elements' array is of actual size 'count'. The - 'opaque1' and 'opaque2' pointers are for use by 'gawk'; therefore - they are marked 'awk_const' so that the extension cannot modify - them. - - ---------- Footnotes ---------- - - (1) It is also a "cookie," but the 'gawk' developers did not wish to -overuse this term. - - -File: gawk.info, Node: Array Functions, Next: Flattening Arrays, Prev: Array Data Types, Up: Array Manipulation - -16.4.11.2 Array Functions -......................... - -The following functions relate to individual array elements: - -'awk_bool_t get_element_count(awk_array_t a_cookie, size_t *count);' - For the array represented by 'a_cookie', place in '*count' the - number of elements it contains. A subarray counts as a single - element. Return false if there is an error. - -'awk_bool_t get_array_element(awk_array_t a_cookie,' -' const awk_value_t *const index,' -' awk_valtype_t wanted,' -' awk_value_t *result);' - For the array represented by 'a_cookie', return in '*result' the - value of the element whose index is 'index'. 'wanted' specifies - the type of value you wish to retrieve. Return false if 'wanted' - does not match the actual type or if 'index' is not in the array - (*note Table 16.1: table-value-types-returned.). - - The value for 'index' can be numeric, in which case 'gawk' converts - it to a string. Using nonintegral values is possible, but requires - that you understand how such values are converted to strings (*note - Conversion::); thus, using integral values is safest. - - As with _all_ strings passed into 'gawk' from an extension, the - string value of 'index' must come from 'gawk_malloc()', - 'gawk_calloc()', or 'gawk_realloc()', and 'gawk' releases the - storage. - -'awk_bool_t set_array_element(awk_array_t a_cookie,' -' const awk_value_t *const index,' -' const awk_value_t *const value);' - In the array represented by 'a_cookie', create or modify the - element whose index is given by 'index'. The 'ARGV' and 'ENVIRON' - arrays may not be changed, although the 'PROCINFO' array can be. - -'awk_bool_t set_array_element_by_elem(awk_array_t a_cookie,' -' awk_element_t element);' - Like 'set_array_element()', but take the 'index' and 'value' from - 'element'. This is a convenience macro. - -'awk_bool_t del_array_element(awk_array_t a_cookie,' -' const awk_value_t* const index);' - Remove the element with the given index from the array represented - by 'a_cookie'. Return true if the element was removed, or false if - the element did not exist in the array. - - The following functions relate to arrays as a whole: - -'awk_array_t create_array(void);' - Create a new array to which elements may be added. *Note Creating - Arrays:: for a discussion of how to create a new array and add - elements to it. - -'awk_bool_t clear_array(awk_array_t a_cookie);' - Clear the array represented by 'a_cookie'. Return false if there - was some kind of problem, true otherwise. The array remains an - array, but after calling this function, it has no elements. This - is equivalent to using the 'delete' statement (*note Delete::). - -'awk_bool_t flatten_array(awk_array_t a_cookie, awk_flat_array_t **data);' - For the array represented by 'a_cookie', create an - 'awk_flat_array_t' structure and fill it in. Set the pointer whose - address is passed as 'data' to point to this structure. Return - true upon success, or false otherwise. *Note Flattening Arrays::, - for a discussion of how to flatten an array and work with it. - -'awk_bool_t release_flattened_array(awk_array_t a_cookie,' -' awk_flat_array_t *data);' - When done with a flattened array, release the storage using this - function. You must pass in both the original array cookie and the - address of the created 'awk_flat_array_t' structure. The function - returns true upon success, false otherwise. - - -File: gawk.info, Node: Flattening Arrays, Next: Creating Arrays, Prev: Array Functions, Up: Array Manipulation - -16.4.11.3 Working With All The Elements of an Array -................................................... - -To "flatten" an array is to create a structure that represents the full -array in a fashion that makes it easy for C code to traverse the entire -array. Some of the code in 'extension/testext.c' does this, and also -serves as a nice example showing how to use the APIs. - - We walk through that part of the code one step at a time. First, the -'gawk' script that drives the test extension: - - @load "testext" - BEGIN { - n = split("blacky rusty sophie raincloud lucky", pets) - printf("pets has %d elements\n", length(pets)) - ret = dump_array_and_delete("pets", "3") - printf("dump_array_and_delete(pets) returned %d\n", ret) - if ("3" in pets) - printf("dump_array_and_delete() did NOT remove index \"3\"!\n") - else - printf("dump_array_and_delete() did remove index \"3\"!\n") - print "" - } - -This code creates an array with 'split()' (*note String Functions::) and -then calls 'dump_array_and_delete()'. That function looks up the array -whose name is passed as the first argument, and deletes the element at -the index passed in the second argument. The 'awk' code then prints the -return value and checks if the element was indeed deleted. Here is the -C code that implements 'dump_array_and_delete()'. It has been edited -slightly for presentation. - - The first part declares variables, sets up the default return value -in 'result', and checks that the function was called with the correct -number of arguments: - - static awk_value_t * - dump_array_and_delete(int nargs, awk_value_t *result) - { - awk_value_t value, value2, value3; - awk_flat_array_t *flat_array; - size_t count; - char *name; - int i; - - assert(result != NULL); - make_number(0.0, result); - - if (nargs != 2) { - printf("dump_array_and_delete: nargs not right " - "(%d should be 2)\n", nargs); - goto out; - } - - The function then proceeds in steps, as follows. First, retrieve the -name of the array, passed as the first argument, followed by the array -itself. If either operation fails, print an error message and return: - - /* get argument named array as flat array and print it */ - if (get_argument(0, AWK_STRING, & value)) { - name = value.str_value.str; - if (sym_lookup(name, AWK_ARRAY, & value2)) - printf("dump_array_and_delete: sym_lookup of %s passed\n", - name); - else { - printf("dump_array_and_delete: sym_lookup of %s failed\n", - name); - goto out; - } - } else { - printf("dump_array_and_delete: get_argument(0) failed\n"); - goto out; - } - - For testing purposes and to make sure that the C code sees the same -number of elements as the 'awk' code, the second step is to get the -count of elements in the array and print it: - - if (! get_element_count(value2.array_cookie, & count)) { - printf("dump_array_and_delete: get_element_count failed\n"); - goto out; - } - - printf("dump_array_and_delete: incoming size is %lu\n", - (unsigned long) count); - - The third step is to actually flatten the array, and then to -double-check that the count in the 'awk_flat_array_t' is the same as the -count just retrieved: - - if (! flatten_array(value2.array_cookie, & flat_array)) { - printf("dump_array_and_delete: could not flatten array\n"); - goto out; - } - - if (flat_array->count != count) { - printf("dump_array_and_delete: flat_array->count (%lu)" - " != count (%lu)\n", - (unsigned long) flat_array->count, - (unsigned long) count); - goto out; - } - - The fourth step is to retrieve the index of the element to be -deleted, which was passed as the second argument. Remember that -argument counts passed to 'get_argument()' are zero-based, and thus the -second argument is numbered one: - - if (! get_argument(1, AWK_STRING, & value3)) { - printf("dump_array_and_delete: get_argument(1) failed\n"); - goto out; - } - - The fifth step is where the "real work" is done. The function loops -over every element in the array, printing the index and element values. -In addition, upon finding the element with the index that is supposed to -be deleted, the function sets the 'AWK_ELEMENT_DELETE' bit in the -'flags' field of the element. When the array is released, 'gawk' -traverses the flattened array, and deletes any elements that have this -flag bit set: - - for (i = 0; i < flat_array->count; i++) { - printf("\t%s[\"%.*s\"] = %s\n", - name, - (int) flat_array->elements[i].index.str_value.len, - flat_array->elements[i].index.str_value.str, - valrep2str(& flat_array->elements[i].value)); - - if (strcmp(value3.str_value.str, - flat_array->elements[i].index.str_value.str) == 0) { - flat_array->elements[i].flags |= AWK_ELEMENT_DELETE; - printf("dump_array_and_delete: marking element \"%s\" " - "for deletion\n", - flat_array->elements[i].index.str_value.str); - } - } - - The sixth step is to release the flattened array. This tells 'gawk' -that the extension is no longer using the array, and that it should -delete any elements marked for deletion. 'gawk' also frees any storage -that was allocated, so you should not use the pointer ('flat_array' in -this code) once you have called 'release_flattened_array()': - - if (! release_flattened_array(value2.array_cookie, flat_array)) { - printf("dump_array_and_delete: could not release flattened array\n"); - goto out; - } - - Finally, because everything was successful, the function sets the -return value to success, and returns: - - make_number(1.0, result); - out: - return result; - } - - Here is the output from running this part of the test: - - pets has 5 elements - dump_array_and_delete: sym_lookup of pets passed - dump_array_and_delete: incoming size is 5 - pets["1"] = "blacky" - pets["2"] = "rusty" - pets["3"] = "sophie" - dump_array_and_delete: marking element "3" for deletion - pets["4"] = "raincloud" - pets["5"] = "lucky" - dump_array_and_delete(pets) returned 1 - dump_array_and_delete() did remove index "3"! - - -File: gawk.info, Node: Creating Arrays, Prev: Flattening Arrays, Up: Array Manipulation - -16.4.11.4 How To Create and Populate Arrays -........................................... - -Besides working with arrays created by 'awk' code, you can create arrays -and populate them as you see fit, and then 'awk' code can access them -and manipulate them. - - There are two important points about creating arrays from extension -code: - - * You must install a new array into 'gawk''s symbol table immediately - upon creating it. Once you have done so, you can then populate the - array. - - Similarly, if installing a new array as a subarray of an existing - array, you must add the new array to its parent before adding any - elements to it. - - Thus, the correct way to build an array is to work "top down." - Create the array, and immediately install it in 'gawk''s symbol - table using 'sym_update()', or install it as an element in a - previously existing array using 'set_array_element()'. We show - example code shortly. - - * Due to 'gawk' internals, after using 'sym_update()' to install an - array into 'gawk', you have to retrieve the array cookie from the - value passed in to 'sym_update()' before doing anything else with - it, like so: - - awk_value_t val; - awk_array_t new_array; - - new_array = create_array(); - val.val_type = AWK_ARRAY; - val.array_cookie = new_array; - - /* install array in the symbol table */ - sym_update("array", & val); - - new_array = val.array_cookie; /* YOU MUST DO THIS */ - - If installing an array as a subarray, you must also retrieve the - value of the array cookie after the call to 'set_element()'. - - The following C code is a simple test extension to create an array -with two regular elements and with a subarray. The leading '#include' -directives and boilerplate variable declarations (*note Extension API -Boilerplate::) are omitted for brevity. The first step is to create a -new array and then install it in the symbol table: - - /* create_new_array --- create a named array */ - - static void - create_new_array() - { - awk_array_t a_cookie; - awk_array_t subarray; - awk_value_t index, value; - - a_cookie = create_array(); - value.val_type = AWK_ARRAY; - value.array_cookie = a_cookie; - - if (! sym_update("new_array", & value)) - printf("create_new_array: sym_update(\"new_array\") failed!\n"); - a_cookie = value.array_cookie; - -Note how 'a_cookie' is reset from the 'array_cookie' field in the -'value' structure. - - The second step is to install two regular values into 'new_array': - - (void) make_const_string("hello", 5, & index); - (void) make_const_string("world", 5, & value); - if (! set_array_element(a_cookie, & index, & value)) { - printf("fill_in_array: set_array_element failed\n"); - return; - } - - (void) make_const_string("answer", 6, & index); - (void) make_number(42.0, & value); - if (! set_array_element(a_cookie, & index, & value)) { - printf("fill_in_array: set_array_element failed\n"); - return; - } - - The third step is to create the subarray and install it: - - (void) make_const_string("subarray", 8, & index); - subarray = create_array(); - value.val_type = AWK_ARRAY; - value.array_cookie = subarray; - if (! set_array_element(a_cookie, & index, & value)) { - printf("fill_in_array: set_array_element failed\n"); - return; - } - subarray = value.array_cookie; - - The final step is to populate the subarray with its own element: - - (void) make_const_string("foo", 3, & index); - (void) make_const_string("bar", 3, & value); - if (! set_array_element(subarray, & index, & value)) { - printf("fill_in_array: set_array_element failed\n"); - return; - } - } - - Here is a sample script that loads the extension and then dumps the -array: - - @load "subarray" - - function dumparray(name, array, i) - { - for (i in array) - if (isarray(array[i])) - dumparray(name "[\"" i "\"]", array[i]) - else - printf("%s[\"%s\"] = %s\n", name, i, array[i]) - } - - BEGIN { - dumparray("new_array", new_array); - } - - Here is the result of running the script: - - $ AWKLIBPATH=$PWD ./gawk -f subarray.awk - -| new_array["subarray"]["foo"] = bar - -| new_array["hello"] = world - -| new_array["answer"] = 42 - -(*Note Finding Extensions:: for more information on the 'AWKLIBPATH' -environment variable.) - - -File: gawk.info, Node: Redirection API, Next: Extension API Variables, Prev: Array Manipulation, Up: Extension API Description - -16.4.12 Accessing and Manipulating Redirections ------------------------------------------------ - -The following function allows extensions to access and manipulate -redirections. - -'awk_bool_t get_file(const char *name,' -' size_t name_len,' -' const char *filetype,' -' int fd,' -' const awk_input_buf_t **ibufp,' -' const awk_output_buf_t **obufp);' - Look up a file in 'gawk''s internal redirection table. If 'name' - is 'NULL' or 'name_len' is zero, return data for the currently open - input file corresponding to 'FILENAME'. (This does not access the - 'filetype' argument, so that may be undefined). If the file is not - already open, attempt to open it. The 'filetype' argument must be - zero-terminated and should be one of: - - '">"' - A file opened for output. - - '">>"' - A file opened for append. - - '"<"' - A file opened for input. - - '"|>"' - A pipe opened for output. - - '"|<"' - A pipe opened for input. - - '"|&"' - A two-way coprocess. - - On error, return a 'false' value. Otherwise, return 'true', and - return additional information about the redirection in the 'ibufp' - and 'obufp' pointers. For input redirections, the '*ibufp' value - should be non-'NULL', and '*obufp' should be 'NULL'. For output - redirections, the '*obufp' value should be non-'NULL', and '*ibufp' - should be 'NULL'. For two-way coprocesses, both values should be - non-'NULL'. - - In the usual case, the extension is interested in '(*ibufp)->fd' - and/or 'fileno((*obufp)->fp)'. If the file is not already open, - and the 'fd' argument is non-negative, 'gawk' will use that file - descriptor instead of opening the file in the usual way. If 'fd' - is non-negative, but the file exists already, 'gawk' ignores 'fd' - and returns the existing file. It is the caller's responsibility - to notice that neither the 'fd' in the returned 'awk_input_buf_t' - nor the 'fd' in the returned 'awk_output_buf_t' matches the - requested value. - - Note that supplying a file descriptor is currently _not_ supported - for pipes. However, supplying a file descriptor should work for - input, output, append, and two-way (coprocess) sockets. If - 'filetype' is two-way, 'gawk' assumes that it is a socket! Note - that in the two-way case, the input and output file descriptors may - differ. To check for success, you must check whether either - matches. - - It is anticipated that this API function will be used to implement -I/O multiplexing and a socket library. - - -File: gawk.info, Node: Extension API Variables, Next: Extension API Boilerplate, Prev: Redirection API, Up: Extension API Description - -16.4.13 API Variables ---------------------- - -The API provides two sets of variables. The first provides information -about the version of the API (both with which the extension was -compiled, and with which 'gawk' was compiled). The second provides -information about how 'gawk' was invoked. - -* Menu: - -* Extension Versioning:: API Version information. -* Extension API Informational Variables:: Variables providing information about - 'gawk''s invocation. - - -File: gawk.info, Node: Extension Versioning, Next: Extension API Informational Variables, Up: Extension API Variables - -16.4.13.1 API Version Constants and Variables -............................................. - -The API provides both a "major" and a "minor" version number. The API -versions are available at compile time as C preprocessor defines to -support conditional compilation, and as enum constants to facilitate -debugging: - -API Version C preprocessor define enum constant ---------------------------------------------------------------------------- -Major gawk_api_major_version GAWK_API_MAJOR_VERSION -Minor gawk_api_minor_version GAWK_API_MINOR_VERSION - -Table 16.2: gawk API version constants - - The minor version increases when new functions are added to the API. -Such new functions are always added to the end of the API 'struct'. - - The major version increases (and the minor version is reset to zero) -if any of the data types change size or member order, or if any of the -existing functions change signature. - - It could happen that an extension may be compiled against one version -of the API but loaded by a version of 'gawk' using a different version. -For this reason, the major and minor API versions of the running 'gawk' -are included in the API 'struct' as read-only constant integers: - -'api->major_version' - The major version of the running 'gawk' - -'api->minor_version' - The minor version of the running 'gawk' - - It is up to the extension to decide if there are API -incompatibilities. Typically, a check like this is enough: - - if (api->major_version != GAWK_API_MAJOR_VERSION - || api->minor_version < GAWK_API_MINOR_VERSION) { - fprintf(stderr, "foo_extension: version mismatch with gawk!\n"); - fprintf(stderr, "\tmy version (%d, %d), gawk version (%d, %d)\n", - GAWK_API_MAJOR_VERSION, GAWK_API_MINOR_VERSION, - api->major_version, api->minor_version); - exit(1); - } - - Such code is included in the boilerplate 'dl_load_func()' macro -provided in 'gawkapi.h' (discussed in *note Extension API -Boilerplate::). - - -File: gawk.info, Node: Extension API Informational Variables, Prev: Extension Versioning, Up: Extension API Variables - -16.4.13.2 Informational Variables -................................. - -The API provides access to several variables that describe whether the -corresponding command-line options were enabled when 'gawk' was invoked. -The variables are: - -'do_debug' - This variable is true if 'gawk' was invoked with '--debug' option. - -'do_lint' - This variable is true if 'gawk' was invoked with '--lint' option. - -'do_mpfr' - This variable is true if 'gawk' was invoked with '--bignum' option. - -'do_profile' - This variable is true if 'gawk' was invoked with '--profile' - option. - -'do_sandbox' - This variable is true if 'gawk' was invoked with '--sandbox' - option. - -'do_traditional' - This variable is true if 'gawk' was invoked with '--traditional' - option. - - The value of 'do_lint' can change if 'awk' code modifies the 'LINT' -predefined variable (*note Built-in Variables::). The others should not -change during execution. - - -File: gawk.info, Node: Extension API Boilerplate, Prev: Extension API Variables, Up: Extension API Description - -16.4.14 Boilerplate Code ------------------------- - -As mentioned earlier (*note Extension Mechanism Outline::), the function -definitions as presented are really macros. To use these macros, your -extension must provide a small amount of boilerplate code (variables and -functions) toward the top of your source file, using predefined names as -described here. The boilerplate needed is also provided in comments in -the 'gawkapi.h' header file: - - /* Boilerplate code: */ - int plugin_is_GPL_compatible; - - static gawk_api_t *const api; - static awk_ext_id_t ext_id; - static const char *ext_version = NULL; /* or ... = "some string" */ - - static awk_ext_func_t func_table[] = { - { "name", do_name, 1 }, - /* ... */ - }; - - /* EITHER: */ - - static awk_bool_t (*init_func)(void) = NULL; - - /* OR: */ - - static awk_bool_t - init_my_extension(void) - { - ... - } - - static awk_bool_t (*init_func)(void) = init_my_extension; - - dl_load_func(func_table, some_name, "name_space_in_quotes") - - These variables and functions are as follows: - -'int plugin_is_GPL_compatible;' - This asserts that the extension is compatible with the GNU GPL - (*note Copying::). If your extension does not have this, 'gawk' - will not load it (*note Plugin License::). - -'static gawk_api_t *const api;' - This global 'static' variable should be set to point to the - 'gawk_api_t' pointer that 'gawk' passes to your 'dl_load()' - function. This variable is used by all of the macros. - -'static awk_ext_id_t ext_id;' - This global static variable should be set to the 'awk_ext_id_t' - value that 'gawk' passes to your 'dl_load()' function. This - variable is used by all of the macros. - -'static const char *ext_version = NULL; /* or ... = "some string" */' - This global 'static' variable should be set either to 'NULL', or to - point to a string giving the name and version of your extension. - -'static awk_ext_func_t func_table[] = { ... };' - This is an array of one or more 'awk_ext_func_t' structures, as - described earlier (*note Extension Functions::). It can then be - looped over for multiple calls to 'add_ext_func()'. - -'static awk_bool_t (*init_func)(void) = NULL;' -' OR' -'static awk_bool_t init_my_extension(void) { ... }' -'static awk_bool_t (*init_func)(void) = init_my_extension;' - If you need to do some initialization work, you should define a - function that does it (creates variables, opens files, etc.) and - then define the 'init_func' pointer to point to your function. The - function should return 'awk_false' upon failure, or 'awk_true' if - everything goes well. - - If you don't need to do any initialization, define the pointer and - initialize it to 'NULL'. - -'dl_load_func(func_table, some_name, "name_space_in_quotes")' - This macro expands to a 'dl_load()' function that performs all the - necessary initializations. - - The point of all the variables and arrays is to let the 'dl_load()' -function (from the 'dl_load_func()' macro) do all the standard work. It -does the following: - - 1. Check the API versions. If the extension major version does not - match 'gawk''s, or if the extension minor version is greater than - 'gawk''s, it prints a fatal error message and exits. - - 2. Load the functions defined in 'func_table'. If any of them fails - to load, it prints a warning message but continues on. - - 3. If the 'init_func' pointer is not 'NULL', call the function it - points to. If it returns 'awk_false', print a warning message. - - 4. If 'ext_version' is not 'NULL', register the version string with - 'gawk'. - - -File: gawk.info, Node: Finding Extensions, Next: Extension Example, Prev: Extension API Description, Up: Dynamic Extensions - -16.5 How 'gawk' Finds Extensions -================================ - -Compiled extensions have to be installed in a directory where 'gawk' can -find them. If 'gawk' is configured and built in the default fashion, -the directory in which to find extensions is '/usr/local/lib/gawk'. You -can also specify a search path with a list of directories to search for -compiled extensions. *Note AWKLIBPATH Variable:: for more information. - - -File: gawk.info, Node: Extension Example, Next: Extension Samples, Prev: Finding Extensions, Up: Dynamic Extensions - -16.6 Example: Some File Functions -================================= - - No matter where you go, there you are. - -- _Buckaroo Banzai_ - - Two useful functions that are not in 'awk' are 'chdir()' (so that an -'awk' program can change its directory) and 'stat()' (so that an 'awk' -program can gather information about a file). In order to illustrate -the API in action, this minor node implements these functions for 'gawk' -in an extension. - -* Menu: - -* Internal File Description:: What the new functions will do. -* Internal File Ops:: The code for internal file operations. -* Using Internal File Ops:: How to use an external extension. - - -File: gawk.info, Node: Internal File Description, Next: Internal File Ops, Up: Extension Example - -16.6.1 Using 'chdir()' and 'stat()' ------------------------------------ - -This minor node shows how to use the new functions at the 'awk' level -once they've been integrated into the running 'gawk' interpreter. Using -'chdir()' is very straightforward. It takes one argument, the new -directory to change to: - - @load "filefuncs" - ... - newdir = "/home/arnold/funstuff" - ret = chdir(newdir) - if (ret < 0) { - printf("could not change to %s: %s\n", newdir, ERRNO) > "/dev/stderr" - exit 1 - } - ... - - The return value is negative if the 'chdir()' failed, and 'ERRNO' -(*note Built-in Variables::) is set to a string indicating the error. - - Using 'stat()' is a bit more complicated. The C 'stat()' function -fills in a structure that has a fair amount of information. The right -way to model this in 'awk' is to fill in an associative array with the -appropriate information: - - file = "/home/arnold/.profile" - ret = stat(file, fdata) - if (ret < 0) { - printf("could not stat %s: %s\n", - file, ERRNO) > "/dev/stderr" - exit 1 - } - printf("size of %s is %d bytes\n", file, fdata["size"]) - - The 'stat()' function always clears the data array, even if the -'stat()' fails. It fills in the following elements: - -'"name"' - The name of the file that was 'stat()'ed. - -'"dev"' -'"ino"' - The file's device and inode numbers, respectively. - -'"mode"' - The file's mode, as a numeric value. This includes both the file's - type and its permissions. - -'"nlink"' - The number of hard links (directory entries) the file has. - -'"uid"' -'"gid"' - The numeric user and group ID numbers of the file's owner. - -'"size"' - The size in bytes of the file. - -'"blocks"' - The number of disk blocks the file actually occupies. This may not - be a function of the file's size if the file has holes. - -'"atime"' -'"mtime"' -'"ctime"' - The file's last access, modification, and inode update times, - respectively. These are numeric timestamps, suitable for - formatting with 'strftime()' (*note Time Functions::). - -'"pmode"' - The file's "printable mode." This is a string representation of - the file's type and permissions, such as is produced by 'ls - -l'--for example, '"drwxr-xr-x"'. - -'"type"' - A printable string representation of the file's type. The value is - one of the following: - - '"blockdev"' - '"chardev"' - The file is a block or character device ("special file"). - - '"directory"' - The file is a directory. - - '"fifo"' - The file is a named pipe (also known as a FIFO). - - '"file"' - The file is just a regular file. - - '"socket"' - The file is an 'AF_UNIX' ("Unix domain") socket in the - filesystem. - - '"symlink"' - The file is a symbolic link. - -'"devbsize"' - The size of a block for the element indexed by '"blocks"'. This - information is derived from either the 'DEV_BSIZE' constant defined - in '<sys/param.h>' on most systems, or the 'S_BLKSIZE' constant in - '<sys/stat.h>' on BSD systems. For some other systems, "a priori" - knowledge is used to provide a value. Where no value can be - determined, it defaults to 512. - - Several additional elements may be present, depending upon the -operating system and the type of the file. You can test for them in -your 'awk' program by using the 'in' operator (*note Reference to -Elements::): - -'"blksize"' - The preferred block size for I/O to the file. This field is not - present on all POSIX-like systems in the C 'stat' structure. - -'"linkval"' - If the file is a symbolic link, this element is the name of the - file the link points to (i.e., the value of the link). - -'"rdev"' -'"major"' -'"minor"' - If the file is a block or character device file, then these values - represent the numeric device number and the major and minor - components of that number, respectively. - - -File: gawk.info, Node: Internal File Ops, Next: Using Internal File Ops, Prev: Internal File Description, Up: Extension Example - -16.6.2 C Code for 'chdir()' and 'stat()' ----------------------------------------- - -Here is the C code for these extensions.(1) - - The file includes a number of standard header files, and then -includes the 'gawkapi.h' header file, which provides the API -definitions. Those are followed by the necessary variable declarations -to make use of the API macros and boilerplate code (*note Extension API -Boilerplate::): - - #ifdef HAVE_CONFIG_H - #include <config.h> - #endif - - #include <stdio.h> - #include <assert.h> - #include <errno.h> - #include <stdlib.h> - #include <string.h> - #include <unistd.h> - - #include <sys/types.h> - #include <sys/stat.h> - - #include "gawkapi.h" - - #include "gettext.h" - #define _(msgid) gettext(msgid) - #define N_(msgid) msgid - - #include "gawkfts.h" - #include "stack.h" - - static const gawk_api_t *api; /* for convenience macros to work */ - static awk_ext_id_t *ext_id; - static awk_bool_t init_filefuncs(void); - static awk_bool_t (*init_func)(void) = init_filefuncs; - static const char *ext_version = "filefuncs extension: version 1.0"; - - int plugin_is_GPL_compatible; - - By convention, for an 'awk' function 'foo()', the C function that -implements it is called 'do_foo()'. The function should have two -arguments. The first is an 'int', usually called 'nargs', that -represents the number of actual arguments for the function. The second -is a pointer to an 'awk_value_t' structure, usually named 'result': - - /* do_chdir --- provide dynamically loaded chdir() function for gawk */ - - static awk_value_t * - do_chdir(int nargs, awk_value_t *result) - { - awk_value_t newdir; - int ret = -1; - - assert(result != NULL); - - if (do_lint && nargs != 1) - lintwarn(ext_id, - _("chdir: called with incorrect number of arguments, " - "expecting 1")); - - The 'newdir' variable represents the new directory to change to, -which is retrieved with 'get_argument()'. Note that the first argument -is numbered zero. - - If the argument is retrieved successfully, the function calls the -'chdir()' system call. If the 'chdir()' fails, 'ERRNO' is updated: - - if (get_argument(0, AWK_STRING, & newdir)) { - ret = chdir(newdir.str_value.str); - if (ret < 0) - update_ERRNO_int(errno); - } - - Finally, the function returns the return value to the 'awk' level: - - return make_number(ret, result); - } - - The 'stat()' extension is more involved. First comes a function that -turns a numeric mode into a printable representation (e.g., octal '0644' -becomes '-rw-r--r--'). This is omitted here for brevity: - - /* format_mode --- turn a stat mode field into something readable */ - - static char * - format_mode(unsigned long fmode) - { - ... - } - - Next comes a function for reading symbolic links, which is also -omitted here for brevity: - - /* read_symlink --- read a symbolic link into an allocated buffer. - ... */ - - static char * - read_symlink(const char *fname, size_t bufsize, ssize_t *linksize) - { - ... - } - - Two helper functions simplify entering values in the array that will -contain the result of the 'stat()': - - /* array_set --- set an array element */ - - static void - array_set(awk_array_t array, const char *sub, awk_value_t *value) - { - awk_value_t index; - - set_array_element(array, - make_const_string(sub, strlen(sub), & index), - value); - - } - - /* array_set_numeric --- set an array element with a number */ - - static void - array_set_numeric(awk_array_t array, const char *sub, double num) - { - awk_value_t tmp; - - array_set(array, sub, make_number(num, & tmp)); - } - - The following function does most of the work to fill in the -'awk_array_t' result array with values obtained from a valid 'struct -stat'. This work is done in a separate function to support the 'stat()' -function for 'gawk' and also to support the 'fts()' extension, which is -included in the same file but whose code is not shown here (*note -Extension Sample File Functions::). - - The first part of the function is variable declarations, including a -table to map file types to strings: - - /* fill_stat_array --- do the work to fill an array with stat info */ - - static int - fill_stat_array(const char *name, awk_array_t array, struct stat *sbuf) - { - char *pmode; /* printable mode */ - const char *type = "unknown"; - awk_value_t tmp; - static struct ftype_map { - unsigned int mask; - const char *type; - } ftype_map[] = { - { S_IFREG, "file" }, - { S_IFBLK, "blockdev" }, - { S_IFCHR, "chardev" }, - { S_IFDIR, "directory" }, - #ifdef S_IFSOCK - { S_IFSOCK, "socket" }, - #endif - #ifdef S_IFIFO - { S_IFIFO, "fifo" }, - #endif - #ifdef S_IFLNK - { S_IFLNK, "symlink" }, - #endif - #ifdef S_IFDOOR /* Solaris weirdness */ - { S_IFDOOR, "door" }, - #endif /* S_IFDOOR */ - }; - int j, k; - - The destination array is cleared, and then code fills in various -elements based on values in the 'struct stat': - - /* empty out the array */ - clear_array(array); - - /* fill in the array */ - array_set(array, "name", make_const_string(name, strlen(name), - & tmp)); - array_set_numeric(array, "dev", sbuf->st_dev); - array_set_numeric(array, "ino", sbuf->st_ino); - array_set_numeric(array, "mode", sbuf->st_mode); - array_set_numeric(array, "nlink", sbuf->st_nlink); - array_set_numeric(array, "uid", sbuf->st_uid); - array_set_numeric(array, "gid", sbuf->st_gid); - array_set_numeric(array, "size", sbuf->st_size); - array_set_numeric(array, "blocks", sbuf->st_blocks); - array_set_numeric(array, "atime", sbuf->st_atime); - array_set_numeric(array, "mtime", sbuf->st_mtime); - array_set_numeric(array, "ctime", sbuf->st_ctime); - - /* for block and character devices, add rdev, - major and minor numbers */ - if (S_ISBLK(sbuf->st_mode) || S_ISCHR(sbuf->st_mode)) { - array_set_numeric(array, "rdev", sbuf->st_rdev); - array_set_numeric(array, "major", major(sbuf->st_rdev)); - array_set_numeric(array, "minor", minor(sbuf->st_rdev)); - } - -The latter part of the function makes selective additions to the -destination array, depending upon the availability of certain members -and/or the type of the file. It then returns zero, for success: - - #ifdef HAVE_STRUCT_STAT_ST_BLKSIZE - array_set_numeric(array, "blksize", sbuf->st_blksize); - #endif /* HAVE_STRUCT_STAT_ST_BLKSIZE */ - - pmode = format_mode(sbuf->st_mode); - array_set(array, "pmode", make_const_string(pmode, strlen(pmode), - & tmp)); - - /* for symbolic links, add a linkval field */ - if (S_ISLNK(sbuf->st_mode)) { - char *buf; - ssize_t linksize; - - if ((buf = read_symlink(name, sbuf->st_size, - & linksize)) != NULL) - array_set(array, "linkval", - make_malloced_string(buf, linksize, & tmp)); - else - warning(ext_id, _("stat: unable to read symbolic link `%s'"), - name); - } - - /* add a type field */ - type = "unknown"; /* shouldn't happen */ - for (j = 0, k = sizeof(ftype_map)/sizeof(ftype_map[0]); j < k; j++) { - if ((sbuf->st_mode & S_IFMT) == ftype_map[j].mask) { - type = ftype_map[j].type; - break; - } - } - - array_set(array, "type", make_const_string(type, strlen(type), & tmp)); - - return 0; - } - - The third argument to 'stat()' was not discussed previously. This -argument is optional. If present, it causes 'do_stat()' to use the -'stat()' system call instead of the 'lstat()' system call. This is done -by using a function pointer: 'statfunc'. 'statfunc' is initialized to -point to 'lstat()' (instead of 'stat()') to get the file information, in -case the file is a symbolic link. However, if the third argument is -included, 'statfunc' is set to point to 'stat()', instead. - - Here is the 'do_stat()' function, which starts with variable -declarations and argument checking: - - /* do_stat --- provide a stat() function for gawk */ - - static awk_value_t * - do_stat(int nargs, awk_value_t *result) - { - awk_value_t file_param, array_param; - char *name; - awk_array_t array; - int ret; - struct stat sbuf; - /* default is lstat() */ - int (*statfunc)(const char *path, struct stat *sbuf) = lstat; - - assert(result != NULL); - - if (nargs != 2 && nargs != 3) { - if (do_lint) - lintwarn(ext_id, - _("stat: called with wrong number of arguments")); - return make_number(-1, result); - } - - Then comes the actual work. First, the function gets the arguments. -Next, it gets the information for the file. If the called function -('lstat()' or 'stat()') returns an error, the code sets 'ERRNO' and -returns: - - /* file is first arg, array to hold results is second */ - if ( ! get_argument(0, AWK_STRING, & file_param) - || ! get_argument(1, AWK_ARRAY, & array_param)) { - warning(ext_id, _("stat: bad parameters")); - return make_number(-1, result); - } - - if (nargs == 3) { - statfunc = stat; - } - - name = file_param.str_value.str; - array = array_param.array_cookie; - - /* always empty out the array */ - clear_array(array); - - /* stat the file; if error, set ERRNO and return */ - ret = statfunc(name, & sbuf); - if (ret < 0) { - update_ERRNO_int(errno); - return make_number(ret, result); - } - - The tedious work is done by 'fill_stat_array()', shown earlier. When -done, the function returns the result from 'fill_stat_array()': - - ret = fill_stat_array(name, array, & sbuf); - - return make_number(ret, result); - } - - Finally, it's necessary to provide the "glue" that loads the new -function(s) into 'gawk'. - - The 'filefuncs' extension also provides an 'fts()' function, which we -omit here (*note Extension Sample File Functions::). For its sake, -there is an initialization function: - - /* init_filefuncs --- initialization routine */ - - static awk_bool_t - init_filefuncs(void) - { - ... - } - - We are almost done. We need an array of 'awk_ext_func_t' structures -for loading each function into 'gawk': - - static awk_ext_func_t func_table[] = { - { "chdir", do_chdir, 1 }, - { "stat", do_stat, 2 }, - #ifndef __MINGW32__ - { "fts", do_fts, 3 }, - #endif - }; - - Each extension must have a routine named 'dl_load()' to load -everything that needs to be loaded. It is simplest to use the -'dl_load_func()' macro in 'gawkapi.h': - - /* define the dl_load() function using the boilerplate macro */ - - dl_load_func(func_table, filefuncs, "") - - And that's it! - - ---------- Footnotes ---------- - - (1) This version is edited slightly for presentation. See -'extension/filefuncs.c' in the 'gawk' distribution for the complete -version. - - -File: gawk.info, Node: Using Internal File Ops, Prev: Internal File Ops, Up: Extension Example - -16.6.3 Integrating the Extensions ---------------------------------- - -Now that the code is written, it must be possible to add it at runtime -to the running 'gawk' interpreter. First, the code must be compiled. -Assuming that the functions are in a file named 'filefuncs.c', and IDIR -is the location of the 'gawkapi.h' header file, the following steps(1) -create a GNU/Linux shared library: - - $ gcc -fPIC -shared -DHAVE_CONFIG_H -c -O -g -IIDIR filefuncs.c - $ gcc -o filefuncs.so -shared filefuncs.o - - Once the library exists, it is loaded by using the '@load' keyword: - - # file testff.awk - @load "filefuncs" - - BEGIN { - "pwd" | getline curdir # save current directory - close("pwd") - - chdir("/tmp") - system("pwd") # test it - chdir(curdir) # go back - - print "Info for testff.awk" - ret = stat("testff.awk", data) - print "ret =", ret - for (i in data) - printf "data[\"%s\"] = %s\n", i, data[i] - print "testff.awk modified:", - strftime("%m %d %Y %H:%M:%S", data["mtime"]) - - print "\nInfo for JUNK" - ret = stat("JUNK", data) - print "ret =", ret - for (i in data) - printf "data[\"%s\"] = %s\n", i, data[i] - print "JUNK modified:", strftime("%m %d %Y %H:%M:%S", data["mtime"]) - } - - The 'AWKLIBPATH' environment variable tells 'gawk' where to find -extensions (*note Finding Extensions::). We set it to the current -directory and run the program: - - $ AWKLIBPATH=$PWD gawk -f testff.awk - -| /tmp - -| Info for testff.awk - -| ret = 0 - -| data["blksize"] = 4096 - -| data["devbsize"] = 512 - -| data["mtime"] = 1412004710 - -| data["mode"] = 33204 - -| data["type"] = file - -| data["dev"] = 2053 - -| data["gid"] = 1000 - -| data["ino"] = 10358899 - -| data["ctime"] = 1412004710 - -| data["blocks"] = 8 - -| data["nlink"] = 1 - -| data["name"] = testff.awk - -| data["atime"] = 1412004716 - -| data["pmode"] = -rw-rw-r-- - -| data["size"] = 666 - -| data["uid"] = 1000 - -| testff.awk modified: 09 29 2014 18:31:50 - -| - -| Info for JUNK - -| ret = -1 - -| JUNK modified: 01 01 1970 02:00:00 - - ---------- Footnotes ---------- - - (1) In practice, you would probably want to use the GNU Autotools -(Automake, Autoconf, Libtool, and 'gettext') to configure and build your -libraries. Instructions for doing so are beyond the scope of this Info -file. *Note gawkextlib:: for Internet links to the tools. - - -File: gawk.info, Node: Extension Samples, Next: gawkextlib, Prev: Extension Example, Up: Dynamic Extensions - -16.7 The Sample Extensions in the 'gawk' Distribution -===================================================== - -This minor node provides a brief overview of the sample extensions that -come in the 'gawk' distribution. Some of them are intended for -production use (e.g., the 'filefuncs', 'readdir', and 'inplace' -extensions). Others mainly provide example code that shows how to use -the extension API. - -* Menu: - -* Extension Sample File Functions:: The file functions sample. -* Extension Sample Fnmatch:: An interface to 'fnmatch()'. -* Extension Sample Fork:: An interface to 'fork()' and other - process functions. -* Extension Sample Inplace:: Enabling in-place file editing. -* Extension Sample Ord:: Character to value to character - conversions. -* Extension Sample Readdir:: An interface to 'readdir()'. -* Extension Sample Revout:: Reversing output sample output wrapper. -* Extension Sample Rev2way:: Reversing data sample two-way processor. -* Extension Sample Read write array:: Serializing an array to a file. -* Extension Sample Readfile:: Reading an entire file into a string. -* Extension Sample Time:: An interface to 'gettimeofday()' - and 'sleep()'. -* Extension Sample API Tests:: Tests for the API. - - -File: gawk.info, Node: Extension Sample File Functions, Next: Extension Sample Fnmatch, Up: Extension Samples - -16.7.1 File-Related Functions ------------------------------ - -The 'filefuncs' extension provides three different functions, as -follows. The usage is: - -'@load "filefuncs"' - This is how you load the extension. - -'result = chdir("/some/directory")' - The 'chdir()' function is a direct hook to the 'chdir()' system - call to change the current directory. It returns zero upon success - or a value less than zero upon error. In the latter case, it - updates 'ERRNO'. - -'result = stat("/some/path", statdata' [', follow']')' - The 'stat()' function provides a hook into the 'stat()' system - call. It returns zero upon success or a value less than zero upon - error. In the latter case, it updates 'ERRNO'. - - By default, it uses the 'lstat()' system call. However, if passed - a third argument, it uses 'stat()' instead. - - In all cases, it clears the 'statdata' array. When the call is - successful, 'stat()' fills the 'statdata' array with information - retrieved from the filesystem, as follows: - - Subscript Field in 'struct stat' File type - ---------------------------------------------------------------- - '"name"' The file name All - '"dev"' 'st_dev' All - '"ino"' 'st_ino' All - '"mode"' 'st_mode' All - '"nlink"' 'st_nlink' All - '"uid"' 'st_uid' All - '"gid"' 'st_gid' All - '"size"' 'st_size' All - '"atime"' 'st_atime' All - '"mtime"' 'st_mtime' All - '"ctime"' 'st_ctime' All - '"rdev"' 'st_rdev' Device files - '"major"' 'st_major' Device files - '"minor"' 'st_minor' Device files - '"blksize"' 'st_blksize' All - '"pmode"' A human-readable version of the All - mode value, like that printed by - 'ls' (for example, '"-rwxr-xr-x"') - '"linkval"' The value of the symbolic link Symbolic - links - '"type"' The type of the file as a All - string--one of '"file"', - '"blockdev"', '"chardev"', - '"directory"', '"socket"', - '"fifo"', '"symlink"', '"door"', - or '"unknown"' (not all systems - support all file types) - -'flags = or(FTS_PHYSICAL, ...)' -'result = fts(pathlist, flags, filedata)' - Walk the file trees provided in 'pathlist' and fill in the - 'filedata' array, as described next. 'flags' is the bitwise OR of - several predefined values, also described in a moment. Return zero - if there were no errors, otherwise return -1. - - The 'fts()' function provides a hook to the C library 'fts()' -routines for traversing file hierarchies. Instead of returning data -about one file at a time in a stream, it fills in a multidimensional -array with data about each file and directory encountered in the -requested hierarchies. - - The arguments are as follows: - -'pathlist' - An array of file names. The element values are used; the index - values are ignored. - -'flags' - This should be the bitwise OR of one or more of the following - predefined constant flag values. At least one of 'FTS_LOGICAL' or - 'FTS_PHYSICAL' must be provided; otherwise 'fts()' returns an error - value and sets 'ERRNO'. The flags are: - - 'FTS_LOGICAL' - Do a "logical" file traversal, where the information returned - for a symbolic link refers to the linked-to file, and not to - the symbolic link itself. This flag is mutually exclusive - with 'FTS_PHYSICAL'. - - 'FTS_PHYSICAL' - Do a "physical" file traversal, where the information returned - for a symbolic link refers to the symbolic link itself. This - flag is mutually exclusive with 'FTS_LOGICAL'. - - 'FTS_NOCHDIR' - As a performance optimization, the C library 'fts()' routines - change directory as they traverse a file hierarchy. This flag - disables that optimization. - - 'FTS_COMFOLLOW' - Immediately follow a symbolic link named in 'pathlist', - whether or not 'FTS_LOGICAL' is set. - - 'FTS_SEEDOT' - By default, the C library 'fts()' routines do not return - entries for '.' (dot) and '..' (dot-dot). This option causes - entries for dot-dot to also be included. (The extension - always includes an entry for dot; more on this in a moment.) - - 'FTS_XDEV' - During a traversal, do not cross onto a different mounted - filesystem. - -'filedata' - The 'filedata' array holds the results. 'fts()' first clears it. - Then it creates an element in 'filedata' for every element in - 'pathlist'. The index is the name of the directory or file given - in 'pathlist'. The element for this index is itself an array. - There are two cases: - - _The path is a file_ - In this case, the array contains two or three elements: - - '"path"' - The full path to this file, starting from the "root" that - was given in the 'pathlist' array. - - '"stat"' - This element is itself an array, containing the same - information as provided by the 'stat()' function - described earlier for its 'statdata' argument. The - element may not be present if the 'stat()' system call - for the file failed. - - '"error"' - If some kind of error was encountered, the array will - also contain an element named '"error"', which is a - string describing the error. - - _The path is a directory_ - In this case, the array contains one element for each entry in - the directory. If an entry is a file, that element is the - same as for files, just described. If the entry is a - directory, that element is (recursively) an array describing - the subdirectory. If 'FTS_SEEDOT' was provided in the flags, - then there will also be an element named '".."'. This element - will be an array containing the data as provided by 'stat()'. - - In addition, there will be an element whose index is '"."'. - This element is an array containing the same two or three - elements as for a file: '"path"', '"stat"', and '"error"'. - - The 'fts()' function returns zero if there were no errors. -Otherwise, it returns -1. - - NOTE: The 'fts()' extension does not exactly mimic the interface of - the C library 'fts()' routines, choosing instead to provide an - interface that is based on associative arrays, which is more - comfortable to use from an 'awk' program. This includes the lack - of a comparison function, because 'gawk' already provides powerful - array sorting facilities. Although an 'fts_read()'-like interface - could have been provided, this felt less natural than simply - creating a multidimensional array to represent the file hierarchy - and its information. - - See 'test/fts.awk' in the 'gawk' distribution for an example use of -the 'fts()' extension function. - - -File: gawk.info, Node: Extension Sample Fnmatch, Next: Extension Sample Fork, Prev: Extension Sample File Functions, Up: Extension Samples - -16.7.2 Interface to 'fnmatch()' -------------------------------- - -This extension provides an interface to the C library 'fnmatch()' -function. The usage is: - -'@load "fnmatch"' - This is how you load the extension. - -'result = fnmatch(pattern, string, flags)' - The return value is zero on success, 'FNM_NOMATCH' if the string - did not match the pattern, or a different nonzero value if an error - occurred. - - In addition to the 'fnmatch()' function, the 'fnmatch' extension adds -one constant ('FNM_NOMATCH'), and an array of flag values named 'FNM'. - - The arguments to 'fnmatch()' are: - -'pattern' - The file name wildcard to match - -'string' - The file name string - -'flag' - Either zero, or the bitwise OR of one or more of the flags in the - 'FNM' array - - The flags are as follows: - -Array element Corresponding flag defined by 'fnmatch()' --------------------------------------------------------------------------- -'FNM["CASEFOLD"]' 'FNM_CASEFOLD' -'FNM["FILE_NAME"]' 'FNM_FILE_NAME' -'FNM["LEADING_DIR"]''FNM_LEADING_DIR' -'FNM["NOESCAPE"]' 'FNM_NOESCAPE' -'FNM["PATHNAME"]' 'FNM_PATHNAME' -'FNM["PERIOD"]' 'FNM_PERIOD' - - Here is an example: - - @load "fnmatch" - ... - flags = or(FNM["PERIOD"], FNM["NOESCAPE"]) - if (fnmatch("*.a", "foo.c", flags) == FNM_NOMATCH) - print "no match" - - -File: gawk.info, Node: Extension Sample Fork, Next: Extension Sample Inplace, Prev: Extension Sample Fnmatch, Up: Extension Samples - -16.7.3 Interface to 'fork()', 'wait()', and 'waitpid()' -------------------------------------------------------- - -The 'fork' extension adds three functions, as follows: - -'@load "fork"' - This is how you load the extension. - -'pid = fork()' - This function creates a new process. The return value is zero in - the child and the process ID number of the child in the parent, or - -1 upon error. In the latter case, 'ERRNO' indicates the problem. - In the child, 'PROCINFO["pid"]' and 'PROCINFO["ppid"]' are updated - to reflect the correct values. - -'ret = waitpid(pid)' - This function takes a numeric argument, which is the process ID to - wait for. The return value is that of the 'waitpid()' system call. - -'ret = wait()' - This function waits for the first child to die. The return value - is that of the 'wait()' system call. - - There is no corresponding 'exec()' function. - - Here is an example: - - @load "fork" - ... - if ((pid = fork()) == 0) - print "hello from the child" - else - print "hello from the parent" - - -File: gawk.info, Node: Extension Sample Inplace, Next: Extension Sample Ord, Prev: Extension Sample Fork, Up: Extension Samples - -16.7.4 Enabling In-Place File Editing -------------------------------------- - -The 'inplace' extension emulates GNU 'sed''s '-i' option, which performs -"in-place" editing of each input file. It uses the bundled -'inplace.awk' include file to invoke the extension properly: - - # inplace --- load and invoke the inplace extension. - - @load "inplace" - - # Please set INPLACE_SUFFIX to make a backup copy. For example, you may - # want to set INPLACE_SUFFIX to .bak on the command line or in a BEGIN rule. - - # By default, each filename on the command line will be edited inplace. - # But you can selectively disable this by adding an inplace=0 argument - # prior to files that you do not want to process this way. You can then - # reenable it later on the commandline by putting inplace=1 before files - # that you wish to be subject to inplace editing. - - # N.B. We call inplace_end() in the BEGINFILE and END rules so that any - # actions in an ENDFILE rule will be redirected as expected. - - BEGIN { - inplace = 1 # enabled by default - } - - BEGINFILE { - if (_inplace_filename != "") - inplace_end(_inplace_filename, INPLACE_SUFFIX) - if (inplace) - inplace_begin(_inplace_filename = FILENAME, INPLACE_SUFFIX) - else - _inplace_filename = "" - } - - END { - if (_inplace_filename != "") - inplace_end(_inplace_filename, INPLACE_SUFFIX) - } - - For each regular file that is processed, the extension redirects -standard output to a temporary file configured to have the same owner -and permissions as the original. After the file has been processed, the -extension restores standard output to its original destination. If -'INPLACE_SUFFIX' is not an empty string, the original file is linked to -a backup file name created by appending that suffix. Finally, the -temporary file is renamed to the original file name. - - Note that the use of this feature can be controlled by placing -'inplace=0' on the command-line prior to listing files that should not -be processed this way. You can reenable inplace editing by adding an -'inplace=1' argument prior to files that should be subject to inplace -editing. - - The '_inplace_filename' variable serves to keep track of the current -filename so as to not invoke 'inplace_end()' before processing the first -file. - - If any error occurs, the extension issues a fatal error to terminate -processing immediately without damaging the original file. - - Here are some simple examples: - - $ gawk -i inplace '{ gsub(/foo/, "bar") }; { print }' file1 file2 file3 - - To keep a backup copy of the original files, try this: - - $ gawk -i inplace -v INPLACE_SUFFIX=.bak '{ gsub(/foo/, "bar") } - > { print }' file1 file2 file3 - - Please note that, while the extension does attempt to preserve -ownership and permissions, it makes no attempt to copy the ACLs from the -original file. - - If the program dies prematurely, as might happen if an unhandled -signal is received, a temporary file may be left behind. - - -File: gawk.info, Node: Extension Sample Ord, Next: Extension Sample Readdir, Prev: Extension Sample Inplace, Up: Extension Samples - -16.7.5 Character and Numeric values: 'ord()' and 'chr()' --------------------------------------------------------- - -The 'ordchr' extension adds two functions, named 'ord()' and 'chr()', as -follows: - -'@load "ordchr"' - This is how you load the extension. - -'number = ord(string)' - Return the numeric value of the first character in 'string'. - -'char = chr(number)' - Return a string whose first character is that represented by - 'number'. - - These functions are inspired by the Pascal language functions of the -same name. Here is an example: - - @load "ordchr" - ... - printf("The numeric value of 'A' is %d\n", ord("A")) - printf("The string value of 65 is %s\n", chr(65)) - - -File: gawk.info, Node: Extension Sample Readdir, Next: Extension Sample Revout, Prev: Extension Sample Ord, Up: Extension Samples - -16.7.6 Reading Directories --------------------------- - -The 'readdir' extension adds an input parser for directories. The usage -is as follows: - - @load "readdir" - - When this extension is in use, instead of skipping directories named -on the command line (or with 'getline'), they are read, with each entry -returned as a record. - - The record consists of three fields. The first two are the inode -number and the file name, separated by a forward slash character. On -systems where the directory entry contains the file type, the record has -a third field (also separated by a slash), which is a single letter -indicating the type of the file. The letters and their corresponding -file types are shown in *note Table 16.3: table-readdir-file-types. - -Letter File type --------------------------------------------------------------------------- -'b' Block device -'c' Character device -'d' Directory -'f' Regular file -'l' Symbolic link -'p' Named pipe (FIFO) -'s' Socket -'u' Anything else (unknown) - -Table 16.3: File types returned by the 'readdir' extension - - On systems without the file type information, the third field is -always 'u'. - - NOTE: On GNU/Linux systems, there are filesystems that don't - support the 'd_type' entry (see the readdir(3) manual page), and so - the file type is always 'u'. You can use the 'filefuncs' extension - to call 'stat()' in order to get correct type information. - - Here is an example: - - @load "readdir" - ... - BEGIN { FS = "/" } - { print "file name is", $2 } - - -File: gawk.info, Node: Extension Sample Revout, Next: Extension Sample Rev2way, Prev: Extension Sample Readdir, Up: Extension Samples - -16.7.7 Reversing Output ------------------------ - -The 'revoutput' extension adds a simple output wrapper that reverses the -characters in each output line. Its main purpose is to show how to -write an output wrapper, although it may be mildly amusing for the -unwary. Here is an example: - - @load "revoutput" - - BEGIN { - REVOUT = 1 - print "don't panic" > "/dev/stdout" - } - - The output from this program is 'cinap t'nod'. - - -File: gawk.info, Node: Extension Sample Rev2way, Next: Extension Sample Read write array, Prev: Extension Sample Revout, Up: Extension Samples - -16.7.8 Two-Way I/O Example --------------------------- - -The 'revtwoway' extension adds a simple two-way processor that reverses -the characters in each line sent to it for reading back by the 'awk' -program. Its main purpose is to show how to write a two-way processor, -although it may also be mildly amusing. The following example shows how -to use it: - - @load "revtwoway" - - BEGIN { - cmd = "/magic/mirror" - print "don't panic" |& cmd - cmd |& getline result - print result - close(cmd) - } - - The output from this program is: 'cinap t'nod'. - - -File: gawk.info, Node: Extension Sample Read write array, Next: Extension Sample Readfile, Prev: Extension Sample Rev2way, Up: Extension Samples - -16.7.9 Dumping and Restoring an Array -------------------------------------- - -The 'rwarray' extension adds two functions, named 'writea()' and -'reada()', as follows: - -'@load "rwarray"' - This is how you load the extension. - -'ret = writea(file, array)' - This function takes a string argument, which is the name of the - file to which to dump the array, and the array itself as the second - argument. 'writea()' understands arrays of arrays. It returns one - on success, or zero upon failure. - -'ret = reada(file, array)' - 'reada()' is the inverse of 'writea()'; it reads the file named as - its first argument, filling in the array named as the second - argument. It clears the array first. Here too, the return value - is one on success, or zero upon failure. - - The array created by 'reada()' is identical to that written by -'writea()' in the sense that the contents are the same. However, due to -implementation issues, the array traversal order of the re-created array -is likely to be different from that of the original array. As array -traversal order in 'awk' is by default undefined, this is (technically) -not a problem. If you need to guarantee a particular traversal order, -use the array sorting features in 'gawk' to do so (*note Array -Sorting::). - - The file contains binary data. All integral values are written in -network byte order. However, double-precision floating-point values are -written as native binary data. Thus, arrays containing only string data -can theoretically be dumped on systems with one byte order and restored -on systems with a different one, but this has not been tried. - - Here is an example: - - @load "rwarray" - ... - ret = writea("arraydump.bin", array) - ... - ret = reada("arraydump.bin", array) - - -File: gawk.info, Node: Extension Sample Readfile, Next: Extension Sample Time, Prev: Extension Sample Read write array, Up: Extension Samples - -16.7.10 Reading an Entire File ------------------------------- - -The 'readfile' extension adds a single function named 'readfile()', and -an input parser: - -'@load "readfile"' - This is how you load the extension. - -'result = readfile("/some/path")' - The argument is the name of the file to read. The return value is - a string containing the entire contents of the requested file. - Upon error, the function returns the empty string and sets 'ERRNO'. - -'BEGIN { PROCINFO["readfile"] = 1 }' - In addition, the extension adds an input parser that is activated - if 'PROCINFO["readfile"]' exists. When activated, each input file - is returned in its entirety as '$0'. 'RT' is set to the null - string. - - Here is an example: - - @load "readfile" - ... - contents = readfile("/path/to/file"); - if (contents == "" && ERRNO != "") { - print("problem reading file", ERRNO) > "/dev/stderr" - ... - } - - -File: gawk.info, Node: Extension Sample Time, Next: Extension Sample API Tests, Prev: Extension Sample Readfile, Up: Extension Samples - -16.7.11 Extension Time Functions --------------------------------- - -The 'time' extension adds two functions, named 'gettimeofday()' and -'sleep()', as follows: - -'@load "time"' - This is how you load the extension. - -'the_time = gettimeofday()' - Return the time in seconds that has elapsed since 1970-01-01 UTC as - a floating-point value. If the time is unavailable on this - platform, return -1 and set 'ERRNO'. The returned time should have - sub-second precision, but the actual precision may vary based on - the platform. If the standard C 'gettimeofday()' system call is - available on this platform, then it simply returns the value. - Otherwise, if on MS-Windows, it tries to use - 'GetSystemTimeAsFileTime()'. - -'result = sleep(SECONDS)' - Attempt to sleep for SECONDS seconds. If SECONDS is negative, or - the attempt to sleep fails, return -1 and set 'ERRNO'. Otherwise, - return zero after sleeping for the indicated amount of time. Note - that SECONDS may be a floating-point (nonintegral) value. - Implementation details: depending on platform availability, this - function tries to use 'nanosleep()' or 'select()' to implement the - delay. - - -File: gawk.info, Node: Extension Sample API Tests, Prev: Extension Sample Time, Up: Extension Samples - -16.7.12 API Tests ------------------ - -The 'testext' extension exercises parts of the extension API that are -not tested by the other samples. The 'extension/testext.c' file -contains both the C code for the extension and 'awk' test code inside C -comments that run the tests. The testing framework extracts the 'awk' -code and runs the tests. See the source file for more information. - - -File: gawk.info, Node: gawkextlib, Next: Extension summary, Prev: Extension Samples, Up: Dynamic Extensions - -16.8 The 'gawkextlib' Project -============================= - -The 'gawkextlib' (http://sourceforge.net/projects/gawkextlib/) project -provides a number of 'gawk' extensions, including one for processing XML -files. This is the evolution of the original 'xgawk' (XML 'gawk') -project. - - As of this writing, there are seven extensions: - - * 'errno' extension - - * GD graphics library extension - - * MPFR library extension (this provides access to a number of MPFR - functions that 'gawk''s native MPFR support does not) - - * PDF extension - - * PostgreSQL extension - - * Redis extension - - * Select extension - - * XML parser extension, using the Expat - (http://expat.sourceforge.net) XML parsing library - - You can check out the code for the 'gawkextlib' project using the Git -(http://git-scm.com) distributed source code control system. The -command is as follows: - - git clone git://git.code.sf.net/p/gawkextlib/code gawkextlib-code - - You will need to have the Expat (http://expat.sourceforge.net) XML -parser library installed in order to build and use the XML extension. - - In addition, you must have the GNU Autotools installed (Autoconf -(http://www.gnu.org/software/autoconf), Automake -(http://www.gnu.org/software/automake), Libtool -(http://www.gnu.org/software/libtool), and GNU 'gettext' -(http://www.gnu.org/software/gettext)). - - The simple recipe for building and testing 'gawkextlib' is as -follows. First, build and install 'gawk': - - cd .../path/to/gawk/code - ./configure --prefix=/tmp/newgawk Install in /tmp/newgawk for now - make && make check Build and check that all is OK - make install Install gawk - - Next, go to <http://sourceforge.net/projects/gawkextlib/files> to -download 'gawkextlib' and any extensions that you would like to build. -The 'README' file at that site explains how to build the code. If you -installed 'gawk' in a non-standard location, you will need to specify -'./configure --with-gawk=/PATH/TO/GAWK' to find it. You may need to use -the 'sudo' utility to install both 'gawk' and 'gawkextlib', depending -upon how your system works. - - If you write an extension that you wish to share with other 'gawk' -users, consider doing so through the 'gawkextlib' project. See the -project's website for more information. - - -File: gawk.info, Node: Extension summary, Next: Extension Exercises, Prev: gawkextlib, Up: Dynamic Extensions - -16.9 Summary -============ - - * You can write extensions (sometimes called plug-ins) for 'gawk' in - C or C++ using the application programming interface (API) defined - by the 'gawk' developers. - - * Extensions must have a license compatible with the GNU General - Public License (GPL), and they must assert that fact by declaring a - variable named 'plugin_is_GPL_compatible'. - - * Communication between 'gawk' and an extension is two-way. 'gawk' - passes a 'struct' to the extension that contains various data - fields and function pointers. The extension can then call into - 'gawk' via the supplied function pointers to accomplish certain - tasks. - - * One of these tasks is to "register" the name and implementation of - new 'awk'-level functions with 'gawk'. The implementation takes - the form of a C function pointer with a defined signature. By - convention, implementation functions are named 'do_XXXX()' for some - 'awk'-level function 'XXXX()'. - - * The API is defined in a header file named 'gawkapi.h'. You must - include a number of standard header files _before_ including it in - your source file. - - * API function pointers are provided for the following kinds of - operations: - - * Allocating, reallocating, and releasing memory - - * Registration functions (you may register extension functions, - exit callbacks, a version string, input parsers, output - wrappers, and two-way processors) - - * Printing fatal, nonfatal, warning, and "lint" warning messages - - * Updating 'ERRNO', or unsetting it - - * Accessing parameters, including converting an undefined - parameter into an array - - * Symbol table access (retrieving a global variable, creating - one, or changing one) - - * Creating and releasing cached values; this provides an - efficient way to use values for multiple variables and can be - a big performance win - - * Manipulating arrays (retrieving, adding, deleting, and - modifying elements; getting the count of elements in an array; - creating a new array; clearing an array; and flattening an - array for easy C-style looping over all its indices and - elements) - - * The API defines a number of standard data types for representing - 'awk' values, array elements, and arrays. - - * The API provides convenience functions for constructing values. It - also provides memory management functions to ensure compatibility - between memory allocated by 'gawk' and memory allocated by an - extension. - - * _All_ memory passed from 'gawk' to an extension must be treated as - read-only by the extension. - - * _All_ memory passed from an extension to 'gawk' must come from the - API's memory allocation functions. 'gawk' takes responsibility for - the memory and releases it when appropriate. - - * The API provides information about the running version of 'gawk' so - that an extension can make sure it is compatible with the 'gawk' - that loaded it. - - * It is easiest to start a new extension by copying the boilerplate - code described in this major node. Macros in the 'gawkapi.h' - header file make this easier to do. - - * The 'gawk' distribution includes a number of small but useful - sample extensions. The 'gawkextlib' project includes several more - (larger) extensions. If you wish to write an extension and - contribute it to the community of 'gawk' users, the 'gawkextlib' - project is the place to do so. - - -File: gawk.info, Node: Extension Exercises, Prev: Extension summary, Up: Dynamic Extensions - -16.10 Exercises -=============== - - 1. Add functions to implement system calls such as 'chown()', - 'chmod()', and 'umask()' to the file operations extension presented - in *note Internal File Ops::. - - 2. Write an input parser that prints a prompt if the input is a from a - "terminal" device. You can use the 'isatty()' function to tell if - the input file is a terminal. (Hint: this function is usually - expensive to call; try to call it just once.) The content of the - prompt should come from a variable settable by 'awk'-level code. - You can write the prompt to standard error. However, for best - results, open a new file descriptor (or file pointer) on '/dev/tty' - and print the prompt there, in case standard error has been - redirected. - - Why is standard error a better choice than standard output for - writing the prompt? Which reading mechanism should you replace, - the one to get a record, or the one to read raw bytes? - - 3. (Hard.) How would you provide namespaces in 'gawk', so that the - names of functions in different extensions don't conflict with each - other? If you come up with a really good scheme, contact the - 'gawk' maintainer to tell him about it. - - 4. Write a wrapper script that provides an interface similar to 'sed - -i' for the "inplace" extension presented in *note Extension Sample - Inplace::. - - -File: gawk.info, Node: Language History, Next: Installation, Prev: Dynamic Extensions, Up: Top - -Appendix A The Evolution of the 'awk' Language -********************************************** - -This Info file describes the GNU implementation of 'awk', which follows -the POSIX specification. Many longtime 'awk' users learned 'awk' -programming with the original 'awk' implementation in Version 7 Unix. -(This implementation was the basis for 'awk' in Berkeley Unix, through -4.3-Reno. Subsequent versions of Berkeley Unix, and, for a while, some -systems derived from 4.4BSD-Lite, used various versions of 'gawk' for -their 'awk'.) This major node briefly describes the evolution of the -'awk' language, with cross-references to other parts of the Info file -where you can find more information. - -* Menu: - -* V7/SVR3.1:: The major changes between V7 and System V - Release 3.1. -* SVR4:: Minor changes between System V Releases 3.1 - and 4. -* POSIX:: New features from the POSIX standard. -* BTL:: New features from Brian Kernighan's version of - 'awk'. -* POSIX/GNU:: The extensions in 'gawk' not in POSIX - 'awk'. -* Feature History:: The history of the features in 'gawk'. -* Common Extensions:: Common Extensions Summary. -* Ranges and Locales:: How locales used to affect regexp ranges. -* Contributors:: The major contributors to 'gawk'. -* History summary:: History summary. - - -File: gawk.info, Node: V7/SVR3.1, Next: SVR4, Up: Language History - -A.1 Major Changes Between V7 and SVR3.1 -======================================= - -The 'awk' language evolved considerably between the release of Version 7 -Unix (1978) and the new version that was first made generally available -in System V Release 3.1 (1987). This minor node summarizes the changes, -with cross-references to further details: - - * The requirement for ';' to separate rules on a line (*note - Statements/Lines::) - - * User-defined functions and the 'return' statement (*note - User-defined::) - - * The 'delete' statement (*note Delete::) - - * The 'do'-'while' statement (*note Do Statement::) - - * The built-in functions 'atan2()', 'cos()', 'sin()', 'rand()', and - 'srand()' (*note Numeric Functions::) - - * The built-in functions 'gsub()', 'sub()', and 'match()' (*note - String Functions::) - - * The built-in functions 'close()' and 'system()' (*note I/O - Functions::) - - * The 'ARGC', 'ARGV', 'FNR', 'RLENGTH', 'RSTART', and 'SUBSEP' - predefined variables (*note Built-in Variables::) - - * Assignable '$0' (*note Changing Fields::) - - * The conditional expression using the ternary operator '?:' (*note - Conditional Exp::) - - * The expression 'INDX in ARRAY' outside of 'for' statements (*note - Reference to Elements::) - - * The exponentiation operator '^' (*note Arithmetic Ops::) and its - assignment operator form '^=' (*note Assignment Ops::) - - * C-compatible operator precedence, which breaks some old 'awk' - programs (*note Precedence::) - - * Regexps as the value of 'FS' (*note Field Separators::) and as the - third argument to the 'split()' function (*note String - Functions::), rather than using only the first character of 'FS' - - * Dynamic regexps as operands of the '~' and '!~' operators (*note - Computed Regexps::) - - * The escape sequences '\b', '\f', and '\r' (*note Escape - Sequences::) - - * Redirection of input for the 'getline' function (*note Getline::) - - * Multiple 'BEGIN' and 'END' rules (*note BEGIN/END::) - - * Multidimensional arrays (*note Multidimensional::) - - -File: gawk.info, Node: SVR4, Next: POSIX, Prev: V7/SVR3.1, Up: Language History - -A.2 Changes Between SVR3.1 and SVR4 -=================================== - -The System V Release 4 (1989) version of Unix 'awk' added these features -(some of which originated in 'gawk'): - - * The 'ENVIRON' array (*note Built-in Variables::) - - * Multiple '-f' options on the command line (*note Options::) - - * The '-v' option for assigning variables before program execution - begins (*note Options::) - - * The '--' signal for terminating command-line options - - * The '\a', '\v', and '\x' escape sequences (*note Escape - Sequences::) - - * A defined return value for the 'srand()' built-in function (*note - Numeric Functions::) - - * The 'toupper()' and 'tolower()' built-in string functions for case - translation (*note String Functions::) - - * A cleaner specification for the '%c' format-control letter in the - 'printf' function (*note Control Letters::) - - * The ability to dynamically pass the field width and precision - ('"%*.*d"') in the argument list of 'printf' and 'sprintf()' (*note - Control Letters::) - - * The use of regexp constants, such as '/foo/', as expressions, where - they are equivalent to using the matching operator, as in '$0 ~ - /foo/' (*note Using Constant Regexps::) - - * Processing of escape sequences inside command-line variable - assignments (*note Assignment Options::) - - -File: gawk.info, Node: POSIX, Next: BTL, Prev: SVR4, Up: Language History - -A.3 Changes Between SVR4 and POSIX 'awk' -======================================== - -The POSIX Command Language and Utilities standard for 'awk' (1992) -introduced the following changes into the language: - - * The use of '-W' for implementation-specific options (*note - Options::) - - * The use of 'CONVFMT' for controlling the conversion of numbers to - strings (*note Conversion::) - - * The concept of a numeric string and tighter comparison rules to go - with it (*note Typing and Comparison::) - - * The use of predefined variables as function parameter names is - forbidden (*note Definition Syntax::) - - * More complete documentation of many of the previously undocumented - features of the language - - In 2012, a number of extensions that had been commonly available for -many years were finally added to POSIX. They are: - - * The 'fflush()' built-in function for flushing buffered output - (*note I/O Functions::) - - * The 'nextfile' statement (*note Nextfile Statement::) - - * The ability to delete all of an array at once with 'delete ARRAY' - (*note Delete::) - - *Note Common Extensions:: for a list of common extensions not -permitted by the POSIX standard. - - The 2008 POSIX standard can be found online at -<http://www.opengroup.org/onlinepubs/9699919799/>. - - -File: gawk.info, Node: BTL, Next: POSIX/GNU, Prev: POSIX, Up: Language History - -A.4 Extensions in Brian Kernighan's 'awk' -========================================= - -Brian Kernighan has made his version available via his home page (*note -Other Versions::). - - This minor node describes common extensions that originally appeared -in his version of 'awk': - - * The '**' and '**=' operators (*note Arithmetic Ops:: and *note - Assignment Ops::) - - * The use of 'func' as an abbreviation for 'function' (*note - Definition Syntax::) - - * The 'fflush()' built-in function for flushing buffered output - (*note I/O Functions::) - - *Note Common Extensions:: for a full list of the extensions available -in his 'awk'. - - -File: gawk.info, Node: POSIX/GNU, Next: Feature History, Prev: BTL, Up: Language History - -A.5 Extensions in 'gawk' Not in POSIX 'awk' -=========================================== - -The GNU implementation, 'gawk', adds a large number of features. They -can all be disabled with either the '--traditional' or '--posix' options -(*note Options::). - - A number of features have come and gone over the years. This minor -node summarizes the additional features over POSIX 'awk' that are in the -current version of 'gawk'. - - * Additional predefined variables: - - - The 'ARGIND', 'BINMODE', 'ERRNO', 'FIELDWIDTHS', 'FPAT', - 'IGNORECASE', 'LINT', 'PROCINFO', 'RT', and 'TEXTDOMAIN' - variables (*note Built-in Variables::) - - * Special files in I/O redirections: - - - The '/dev/stdin', '/dev/stdout', '/dev/stderr', and - '/dev/fd/N' special file names (*note Special Files::) - - - The '/inet', '/inet4', and '/inet6' special files for TCP/IP - networking using '|&' to specify which version of the IP - protocol to use (*note TCP/IP Networking::) - - * Changes and/or additions to the language: - - - The '\x' escape sequence (*note Escape Sequences::) - - - Full support for both POSIX and GNU regexps (*note Regexp::) - - - The ability for 'FS' and for the third argument to 'split()' - to be null strings (*note Single Character Fields::) - - - The ability for 'RS' to be a regexp (*note Records::) - - - The ability to use octal and hexadecimal constants in 'awk' - program source code (*note Nondecimal-numbers::) - - - The '|&' operator for two-way I/O to a coprocess (*note - Two-way I/O::) - - - Indirect function calls (*note Indirect Calls::) - - - Directories on the command line produce a warning and are - skipped (*note Command-line directories::) - - - Output with 'print' and 'printf' need not be fatal (*note - Nonfatal::) - - * New keywords: - - - The 'BEGINFILE' and 'ENDFILE' special patterns (*note - BEGINFILE/ENDFILE::) - - - The 'switch' statement (*note Switch Statement::) - - * Changes to standard 'awk' functions: - - - The optional second argument to 'close()' that allows closing - one end of a two-way pipe to a coprocess (*note Two-way I/O::) - - - POSIX compliance for 'gsub()' and 'sub()' with '--posix' - - - The 'length()' function accepts an array argument and returns - the number of elements in the array (*note String Functions::) - - - The optional third argument to the 'match()' function for - capturing text-matching subexpressions within a regexp (*note - String Functions::) - - - Positional specifiers in 'printf' formats for making - translations easier (*note Printf Ordering::) - - - The 'split()' function's additional optional fourth argument, - which is an array to hold the text of the field separators - (*note String Functions::) - - * Additional functions only in 'gawk': - - - The 'gensub()', 'patsplit()', and 'strtonum()' functions for - more powerful text manipulation (*note String Functions::) - - - The 'asort()' and 'asorti()' functions for sorting arrays - (*note Array Sorting::) - - - The 'mktime()', 'systime()', and 'strftime()' functions for - working with timestamps (*note Time Functions::) - - - The 'and()', 'compl()', 'lshift()', 'or()', 'rshift()', and - 'xor()' functions for bit manipulation (*note Bitwise - Functions::) - - - The 'isarray()' function to check if a variable is an array or - not (*note Type Functions::) - - - The 'bindtextdomain()', 'dcgettext()', and 'dcngettext()' - functions for internationalization (*note Programmer i18n::) - - - The 'intdiv()' function for doing integer division and - remainder (*note Numeric Functions::) - - * Changes and/or additions in the command-line options: - - - The 'AWKPATH' environment variable for specifying a path - search for the '-f' command-line option (*note Options::) - - - The 'AWKLIBPATH' environment variable for specifying a path - search for the '-l' command-line option (*note Options::) - - - The '-b', '-c', '-C', '-d', '-D', '-e', '-E', '-g', '-h', - '-i', '-l', '-L', '-M', '-n', '-N', '-o', '-O', '-p', '-P', - '-r', '-s', '-S', '-t', and '-V' short options. Also, the - ability to use GNU-style long-named options that start with - '--', and the '--assign', '--bignum', '--characters-as-bytes', - '--copyright', '--debug', '--dump-variables', '--exec', - '--field-separator', '--file', '--gen-pot', '--help', - '--include', '--lint', '--lint-old', '--load', - '--non-decimal-data', '--optimize', '--no-optimize', - '--posix', '--pretty-print', '--profile', '--re-interval', - '--sandbox', '--source', '--traditional', '--use-lc-numeric', - and '--version' long options (*note Options::). - - * Support for the following obsolete systems was removed from the - code and the documentation for 'gawk' version 4.0: - - - Amiga - - - Atari - - - BeOS - - - Cray - - - MIPS RiscOS - - - MS-DOS with the Microsoft Compiler - - - MS-Windows with the Microsoft Compiler - - - NeXT - - - SunOS 3.x, Sun 386 (Road Runner) - - - Tandem (non-POSIX) - - - Prestandard VAX C compiler for VAX/VMS - - - GCC for VAX and Alpha has not been tested for a while. - - * Support for the following obsolete system was removed from the code - for 'gawk' version 4.1: - - - Ultrix - - * Support for the following systems was removed from the code for - 'gawk' version 4.2: - - - MirBSD - - -File: gawk.info, Node: Feature History, Next: Common Extensions, Prev: POSIX/GNU, Up: Language History - -A.6 History of 'gawk' Features -============================== - -This minor node describes the features in 'gawk' over and above those in -POSIX 'awk', in the order they were added to 'gawk'. - - Version 2.10 of 'gawk' introduced the following features: - - * The 'AWKPATH' environment variable for specifying a path search for - the '-f' command-line option (*note Options::). - - * The 'IGNORECASE' variable and its effects (*note - Case-sensitivity::). - - * The '/dev/stdin', '/dev/stdout', '/dev/stderr' and '/dev/fd/N' - special file names (*note Special Files::). - - Version 2.13 of 'gawk' introduced the following features: - - * The 'FIELDWIDTHS' variable and its effects (*note Constant Size::). - - * The 'systime()' and 'strftime()' built-in functions for obtaining - and printing timestamps (*note Time Functions::). - - * Additional command-line options (*note Options::): - - - The '-W lint' option to provide error and portability checking - for both the source code and at runtime. - - - The '-W compat' option to turn off the GNU extensions. - - - The '-W posix' option for full POSIX compliance. - - Version 2.14 of 'gawk' introduced the following feature: - - * The 'next file' statement for skipping to the next data file (*note - Nextfile Statement::). - - Version 2.15 of 'gawk' introduced the following features: - - * New variables (*note Built-in Variables::): - - - 'ARGIND', which tracks the movement of 'FILENAME' through - 'ARGV'. - - - 'ERRNO', which contains the system error message when - 'getline' returns -1 or 'close()' fails. - - * The '/dev/pid', '/dev/ppid', '/dev/pgrpid', and '/dev/user' special - file names. These have since been removed. - - * The ability to delete all of an array at once with 'delete ARRAY' - (*note Delete::). - - * Command-line option changes (*note Options::): - - - The ability to use GNU-style long-named options that start - with '--'. - - - The '--source' option for mixing command-line and library-file - source code. - - Version 3.0 of 'gawk' introduced the following features: - - * New or changed variables: - - - 'IGNORECASE' changed, now applying to string comparison as - well as regexp operations (*note Case-sensitivity::). - - - 'RT', which contains the input text that matched 'RS' (*note - Records::). - - * Full support for both POSIX and GNU regexps (*note Regexp::). - - * The 'gensub()' function for more powerful text manipulation (*note - String Functions::). - - * The 'strftime()' function acquired a default time format, allowing - it to be called with no arguments (*note Time Functions::). - - * The ability for 'FS' and for the third argument to 'split()' to be - null strings (*note Single Character Fields::). - - * The ability for 'RS' to be a regexp (*note Records::). - - * The 'next file' statement became 'nextfile' (*note Nextfile - Statement::). - - * The 'fflush()' function from BWK 'awk' (then at Bell Laboratories; - *note I/O Functions::). - - * New command-line options: - - - The '--lint-old' option to warn about constructs that are not - available in the original Version 7 Unix version of 'awk' - (*note V7/SVR3.1::). - - - The '-m' option from BWK 'awk'. (Brian was still at Bell - Laboratories at the time.) This was later removed from both - his 'awk' and from 'gawk'. - - - The '--re-interval' option to provide interval expressions in - regexps (*note Regexp Operators::). - - - The '--traditional' option was added as a better name for - '--compat' (*note Options::). - - * The use of GNU Autoconf to control the configuration process (*note - Quick Installation::). - - * Amiga support. This has since been removed. - - Version 3.1 of 'gawk' introduced the following features: - - * New variables (*note Built-in Variables::): - - - 'BINMODE', for non-POSIX systems, which allows binary I/O for - input and/or output files (*note PC Using::). - - - 'LINT', which dynamically controls lint warnings. - - - 'PROCINFO', an array for providing process-related - information. - - - 'TEXTDOMAIN', for setting an application's - internationalization text domain (*note - Internationalization::). - - * The ability to use octal and hexadecimal constants in 'awk' program - source code (*note Nondecimal-numbers::). - - * The '|&' operator for two-way I/O to a coprocess (*note Two-way - I/O::). - - * The '/inet' special files for TCP/IP networking using '|&' (*note - TCP/IP Networking::). - - * The optional second argument to 'close()' that allows closing one - end of a two-way pipe to a coprocess (*note Two-way I/O::). - - * The optional third argument to the 'match()' function for capturing - text-matching subexpressions within a regexp (*note String - Functions::). - - * Positional specifiers in 'printf' formats for making translations - easier (*note Printf Ordering::). - - * A number of new built-in functions: - - - The 'asort()' and 'asorti()' functions for sorting arrays - (*note Array Sorting::). - - - The 'bindtextdomain()', 'dcgettext()' and 'dcngettext()' - functions for internationalization (*note Programmer i18n::). - - - The 'extension()' function and the ability to add new built-in - functions dynamically (*note Dynamic Extensions::). - - - The 'mktime()' function for creating timestamps (*note Time - Functions::). - - - The 'and()', 'or()', 'xor()', 'compl()', 'lshift()', - 'rshift()', and 'strtonum()' functions (*note Bitwise - Functions::). - - * The support for 'next file' as two words was removed completely - (*note Nextfile Statement::). - - * Additional command-line options (*note Options::): - - - The '--dump-variables' option to print a list of all global - variables. - - - The '--exec' option, for use in CGI scripts. - - - The '--gen-po' command-line option and the use of a leading - underscore to mark strings that should be translated (*note - String Extraction::). - - - The '--non-decimal-data' option to allow non-decimal input - data (*note Nondecimal Data::). - - - The '--profile' option and 'pgawk', the profiling version of - 'gawk', for producing execution profiles of 'awk' programs - (*note Profiling::). - - - The '--use-lc-numeric' option to force 'gawk' to use the - locale's decimal point for parsing input data (*note - Conversion::). - - * The use of GNU Automake to help in standardizing the configuration - process (*note Quick Installation::). - - * The use of GNU 'gettext' for 'gawk''s own message output (*note - Gawk I18N::). - - * BeOS support. This was later removed. - - * Tandem support. This was later removed. - - * The Atari port became officially unsupported and was later removed - entirely. - - * The source code changed to use ISO C standard-style function - definitions. - - * POSIX compliance for 'sub()' and 'gsub()' (*note Gory Details::). - - * The 'length()' function was extended to accept an array argument - and return the number of elements in the array (*note String - Functions::). - - * The 'strftime()' function acquired a third argument to enable - printing times as UTC (*note Time Functions::). - - Version 4.0 of 'gawk' introduced the following features: - - * Variable additions: - - - 'FPAT', which allows you to specify a regexp that matches the - fields, instead of matching the field separator (*note - Splitting By Content::). - - - If 'PROCINFO["sorted_in"]' exists, 'for(iggy in foo)' loops - sort the indices before looping over them. The value of this - element provides control over how the indices are sorted - before the loop traversal starts (*note Controlling - Scanning::). - - - 'PROCINFO["strftime"]', which holds the default format for - 'strftime()' (*note Time Functions::). - - * The special files '/dev/pid', '/dev/ppid', '/dev/pgrpid' and - '/dev/user' were removed. - - * Support for IPv6 was added via the '/inet6' special file. '/inet4' - forces IPv4 and '/inet' chooses the system default, which is - probably IPv4 (*note TCP/IP Networking::). - - * The use of '\s' and '\S' escape sequences in regular expressions - (*note GNU Regexp Operators::). - - * Interval expressions became part of default regular expressions - (*note Regexp Operators::). - - * POSIX character classes work even with '--traditional' (*note - Regexp Operators::). - - * 'break' and 'continue' became invalid outside a loop, even with - '--traditional' (*note Break Statement::, and also see *note - Continue Statement::). - - * 'fflush()', 'nextfile', and 'delete ARRAY' are allowed if '--posix' - or '--traditional', since they are all now part of POSIX. - - * An optional third argument to 'asort()' and 'asorti()', specifying - how to sort (*note String Functions::). - - * The behavior of 'fflush()' changed to match BWK 'awk' and for - POSIX; now both 'fflush()' and 'fflush("")' flush all open output - redirections (*note I/O Functions::). - - * The 'isarray()' function which distinguishes if an item is an array - or not, to make it possible to traverse arrays of arrays (*note - Type Functions::). - - * The 'patsplit()' function which gives the same capability as - 'FPAT', for splitting (*note String Functions::). - - * An optional fourth argument to the 'split()' function, which is an - array to hold the values of the separators (*note String - Functions::). - - * Arrays of arrays (*note Arrays of Arrays::). - - * The 'BEGINFILE' and 'ENDFILE' special patterns (*note - BEGINFILE/ENDFILE::). - - * Indirect function calls (*note Indirect Calls::). - - * 'switch' / 'case' are enabled by default (*note Switch - Statement::). - - * Command-line option changes (*note Options::): - - - The '-b' and '--characters-as-bytes' options which prevent - 'gawk' from treating input as a multibyte string. - - - The redundant '--compat', '--copyleft', and '--usage' long - options were removed. - - - The '--gen-po' option was finally renamed to the correct - '--gen-pot'. - - - The '--sandbox' option which disables certain features. - - - All long options acquired corresponding short options, for use - in '#!' scripts. - - * Directories named on the command line now produce a warning, not a - fatal error, unless '--posix' or '--traditional' are used (*note - Command-line directories::). - - * The 'gawk' internals were rewritten, bringing the 'dgawk' debugger - and possibly improved performance (*note Debugger::). - - * Per the GNU Coding Standards, dynamic extensions must now define a - global symbol indicating that they are GPL-compatible (*note Plugin - License::). - - * In POSIX mode, string comparisons use 'strcoll()' / 'wcscoll()' - (*note POSIX String Comparison::). - - * The option for raw sockets was removed, since it was never - implemented (*note TCP/IP Networking::). - - * Ranges of the form '[d-h]' are treated as if they were in the C - locale, no matter what kind of regexp is being used, and even if - '--posix' (*note Ranges and Locales::). - - * Support was removed for the following systems: - - - Atari - - - Amiga - - - BeOS - - - Cray - - - MIPS RiscOS - - - MS-DOS with Microsoft Compiler - - - MS-Windows with Microsoft Compiler - - - NeXT - - - SunOS 3.x, Sun 386 (Road Runner) - - - Tandem (non-POSIX) - - - Prestandard VAX C compiler for VAX/VMS - - Version 4.1 of 'gawk' introduced the following features: - - * Three new arrays: 'SYMTAB', 'FUNCTAB', and - 'PROCINFO["identifiers"]' (*note Auto-set::). - - * The three executables 'gawk', 'pgawk', and 'dgawk', were merged - into one, named just 'gawk'. As a result the command-line options - changed. - - * Command-line option changes (*note Options::): - - - The '-D' option invokes the debugger. - - - The '-i' and '--include' options load 'awk' library files. - - - The '-l' and '--load' options load compiled dynamic - extensions. - - - The '-M' and '--bignum' options enable MPFR. - - - The '-o' option only does pretty-printing. - - - The '-p' option is used for profiling. - - - The '-R' option was removed. - - * Support for high precision arithmetic with MPFR (*note Arbitrary - Precision Arithmetic::). - - * The 'and()', 'or()' and 'xor()' functions changed to allow any - number of arguments, with a minimum of two (*note Bitwise - Functions::). - - * The dynamic extension interface was completely redone (*note - Dynamic Extensions::). - - * Redirected 'getline' became allowed inside 'BEGINFILE' and - 'ENDFILE' (*note BEGINFILE/ENDFILE::). - - * The 'where' command was added to the debugger (*note Execution - Stack::). - - * Support for Ultrix was removed. - - Version 4.2 introduced the following changes: - - * Changes to 'ENVIRON' are reflected into 'gawk''s environment and - that of programs that it runs. *Note Auto-set::. - - * The '--pretty-print' option no longer runs the 'awk' program too. - *Note Options::. - - * The 'igawk' program and its manual page are no longer installed - when 'gawk' is built. *Note Igawk Program::. - - * The 'intdiv()' function. *Note Numeric Functions::. - - * The maximum number of hexadecimal digits in '\x' escapes is now - two. *Note Escape Sequences::. - - * Nonfatal output with 'print' and 'printf'. *Note Nonfatal::. - - * For many years, POSIX specified that default field splitting only - allowed spaces and tabs to separate fields, and this was how 'gawk' - behaved with '--posix'. As of 2013, the standard restored - historical behavior, and now default field splitting with '--posix' - also allows newlines to separate fields. - - * Support for MirBSD was removed. - - * Support for GNU/Linux on Alpha was removed. - - -File: gawk.info, Node: Common Extensions, Next: Ranges and Locales, Prev: Feature History, Up: Language History - -A.7 Common Extensions Summary -============================= - -The following table summarizes the common extensions supported by -'gawk', Brian Kernighan's 'awk', and 'mawk', the three most widely used -freely available versions of 'awk' (*note Other Versions::). - -Feature BWK 'awk' 'mawk' 'gawk' Now standard --------------------------------------------------------------------------- -'\x' escape sequence X X X -'FS' as null string X X X -'/dev/stdin' special file X X X -'/dev/stdout' special file X X X -'/dev/stderr' special file X X X -'delete' without subscript X X X X -'fflush()' function X X X X -'length()' of an array X X X -'nextfile' statement X X X X -'**' and '**=' operators X X -'func' keyword X X -'BINMODE' variable X X -'RS' as regexp X X -Time-related functions X X - - -File: gawk.info, Node: Ranges and Locales, Next: Contributors, Prev: Common Extensions, Up: Language History - -A.8 Regexp Ranges and Locales: A Long Sad Story -=============================================== - -This minor node describes the confusing history of ranges within regular -expressions and their interactions with locales, and how this affected -different versions of 'gawk'. - - The original Unix tools that worked with regular expressions defined -character ranges (such as '[a-z]') to match any character between the -first character in the range and the last character in the range, -inclusive. Ordering was based on the numeric value of each character in -the machine's native character set. Thus, on ASCII-based systems, -'[a-z]' matched all the lowercase letters, and only the lowercase -letters, as the numeric values for the letters from 'a' through 'z' were -contiguous. (On an EBCDIC system, the range '[a-z]' includes additional -nonalphabetic characters as well.) - - Almost all introductory Unix literature explained range expressions -as working in this fashion, and in particular, would teach that the -"correct" way to match lowercase letters was with '[a-z]', and that -'[A-Z]' was the "correct" way to match uppercase letters. And indeed, -this was true.(1) - - The 1992 POSIX standard introduced the idea of locales (*note -Locales::). Because many locales include other letters besides the -plain 26 letters of the English alphabet, the POSIX standard added -character classes (*note Bracket Expressions::) as a way to match -different kinds of characters besides the traditional ones in the ASCII -character set. - - However, the standard _changed_ the interpretation of range -expressions. In the '"C"' and '"POSIX"' locales, a range expression -like '[a-dx-z]' is still equivalent to '[abcdxyz]', as in ASCII. But -outside those locales, the ordering was defined to be based on -"collation order". - - What does that mean? In many locales, 'A' and 'a' are both less than -'B'. In other words, these locales sort characters in dictionary order, -and '[a-dx-z]' is typically not equivalent to '[abcdxyz]'; instead, it -might be equivalent to '[ABCXYabcdxyz]', for example. - - This point needs to be emphasized: much literature teaches that you -should use '[a-z]' to match a lowercase character. But on systems with -non-ASCII locales, this also matches all of the uppercase characters -except 'A' or 'Z'! This was a continuous cause of confusion, even well -into the twenty-first century. - - To demonstrate these issues, the following example uses the 'sub()' -function, which does text replacement (*note String Functions::). Here, -the intent is to remove trailing uppercase characters: - - $ echo something1234abc | gawk-3.1.8 '{ sub("[A-Z]*$", ""); print }' - -| something1234a - -This output is unexpected, as the 'bc' at the end of 'something1234abc' -should not normally match '[A-Z]*'. This result is due to the locale -setting (and thus you may not see it on your system). - - Similar considerations apply to other ranges. For example, '["-/]' -is perfectly valid in ASCII, but is not valid in many Unicode locales, -such as 'en_US.UTF-8'. - - Early versions of 'gawk' used regexp matching code that was not -locale-aware, so ranges had their traditional interpretation. - - When 'gawk' switched to using locale-aware regexp matchers, the -problems began; especially as both GNU/Linux and commercial Unix vendors -started implementing non-ASCII locales, _and making them the default_. -Perhaps the most frequently asked question became something like, "Why -does '[A-Z]' match lowercase letters?!?" - - This situation existed for close to 10 years, if not more, and the -'gawk' maintainer grew weary of trying to explain that 'gawk' was being -nicely standards-compliant, and that the issue was in the user's locale. -During the development of version 4.0, he modified 'gawk' to always -treat ranges in the original, pre-POSIX fashion, unless '--posix' was -used (*note Options::).(2) - - Fortunately, shortly before the final release of 'gawk' 4.0, the -maintainer learned that the 2008 standard had changed the definition of -ranges, such that outside the '"C"' and '"POSIX"' locales, the meaning -of range expressions was _undefined_.(3) - - By using this lovely technical term, the standard gives license to -implementers to implement ranges in whatever way they choose. The -'gawk' maintainer chose to apply the pre-POSIX meaning both with the -default regexp matching and when '--traditional' or '--posix' are used. -In all cases 'gawk' remains POSIX-compliant. - - ---------- Footnotes ---------- - - (1) And Life was good. - - (2) And thus was born the Campaign for Rational Range Interpretation -(or RRI). A number of GNU tools have already implemented this change, or -will soon. Thanks to Karl Berry for coining the phrase "Rational Range -Interpretation." - - (3) See the standard -(http://pubs.opengroup.org/onlinepubs/9699919799/basedefs/V1_chap09.html#tag_09_03_05) -and its rationale -(http://pubs.opengroup.org/onlinepubs/9699919799/xrat/V4_xbd_chap09.html#tag_21_09_03_05). - - -File: gawk.info, Node: Contributors, Next: History summary, Prev: Ranges and Locales, Up: Language History - -A.9 Major Contributors to 'gawk' -================================ - - Always give credit where credit is due. - -- _Anonymous_ - - This minor node names the major contributors to 'gawk' and/or this -Info file, in approximate chronological order: - - * Dr. Alfred V. Aho, Dr. Peter J. Weinberger, and Dr. Brian W. - Kernighan, all of Bell Laboratories, designed and implemented Unix - 'awk', from which 'gawk' gets the majority of its feature set. - - * Paul Rubin did the initial design and implementation in 1986, and - wrote the first draft (around 40 pages) of this Info file. - - * Jay Fenlason finished the initial implementation. - - * Diane Close revised the first draft of this Info file, bringing it - to around 90 pages. - - * Richard Stallman helped finish the implementation and the initial - draft of this Info file. He is also the founder of the FSF and the - GNU Project. - - * John Woods contributed parts of the code (mostly fixes) in the - initial version of 'gawk'. - - * In 1988, David Trueman took over primary maintenance of 'gawk', - making it compatible with "new" 'awk', and greatly improving its - performance. - - * Conrad Kwok, Scott Garfinkle, and Kent Williams did the initial - ports to MS-DOS with various versions of MSC. - - * Pat Rankin provided the VMS port and its documentation. - - * Hal Peterson provided help in porting 'gawk' to Cray systems. - (This is no longer supported.) - - * Kai Uwe Rommel provided the initial port to OS/2 and its - documentation. - - * Michal Jaegermann provided the port to Atari systems and its - documentation. (This port is no longer supported.) He continues - to provide portability checking, and has done a lot of work to make - sure 'gawk' works on non-32-bit systems. - - * Fred Fish provided the port to Amiga systems and its documentation. - (With Fred's sad passing, this is no longer supported.) - - * Scott Deifik maintained the MS-DOS port using DJGPP. - - * Eli Zaretskii currently maintains the MS-Windows port using MinGW. - - * Juan Grigera provided a port to Windows32 systems. (This is no - longer supported.) - - * For many years, Dr. Darrel Hankerson acted as coordinator for the - various ports to different PC platforms and created binary - distributions for various PC operating systems. He was also - instrumental in keeping the documentation up to date for the - various PC platforms. - - * Christos Zoulas provided the 'extension()' built-in function for - dynamically adding new functions. (This was obsoleted at 'gawk' - 4.1.) - - * Ju"rgen Kahrs contributed the initial version of the TCP/IP - networking code and documentation, and motivated the inclusion of - the '|&' operator. - - * Stephen Davies provided the initial port to Tandem systems and its - documentation. (However, this is no longer supported.) He was - also instrumental in the initial work to integrate the byte-code - internals into the 'gawk' code base. - - * Matthew Woehlke provided improvements for Tandem's POSIX-compliant - systems. - - * Martin Brown provided the port to BeOS and its documentation. - (This is no longer supported.) - - * Arno Peters did the initial work to convert 'gawk' to use GNU - Automake and GNU 'gettext'. - - * Alan J. Broder provided the initial version of the 'asort()' - function as well as the code for the optional third argument to the - 'match()' function. - - * Andreas Buening updated the 'gawk' port for OS/2. - - * Isamu Hasegawa, of IBM in Japan, contributed support for multibyte - characters. - - * Michael Benzinger contributed the initial code for 'switch' - statements. - - * Patrick T.J. McPhee contributed the code for dynamic loading in - Windows32 environments. (This is no longer supported.) - - * Anders Wallin helped keep the VMS port going for several years. - - * Assaf Gordon contributed the code to implement the '--sandbox' - option. - - * John Haque made the following contributions: - - - The modifications to convert 'gawk' into a byte-code - interpreter, including the debugger - - - The addition of true arrays of arrays - - - The additional modifications for support of - arbitrary-precision arithmetic - - - The initial text of *note Arbitrary Precision Arithmetic:: - - - The work to merge the three versions of 'gawk' into one, for - the 4.1 release - - - Improved array internals for arrays indexed by integers - - - The improved array sorting features were also driven by John, - together with Pat Rankin - - * Panos Papadopoulos contributed the original text for *note Include - Files::. - - * Efraim Yawitz contributed the original text for *note Debugger::. - - * The development of the extension API first released with 'gawk' 4.1 - was driven primarily by Arnold Robbins and Andrew Schorr, with - notable contributions from the rest of the development team. - - * John Malmberg contributed significant improvements to the OpenVMS - port and the related documentation. - - * Antonio Giovanni Colombo rewrote a number of examples in the early - chapters that were severely dated, for which I am incredibly - grateful. - - * Arnold Robbins has been working on 'gawk' since 1988, at first - helping David Trueman, and as the primary maintainer since around - 1994. - - -File: gawk.info, Node: History summary, Prev: Contributors, Up: Language History - -A.10 Summary -============ - - * The 'awk' language has evolved over time. The first release was - with V7 Unix, circa 1978. In 1987, for System V Release 3.1, major - additions, including user-defined functions, were made to the - language. Additional changes were made for System V Release 4, in - 1989. Since then, further minor changes have happened under the - auspices of the POSIX standard. - - * Brian Kernighan's 'awk' provides a small number of extensions that - are implemented in common with other versions of 'awk'. - - * 'gawk' provides a large number of extensions over POSIX 'awk'. - They can be disabled with either the '--traditional' or '--posix' - options. - - * The interaction of POSIX locales and regexp matching in 'gawk' has - been confusing over the years. Today, 'gawk' implements Rational - Range Interpretation, where ranges of the form '[a-z]' match _only_ - the characters numerically between 'a' through 'z' in the machine's - native character set. Usually this is ASCII, but it can be EBCDIC - on IBM S/390 systems. - - * Many people have contributed to 'gawk' development over the years. - We hope that the list provided in this major node is complete and - gives the appropriate credit where credit is due. - - -File: gawk.info, Node: Installation, Next: Notes, Prev: Language History, Up: Top - -Appendix B Installing 'gawk' -**************************** - -This appendix provides instructions for installing 'gawk' on the various -platforms that are supported by the developers. The primary developer -supports GNU/Linux (and Unix), whereas the other ports are contributed. -*Note Bugs:: for the email addresses of the people who maintain the -respective ports. - -* Menu: - -* Gawk Distribution:: What is in the 'gawk' distribution. -* Unix Installation:: Installing 'gawk' under various - versions of Unix. -* Non-Unix Installation:: Installation on Other Operating Systems. -* Bugs:: Reporting Problems and Bugs. -* Other Versions:: Other freely available 'awk' - implementations. -* Installation summary:: Summary of installation. - - -File: gawk.info, Node: Gawk Distribution, Next: Unix Installation, Up: Installation - -B.1 The 'gawk' Distribution -=========================== - -This minor node describes how to get the 'gawk' distribution, how to -extract it, and then what is in the various files and subdirectories. - -* Menu: - -* Getting:: How to get the distribution. -* Extracting:: How to extract the distribution. -* Distribution contents:: What is in the distribution. - - -File: gawk.info, Node: Getting, Next: Extracting, Up: Gawk Distribution - -B.1.1 Getting the 'gawk' Distribution -------------------------------------- - -There are two ways to get GNU software: - - * Copy it from someone else who already has it. - - * Retrieve 'gawk' from the Internet host 'ftp.gnu.org', in the - directory '/gnu/gawk'. Both anonymous 'ftp' and 'http' access are - supported. If you have the 'wget' program, you can use a command - like the following: - - wget http://ftp.gnu.org/gnu/gawk/gawk-4.1.4.tar.gz - - The GNU software archive is mirrored around the world. The -up-to-date list of mirror sites is available from the main FSF website -(http://www.gnu.org/order/ftp.html). Try to use one of the mirrors; -they will be less busy, and you can usually find one closer to your -site. - - You may also retrieve the 'gawk' source code from the official Git -repository; for more information see *note Accessing The Source::. - - -File: gawk.info, Node: Extracting, Next: Distribution contents, Prev: Getting, Up: Gawk Distribution - -B.1.2 Extracting the Distribution ---------------------------------- - -'gawk' is distributed as several 'tar' files compressed with different -compression programs: 'gzip', 'bzip2', and 'xz'. For simplicity, the -rest of these instructions assume you are using the one compressed with -the GNU Gzip program ('gzip'). - - Once you have the distribution (e.g., 'gawk-4.1.4.tar.gz'), use -'gzip' to expand the file and then use 'tar' to extract it. You can use -the following pipeline to produce the 'gawk' distribution: - - gzip -d -c gawk-4.1.4.tar.gz | tar -xvpf - - - On a system with GNU 'tar', you can let 'tar' do the decompression -for you: - - tar -xvpzf gawk-4.1.4.tar.gz - -Extracting the archive creates a directory named 'gawk-4.1.4' in the -current directory. - - The distribution file name is of the form 'gawk-V.R.P.tar.gz'. The V -represents the major version of 'gawk', the R represents the current -release of version V, and the P represents a "patch level", meaning that -minor bugs have been fixed in the release. The current patch level is -4, but when retrieving distributions, you should get the version with -the highest version, release, and patch level. (Note, however, that -patch levels greater than or equal to 70 denote "beta" or nonproduction -software; you might not want to retrieve such a version unless you don't -mind experimenting.) If you are not on a Unix or GNU/Linux system, you -need to make other arrangements for getting and extracting the 'gawk' -distribution. You should consult a local expert. - - -File: gawk.info, Node: Distribution contents, Prev: Extracting, Up: Gawk Distribution - -B.1.3 Contents of the 'gawk' Distribution ------------------------------------------ - -The 'gawk' distribution has a number of C source files, documentation -files, subdirectories, and files related to the configuration process -(*note Unix Installation::), as well as several subdirectories related -to different non-Unix operating systems: - -Various '.c', '.y', and '.h' files - These files contain the actual 'gawk' source code. - -'ABOUT-NLS' - A file containing information about GNU 'gettext' and translations. - -'AUTHORS' - A file with some information about the authorship of 'gawk'. It - exists only to satisfy the pedants at the Free Software Foundation. - -'README' -'README_d/README.*' - Descriptive files: 'README' for 'gawk' under Unix and the rest for - the various hardware and software combinations. - -'INSTALL' - A file providing an overview of the configuration and installation - process. - -'ChangeLog' - A detailed list of source code changes as bugs are fixed or - improvements made. - -'ChangeLog.0' - An older list of source code changes. - -'NEWS' - A list of changes to 'gawk' since the last release or patch. - -'NEWS.0' - An older list of changes to 'gawk'. - -'COPYING' - The GNU General Public License. - -'POSIX.STD' - A description of behaviors in the POSIX standard for 'awk' that are - left undefined, or where 'gawk' may not comply fully, as well as a - list of things that the POSIX standard should describe but does - not. - -'doc/awkforai.txt' - Pointers to the original draft of a short article describing why - 'gawk' is a good language for artificial intelligence (AI) - programming. - -'doc/bc_notes' - A brief description of 'gawk''s "byte code" internals. - -'doc/README.card' -'doc/ad.block' -'doc/awkcard.in' -'doc/cardfonts' -'doc/colors' -'doc/macros' -'doc/no.colors' -'doc/setter.outline' - The 'troff' source for a five-color 'awk' reference card. A modern - version of 'troff' such as GNU 'troff' ('groff') is needed to - produce the color version. See the file 'README.card' for - instructions if you have an older 'troff'. - -'doc/gawk.1' - The 'troff' source for a manual page describing 'gawk'. This is - distributed for the convenience of Unix users. - -'doc/gawktexi.in' -'doc/sidebar.awk' - The Texinfo source file for this Info file. It should be processed - by 'doc/sidebar.awk' before processing with 'texi2dvi' or - 'texi2pdf' to produce a printed document, and with 'makeinfo' to - produce an Info or HTML file. The 'Makefile' takes care of this - processing and produces printable output via 'texi2dvi' or - 'texi2pdf'. - -'doc/gawk.texi' - The file produced after processing 'gawktexi.in' with - 'sidebar.awk'. - -'doc/gawk.info' - The generated Info file for this Info file. - -'doc/gawkinet.texi' - The Texinfo source file for *note (General Introduction, gawkinet, - TCP/IP Internetworking with 'gawk')Top::. It should be processed - with TeX (via 'texi2dvi' or 'texi2pdf') to produce a printed - document and with 'makeinfo' to produce an Info or HTML file. - -'doc/gawkinet.info' - The generated Info file for 'TCP/IP Internetworking with 'gawk''. - -'doc/igawk.1' - The 'troff' source for a manual page describing the 'igawk' program - presented in *note Igawk Program::. (Since 'gawk' can do its own - '@include' processing, neither 'igawk' nor 'igawk.1' are - installed.) - -'doc/Makefile.in' - The input file used during the configuration process to generate - the actual 'Makefile' for creating the documentation. - -'Makefile.am' -'*/Makefile.am' - Files used by the GNU Automake software for generating the - 'Makefile.in' files used by Autoconf and 'configure'. - -'Makefile.in' -'aclocal.m4' -'bisonfix.awk' -'config.guess' -'configh.in' -'configure.ac' -'configure' -'custom.h' -'depcomp' -'install-sh' -'missing_d/*' -'mkinstalldirs' -'m4/*' - These files and subdirectories are used when configuring and - compiling 'gawk' for various Unix systems. Most of them are - explained in *note Unix Installation::. The rest are there to - support the main infrastructure. - -'po/*' - The 'po' library contains message translations. - -'awklib/extract.awk' -'awklib/Makefile.am' -'awklib/Makefile.in' -'awklib/eg/*' - The 'awklib' directory contains a copy of 'extract.awk' (*note - Extract Program::), which can be used to extract the sample - programs from the Texinfo source file for this Info file. It also - contains a 'Makefile.in' file, which 'configure' uses to generate a - 'Makefile'. 'Makefile.am' is used by GNU Automake to create - 'Makefile.in'. The library functions from *note Library - Functions::, are included as ready-to-use files in the 'gawk' - distribution. They are installed as part of the installation - process. The rest of the programs in this Info file are available - in appropriate subdirectories of 'awklib/eg'. - -'extension/*' - The source code, manual pages, and infrastructure files for the - sample extensions included with 'gawk'. *Note Dynamic - Extensions::, for more information. - -'extras/*' - Additional non-essential files. Currently, this directory contains - some shell startup files to be installed in '/etc/profile.d' to aid - in manipulating the 'AWKPATH' and 'AWKLIBPATH' environment - variables. *Note Shell Startup Files::, for more information. - -'posix/*' - Files needed for building 'gawk' on POSIX-compliant systems. - -'pc/*' - Files needed for building 'gawk' under MS-Windows (*note PC - Installation:: for details). - -'vms/*' - Files needed for building 'gawk' under Vax/VMS and OpenVMS (*note - VMS Installation:: for details). - -'test/*' - A test suite for 'gawk'. You can use 'make check' from the - top-level 'gawk' directory to run your version of 'gawk' against - the test suite. If 'gawk' successfully passes 'make check', then - you can be confident of a successful port. - - -File: gawk.info, Node: Unix Installation, Next: Non-Unix Installation, Prev: Gawk Distribution, Up: Installation - -B.2 Compiling and Installing 'gawk' on Unix-Like Systems -======================================================== - -Usually, you can compile and install 'gawk' by typing only two commands. -However, if you use an unusual system, you may need to configure 'gawk' -for your system yourself. - -* Menu: - -* Quick Installation:: Compiling 'gawk' under Unix. -* Shell Startup Files:: Shell convenience functions. -* Additional Configuration Options:: Other compile-time options. -* Configuration Philosophy:: How it's all supposed to work. - - -File: gawk.info, Node: Quick Installation, Next: Shell Startup Files, Up: Unix Installation - -B.2.1 Compiling 'gawk' for Unix-Like Systems --------------------------------------------- - -The normal installation steps should work on all modern commercial -Unix-derived systems, GNU/Linux, BSD-based systems, and the Cygwin -environment for MS-Windows. - - After you have extracted the 'gawk' distribution, 'cd' to -'gawk-4.1.4'. As with most GNU software, you configure 'gawk' for your -system by running the 'configure' program. This program is a Bourne -shell script that is generated automatically using GNU Autoconf. (The -Autoconf software is described fully starting with *note (Autoconf, -autoconf,Autoconf---Generating Automatic Configuration Scripts)Top::.) - - To configure 'gawk', simply run 'configure': - - sh ./configure - - This produces a 'Makefile' and 'config.h' tailored to your system. -The 'config.h' file describes various facts about your system. You -might want to edit the 'Makefile' to change the 'CFLAGS' variable, which -controls the command-line options that are passed to the C compiler -(such as optimization levels or compiling for debugging). - - Alternatively, you can add your own values for most 'make' variables -on the command line, such as 'CC' and 'CFLAGS', when running -'configure': - - CC=cc CFLAGS=-g sh ./configure - -See the file 'INSTALL' in the 'gawk' distribution for all the details. - - After you have run 'configure' and possibly edited the 'Makefile', -type: - - make - -Shortly thereafter, you should have an executable version of 'gawk'. -That's all there is to it! To verify that 'gawk' is working properly, -run 'make check'. All of the tests should succeed. If these steps do -not work, or if any of the tests fail, check the files in the 'README_d' -directory to see if you've found a known problem. If the failure is not -described there, send in a bug report (*note Bugs::). - - Of course, once you've built 'gawk', it is likely that you will wish -to install it. To do so, you need to run the command 'make install', as -a user with the appropriate permissions. How to do this varies by -system, but on many systems you can use the 'sudo' command to do so. -The command then becomes 'sudo make install'. It is likely that you -will be asked for your password, and you will have to have been set up -previously as a user who is allowed to run the 'sudo' command. - - -File: gawk.info, Node: Shell Startup Files, Next: Additional Configuration Options, Prev: Quick Installation, Up: Unix Installation - -B.2.2 Shell Startup Files -------------------------- - -The distribution contains shell startup files 'gawk.sh' and 'gawk.csh' -containing functions to aid in manipulating the 'AWKPATH' and -'AWKLIBPATH' environment variables. On a Fedora system, these files -should be installed in '/etc/profile.d'; on other platforms, the -appropriate location may be different. - -'gawkpath_default' - Reset the 'AWKPATH' environment variable to its default value. - -'gawkpath_prepend' - Add the argument to the front of the 'AWKPATH' environment - variable. - -'gawkpath_append' - Add the argument to the end of the 'AWKPATH' environment variable. - -'gawklibpath_default' - Reset the 'AWKLIBPATH' environment variable to its default value. - -'gawklibpath_prepend' - Add the argument to the front of the 'AWKLIBPATH' environment - variable. - -'gawklibpath_append' - Add the argument to the end of the 'AWKLIBPATH' environment - variable. - - -File: gawk.info, Node: Additional Configuration Options, Next: Configuration Philosophy, Prev: Shell Startup Files, Up: Unix Installation - -B.2.3 Additional Configuration Options --------------------------------------- - -There are several additional options you may use on the 'configure' -command line when compiling 'gawk' from scratch, including: - -'--disable-extensions' - Disable configuring and building the sample extensions in the - 'extension' directory. This is useful for cross-compiling. The - default action is to dynamically check if the extensions can be - configured and compiled. - -'--disable-lint' - Disable all lint checking within 'gawk'. The '--lint' and - '--lint-old' options (*note Options::) are accepted, but silently - do nothing. Similarly, setting the 'LINT' variable (*note - User-modified::) has no effect on the running 'awk' program. - - When used with the GNU Compiler Collection's (GCC's) automatic - dead-code-elimination, this option cuts almost 23K bytes off the - size of the 'gawk' executable on GNU/Linux x86_64 systems. Results - on other systems and with other compilers are likely to vary. - Using this option may bring you some slight performance - improvement. - - CAUTION: Using this option will cause some of the tests in the - test suite to fail. This option may be removed at a later - date. - -'--disable-nls' - Disable all message-translation facilities. This is usually not - desirable, but it may bring you some slight performance - improvement. - -'--with-whiny-user-strftime' - Force use of the included version of the C 'strftime()' function - for deficient systems. - - Use the command './configure --help' to see the full list of options -supplied by 'configure'. - - -File: gawk.info, Node: Configuration Philosophy, Prev: Additional Configuration Options, Up: Unix Installation - -B.2.4 The Configuration Process -------------------------------- - -This minor node is of interest only if you know something about using -the C language and Unix-like operating systems. - - The source code for 'gawk' generally attempts to adhere to formal -standards wherever possible. This means that 'gawk' uses library -routines that are specified by the ISO C standard and by the POSIX -operating system interface standard. The 'gawk' source code requires -using an ISO C compiler (the 1990 standard). - - Many Unix systems do not support all of either the ISO or the POSIX -standards. The 'missing_d' subdirectory in the 'gawk' distribution -contains replacement versions of those functions that are most likely to -be missing. - - The 'config.h' file that 'configure' creates contains definitions -that describe features of the particular operating system where you are -attempting to compile 'gawk'. The three things described by this file -are: what header files are available, so that they can be correctly -included, what (supposedly) standard functions are actually available in -your C libraries, and various miscellaneous facts about your operating -system. For example, there may not be an 'st_blksize' element in the -'stat' structure. In this case, 'HAVE_STRUCT_STAT_ST_BLKSIZE' is -undefined. - - It is possible for your C compiler to lie to 'configure'. It may do -so by not exiting with an error when a library function is not -available. To get around this, edit the 'custom.h' file. Use an -'#ifdef' that is appropriate for your system, and either '#define' any -constants that 'configure' should have defined but didn't, or '#undef' -any constants that 'configure' defined and should not have. The -'custom.h' file is automatically included by the 'config.h' file. - - It is also possible that the 'configure' program generated by -Autoconf will not work on your system in some other fashion. If you do -have a problem, the 'configure.ac' file is the input for Autoconf. You -may be able to change this file and generate a new version of -'configure' that works on your system (*note Bugs:: for information on -how to report problems in configuring 'gawk'). The same mechanism may -be used to send in updates to 'configure.ac' and/or 'custom.h'. - - -File: gawk.info, Node: Non-Unix Installation, Next: Bugs, Prev: Unix Installation, Up: Installation - -B.3 Installation on Other Operating Systems -=========================================== - -This minor node describes how to install 'gawk' on various non-Unix -systems. - -* Menu: - -* PC Installation:: Installing and Compiling 'gawk' on - Microsoft Windows. -* VMS Installation:: Installing 'gawk' on VMS. - - -File: gawk.info, Node: PC Installation, Next: VMS Installation, Up: Non-Unix Installation - -B.3.1 Installation on MS-Windows --------------------------------- - -This minor node covers installation and usage of 'gawk' on Intel -architecture machines running any version of MS-Windows. In this minor -node, the term "Windows32" refers to any of Microsoft Windows -95/98/ME/NT/2000/XP/Vista/7/8/10. - - See also the 'README_d/README.pc' file in the distribution. - -* Menu: - -* PC Binary Installation:: Installing a prepared distribution. -* PC Compiling:: Compiling 'gawk' for Windows32. -* PC Using:: Running 'gawk' on Windows32. -* Cygwin:: Building and running 'gawk' for - Cygwin. -* MSYS:: Using 'gawk' In The MSYS Environment. - - -File: gawk.info, Node: PC Binary Installation, Next: PC Compiling, Up: PC Installation - -B.3.1.1 Installing a Prepared Distribution for MS-Windows Systems -................................................................. - -The only supported binary distribution for MS-Windows systems is that -provided by Eli Zaretskii's "ezwinports" -(https://sourceforge.net/projects/ezwinports/) project. Install the -compiled 'gawk' from there. - - -File: gawk.info, Node: PC Compiling, Next: PC Using, Prev: PC Binary Installation, Up: PC Installation - -B.3.1.2 Compiling 'gawk' for PC Operating Systems -................................................. - -'gawk' can be compiled for Windows32 using MinGW (Windows32). The file -'README_d/README.pc' in the 'gawk' distribution contains additional -notes, and 'pc/Makefile' contains important information on compilation -options. - - To build 'gawk' for Windows32, copy the files in the 'pc' directory -(_except_ for 'ChangeLog') to the directory with the rest of the 'gawk' -sources, then invoke 'make' with the appropriate target name as an -argument to build 'gawk'. The 'Makefile' copied from the 'pc' directory -contains a configuration section with comments and may need to be edited -in order to work with your 'make' utility. - - The 'Makefile' supports a number of targets for building various -MS-DOS and Windows32 versions. A list of targets is printed if the -'make' command is given without a target. As an example, to build a -native MS-Windows binary of 'gawk' using the MinGW tools, type 'make -mingw32'. - - -File: gawk.info, Node: PC Using, Next: Cygwin, Prev: PC Compiling, Up: PC Installation - -B.3.1.3 Using 'gawk' on PC Operating Systems -............................................ - -Under MS-Windows, the Cygwin and MinGW environments support both the -'|&' operator and TCP/IP networking (*note TCP/IP Networking::). - - The MS-Windows version of 'gawk' searches for program files as -described in *note AWKPATH Variable::. However, semicolons (rather than -colons) separate elements in the 'AWKPATH' variable. If 'AWKPATH' is -not set or is empty, then the default search path is -'.;c:/lib/awk;c:/gnu/lib/awk'. - - Under MS-Windows, 'gawk' (and many other text programs) silently -translates end-of-line '\r\n' to '\n' on input and '\n' to '\r\n' on -output. A special 'BINMODE' variable (c.e.) allows control over these -translations and is interpreted as follows: - - * If 'BINMODE' is '"r"' or one, then binary mode is set on read - (i.e., no translations on reads). - - * If 'BINMODE' is '"w"' or two, then binary mode is set on write - (i.e., no translations on writes). - - * If 'BINMODE' is '"rw"' or '"wr"' or three, binary mode is set for - both read and write. - - * 'BINMODE=NON-NULL-STRING' is the same as 'BINMODE=3' (i.e., no - translations on reads or writes). However, 'gawk' issues a warning - message if the string is not one of '"rw"' or '"wr"'. - -The modes for standard input and standard output are set one time only -(after the command line is read, but before processing any of the 'awk' -program). Setting 'BINMODE' for standard input or standard output is -accomplished by using an appropriate '-v BINMODE=N' option on the -command line. 'BINMODE' is set at the time a file or pipe is opened and -cannot be changed midstream. - - The name 'BINMODE' was chosen to match 'mawk' (*note Other -Versions::). 'mawk' and 'gawk' handle 'BINMODE' similarly; however, -'mawk' adds a '-W BINMODE=N' option and an environment variable that can -set 'BINMODE', 'RS', and 'ORS'. The files 'binmode[1-3].awk' (under -'gnu/lib/awk' in some of the prepared binary distributions) have been -chosen to match 'mawk''s '-W BINMODE=N' option. These can be changed or -discarded; in particular, the setting of 'RS' giving the fewest -"surprises" is open to debate. 'mawk' uses 'RS = "\r\n"' if binary mode -is set on read, which is appropriate for files with the MS-DOS-style -end-of-line. - - To illustrate, the following examples set binary mode on writes for -standard output and other files, and set 'ORS' as the "usual" -MS-DOS-style end-of-line: - - gawk -v BINMODE=2 -v ORS="\r\n" ... - -or: - - gawk -v BINMODE=w -f binmode2.awk ... - -These give the same result as the '-W BINMODE=2' option in 'mawk'. The -following changes the record separator to '"\r\n"' and sets binary mode -on reads, but does not affect the mode on standard input: - - gawk -v RS="\r\n" -e "BEGIN { BINMODE = 1 }" ... - -or: - - gawk -f binmode1.awk ... - -With proper quoting, in the first example the setting of 'RS' can be -moved into the 'BEGIN' rule. - - -File: gawk.info, Node: Cygwin, Next: MSYS, Prev: PC Using, Up: PC Installation - -B.3.1.4 Using 'gawk' In The Cygwin Environment -.............................................. - -'gawk' can be built and used "out of the box" under MS-Windows if you -are using the Cygwin environment (http://www.cygwin.com). This -environment provides an excellent simulation of GNU/Linux, using Bash, -GCC, GNU Make, and other GNU programs. Compilation and installation for -Cygwin is the same as for a Unix system: - - tar -xvpzf gawk-4.1.4.tar.gz - cd gawk-4.1.4 - ./configure - make && make check - - When compared to GNU/Linux on the same system, the 'configure' step -on Cygwin takes considerably longer. However, it does finish, and then -the 'make' proceeds as usual. - - -File: gawk.info, Node: MSYS, Prev: Cygwin, Up: PC Installation - -B.3.1.5 Using 'gawk' In The MSYS Environment -............................................ - -In the MSYS environment under MS-Windows, 'gawk' automatically uses -binary mode for reading and writing files. Thus, there is no need to -use the 'BINMODE' variable. - - This can cause problems with other Unix-like components that have -been ported to MS-Windows that expect 'gawk' to do automatic translation -of '"\r\n"', because it won't. - - -File: gawk.info, Node: VMS Installation, Prev: PC Installation, Up: Non-Unix Installation - -B.3.2 Compiling and Installing 'gawk' on Vax/VMS and OpenVMS ------------------------------------------------------------- - -This node describes how to compile and install 'gawk' under VMS. The -older designation "VMS" is used throughout to refer to OpenVMS. - -* Menu: - -* VMS Compilation:: How to compile 'gawk' under VMS. -* VMS Dynamic Extensions:: Compiling 'gawk' dynamic extensions on - VMS. -* VMS Installation Details:: How to install 'gawk' under VMS. -* VMS Running:: How to run 'gawk' under VMS. -* VMS GNV:: The VMS GNV Project. -* VMS Old Gawk:: An old version comes with some VMS systems. - - -File: gawk.info, Node: VMS Compilation, Next: VMS Dynamic Extensions, Up: VMS Installation - -B.3.2.1 Compiling 'gawk' on VMS -............................... - -To compile 'gawk' under VMS, there is a 'DCL' command procedure that -issues all the necessary 'CC' and 'LINK' commands. There is also a -'Makefile' for use with the 'MMS' and 'MMK' utilities. From the source -directory, use either: - - $ @[.vms]vmsbuild.com - -or: - - $ MMS/DESCRIPTION=[.vms]descrip.mms gawk - -or: - - $ MMK/DESCRIPTION=[.vms]descrip.mms gawk - - 'MMK' is an open source, free, near-clone of 'MMS' and can better -handle ODS-5 volumes with upper- and lowercase file names. 'MMK' is -available from <https://github.com/endlesssoftware/mmk>. - - With ODS-5 volumes and extended parsing enabled, the case of the -target parameter may need to be exact. - - 'gawk' has been tested under VAX/VMS 7.3 and Alpha/VMS 7.3-1 using -Compaq C V6.4, and under Alpha/VMS 7.3, Alpha/VMS 7.3-2, and IA64/VMS -8.3. The most recent builds used HP C V7.3 on Alpha VMS 8.3 and both -Alpha and IA64 VMS 8.4 used HP C 7.3.(1) - - *Note VMS GNV:: for information on building 'gawk' as a PCSI kit that -is compatible with the GNV product. - - ---------- Footnotes ---------- - - (1) The IA64 architecture is also known as "Itanium." - - -File: gawk.info, Node: VMS Dynamic Extensions, Next: VMS Installation Details, Prev: VMS Compilation, Up: VMS Installation - -B.3.2.2 Compiling 'gawk' Dynamic Extensions on VMS -.................................................. - -The extensions that have been ported to VMS can be built using one of -the following commands: - - $ MMS/DESCRIPTION=[.vms]descrip.mms extensions - -or: - - $ MMK/DESCRIPTION=[.vms]descrip.mms extensions - - 'gawk' uses 'AWKLIBPATH' as either an environment variable or a -logical name to find the dynamic extensions. - - Dynamic extensions need to be compiled with the same compiler options -for floating-point, pointer size, and symbol name handling as were used -to compile 'gawk' itself. Alpha and Itanium should use IEEE floating -point. The pointer size is 32 bits, and the symbol name handling should -be exact case with CRC shortening for symbols longer than 32 bits. - - For Alpha and Itanium: - - /name=(as_is,short) - /float=ieee/ieee_mode=denorm_results - - For VAX: - - /name=(as_is,short) - - Compile-time macros need to be defined before the first VMS-supplied -header file is included, as follows: - - #if (__CRTL_VER >= 70200000) && !defined (__VAX) - #define _LARGEFILE 1 - #endif - - #ifndef __VAX - #ifdef __CRTL_VER - #if __CRTL_VER >= 80200000 - #define _USE_STD_STAT 1 - #endif - #endif - #endif - - If you are writing your own extensions to run on VMS, you must supply -these definitions yourself. The 'config.h' file created when building -'gawk' on VMS does this for you; if instead you use that file or a -similar one, then you must remember to include it before any -VMS-supplied header files. - - -File: gawk.info, Node: VMS Installation Details, Next: VMS Running, Prev: VMS Dynamic Extensions, Up: VMS Installation - -B.3.2.3 Installing 'gawk' on VMS -................................ - -To use 'gawk', all you need is a "foreign" command, which is a 'DCL' -symbol whose value begins with a dollar sign. For example: - - $ GAWK :== $disk1:[gnubin]gawk - -Substitute the actual location of 'gawk.exe' for '$disk1:[gnubin]'. The -symbol should be placed in the 'login.com' of any user who wants to run -'gawk', so that it is defined every time the user logs on. -Alternatively, the symbol may be placed in the system-wide 'sylogin.com' -procedure, which allows all users to run 'gawk'. - - If your 'gawk' was installed by a PCSI kit into the 'GNV$GNU:' -directory tree, the program will be known as 'GNV$GNU:[bin]gnv$gawk.exe' -and the help file will be 'GNV$GNU:[vms_help]gawk.hlp'. - - The PCSI kit also installs a 'GNV$GNU:[vms_bin]gawk_verb.cld' file -that can be used to add 'gawk' and 'awk' as DCL commands. - - For just the current process you can use: - - $ set command gnv$gnu:[vms_bin]gawk_verb.cld - - Or the system manager can use 'GNV$GNU:[vms_bin]gawk_verb.cld' to add -the 'gawk' and 'awk' to the system-wide 'DCLTABLES'. - - The DCL syntax is documented in the 'gawk.hlp' file. - - Optionally, the 'gawk.hlp' entry can be loaded into a VMS help -library: - - $ LIBRARY/HELP sys$help:helplib [.vms]gawk.hlp - -(You may want to substitute a site-specific help library rather than the -standard VMS library 'HELPLIB'.) After loading the help text, the -command: - - $ HELP GAWK - -provides information about both the 'gawk' implementation and the 'awk' -programming language. - - The logical name 'AWK_LIBRARY' can designate a default location for -'awk' program files. For the '-f' option, if the specified file name -has no device or directory path information in it, 'gawk' looks in the -current directory first, then in the directory specified by the -translation of 'AWK_LIBRARY' if the file is not found. If, after -searching in both directories, the file still is not found, 'gawk' -appends the suffix '.awk' to the file name and retries the file search. -If 'AWK_LIBRARY' has no definition, a default value of 'SYS$LIBRARY:' is -used for it. - - -File: gawk.info, Node: VMS Running, Next: VMS GNV, Prev: VMS Installation Details, Up: VMS Installation - -B.3.2.4 Running 'gawk' on VMS -............................. - -Command-line parsing and quoting conventions are significantly different -on VMS, so examples in this Info file or from other sources often need -minor changes. They _are_ minor though, and all 'awk' programs should -run correctly. - - Here are a couple of trivial tests: - - $ gawk -- "BEGIN {print ""Hello, World!""}" - $ gawk -"W" version - ! could also be -"W version" or "-W version" - -Note that uppercase and mixed-case text must be quoted. - - The VMS port of 'gawk' includes a 'DCL'-style interface in addition -to the original shell-style interface (see the help entry for details). -One side effect of dual command-line parsing is that if there is only a -single parameter (as in the quoted string program), the command becomes -ambiguous. To work around this, the normally optional '--' flag is -required to force Unix-style parsing rather than 'DCL' parsing. If any -other dash-type options (or multiple parameters such as data files to -process) are present, there is no ambiguity and '--' can be omitted. - - The 'exit' value is a Unix-style value and is encoded into a VMS exit -status value when the program exits. - - The VMS severity bits will be set based on the 'exit' value. A -failure is indicated by 1, and VMS sets the 'ERROR' status. A fatal -error is indicated by 2, and VMS sets the 'FATAL' status. All other -values will have the 'SUCCESS' status. The exit value is encoded to -comply with VMS coding standards and will have the 'C_FACILITY_NO' of -'0x350000' with the constant '0xA000' added to the number shifted over -by 3 bits to make room for the severity codes. - - To extract the actual 'gawk' exit code from the VMS status, use: - - unix_status = (vms_status .and. %x7f8) / 8 - -A C program that uses 'exec()' to call 'gawk' will get the original -Unix-style exit value. - - Older versions of 'gawk' for VMS treated a Unix exit code 0 as 1, a -failure as 2, a fatal error as 4, and passed all the other numbers -through. This violated the VMS exit status coding requirements. - - VAX/VMS floating point uses unbiased rounding. *Note Round -Function::. - - VMS reports time values in GMT unless one of the 'SYS$TIMEZONE_RULE' -or 'TZ' logical names is set. Older versions of VMS, such as VAX/VMS -7.3, do not set these logical names. - - The default search path, when looking for 'awk' program files -specified by the '-f' option, is '"SYS$DISK:[],AWK_LIBRARY:"'. The -logical name 'AWKPATH' can be used to override this default. The format -of 'AWKPATH' is a comma-separated list of directory specifications. -When defining it, the value should be quoted so that it retains a single -translation and not a multitranslation 'RMS' searchlist. - - This restriction also applies to running 'gawk' under GNV, as -redirection is always to a DCL command. - - If you are redirecting data to a VMS command or utility, the current -implementation requires that setting up a VMS foreign command that runs -a command file before invoking 'gawk'. (This restriction may be removed -in a future release of 'gawk' on VMS.) - - Without this command file, the input data will also appear prepended -to the output data. - - This also allows simulating POSIX commands that are not found on VMS -or the use of GNV utilities. - - The example below is for 'gawk' redirecting data to the VMS 'sort' -command. - - $ sort = "@device:[dir]vms_gawk_sort.com" - - The command file needs to be of the format in the example below. - - The first line inhibits the passed input data from also showing up in -the output. It must be in the format in the example. - - The next line creates a foreign command that overrides the outer -foreign command which prevents an infinite recursion of command files. - - The next to the last command redirects 'sys$input' to be -'sys$command', in order to pick up the data that is being redirected to -the command. - - The last line runs the actual command. It must be the last command -as the data redirected from 'gawk' will be read when the command file -ends. - - $!'f$verify(0,0)' - $ sort := sort - $ define/user sys$input sys$command: - $ sort sys$input: sys$output: - - -File: gawk.info, Node: VMS GNV, Next: VMS Old Gawk, Prev: VMS Running, Up: VMS Installation - -B.3.2.5 The VMS GNV Project -........................... - -The VMS GNV package provides a build environment similar to POSIX with -ports of a collection of open source tools. The 'gawk' found in the GNV -base kit is an older port. Currently, the GNV project is being -reorganized to supply individual PCSI packages for each component. See -<https://sourceforge.net/p/gnv/wiki/InstallingGNVPackages/>. - - The normal build procedure for 'gawk' produces a program that is -suitable for use with GNV. - - The file 'vms/gawk_build_steps.txt' in the distribution documents the -procedure for building a VMS PCSI kit that is compatible with GNV. - - -File: gawk.info, Node: VMS Old Gawk, Prev: VMS GNV, Up: VMS Installation - -B.3.2.6 Some VMS Systems Have An Old Version of 'gawk' -...................................................... - -Some versions of VMS have an old version of 'gawk'. To access it, -define a symbol, as follows: - - $ gawk :== $sys$common:[syshlp.examples.tcpip.snmp]gawk.exe - - This is apparently version 2.15.6, which is extremely old. We -recommend compiling and using the current version. - - -File: gawk.info, Node: Bugs, Next: Other Versions, Prev: Non-Unix Installation, Up: Installation - -B.4 Reporting Problems and Bugs -=============================== - - There is nothing more dangerous than a bored archaeologist. - -- _Douglas Adams, 'The Hitchhiker's Guide to the Galaxy'_ - - If you have problems with 'gawk' or think that you have found a bug, -report it to the developers; we cannot promise to do anything, but we -might well want to fix it. - -* Menu: - -* Bug address:: Where to send reports to. -* Usenet:: Where not to send reports to. -* Maintainers:: Maintainers of non-*nix ports. - - -File: gawk.info, Node: Bug address, Next: Usenet, Up: Bugs - -B.4.1 Submitting Bug Reports ----------------------------- - -Before reporting a bug, make sure you have really found a genuine bug. -Carefully reread the documentation and see if it says you can do what -you're trying to do. If it's not clear whether you should be able to do -something or not, report that too; it's a bug in the documentation! - - Before reporting a bug or trying to fix it yourself, try to isolate -it to the smallest possible 'awk' program and input data file that -reproduce the problem. Then send us the program and data file, some -idea of what kind of Unix system you're using, the compiler you used to -compile 'gawk', and the exact results 'gawk' gave you. Also say what -you expected to occur; this helps us decide whether the problem is -really in the documentation. - - Make sure to include the version number of 'gawk' you are using. You -can get this information with the command 'gawk --version'. - - Once you have a precise problem description, send email to -<bug-gawk@gnu.org>. - - The 'gawk' maintainers subscribe to this address, and thus they will -receive your bug report. Although you can send mail to the maintainers -directly, the bug reporting address is preferred because the email list -is archived at the GNU Project. _All email must be in English. This is -the only language understood in common by all the maintainers._ In -addition, please be sure to send all mail in _plain text_, not (or not -exclusively) in HTML. - - NOTE: Many distributions of GNU/Linux and the various BSD-based - operating systems have their own bug reporting systems. If you - report a bug using your distribution's bug reporting system, you - should also send a copy to <bug-gawk@gnu.org>. - - This is for two reasons. First, although some distributions - forward bug reports "upstream" to the GNU mailing list, many don't, - so there is a good chance that the 'gawk' maintainers won't even - see the bug report! Second, mail to the GNU list is archived, and - having everything at the GNU Project keeps things self-contained - and not dependent on other organizations. - - Non-bug suggestions are always welcome as well. If you have -questions about things that are unclear in the documentation or are just -obscure features, ask on the bug list; we will try to help you out if we -can. - - -File: gawk.info, Node: Usenet, Next: Maintainers, Prev: Bug address, Up: Bugs - -B.4.2 Please Don't Post Bug Reports to USENET ---------------------------------------------- - - I gave up on Usenet a couple of years ago and haven't really looked - back. It's like sports talk radio--you feel smarter for not having - read it. - -- _Chet Ramey_ - - Please do _not_ try to report bugs in 'gawk' by posting to the -Usenet/Internet newsgroup 'comp.lang.awk'. Although some of the 'gawk' -developers occasionally read this newgroup, the primary 'gawk' -maintainer no longer does. Thus it's virtually guaranteed that he will -_not_ see your posting. The steps described here are the only -officially recognized way for reporting bugs. Really. - - -File: gawk.info, Node: Maintainers, Prev: Usenet, Up: Bugs - -B.4.3 Reporting Problems with Non-Unix Ports --------------------------------------------- - -If you find bugs in one of the non-Unix ports of 'gawk', send an email -to the bug list, with a copy to the person who maintains that port. The -maintainers are named in the following list, as well as in the 'README' -file in the 'gawk' distribution. Information in the 'README' file -should be considered authoritative if it conflicts with this Info file. - - The people maintaining the various 'gawk' ports are: - -Unix and POSIX Arnold Robbins, <arnold@skeeve.com> -systems -MS-Windows with MinGW Eli Zaretskii, <eliz@gnu.org> - -OS/2 Andreas Buening, <andreas.buening@nexgo.de> - -VMS John Malmberg, <wb8tyw@qsl.net> - -z/OS (OS/390) Daniel Richard G. <skunk@iSKUNK.ORG> - Dave Pitts (Maintainer Emeritus), <dpitts@cozx.com> - - If your bug is also reproducible under Unix, send a copy of your -report to the <bug-gawk@gnu.org> email list as well. - - The DJGPP port is no longer supported; it will remain in the code -base for a while in case a volunteer wishes to take it over. If this -does not happen, then eventually code for this port will be removed. - - -File: gawk.info, Node: Other Versions, Next: Installation summary, Prev: Bugs, Up: Installation - -B.5 Other Freely Available 'awk' Implementations -================================================ - - It's kind of fun to put comments like this in your awk code: - '// Do C++ comments work? answer: yes! of course' - -- _Michael Brennan_ - - There are a number of other freely available 'awk' implementations. -This minor node briefly describes where to get them: - -Unix 'awk' - Brian Kernighan, one of the original designers of Unix 'awk', has - made his implementation of 'awk' freely available. You can - retrieve this version via his home page - (http://www.cs.princeton.edu/~bwk). It is available in several - archive formats: - - Shell archive - <http://www.cs.princeton.edu/~bwk/btl.mirror/awk.shar> - - Compressed 'tar' file - <http://www.cs.princeton.edu/~bwk/btl.mirror/awk.tar.gz> - - Zip file - <http://www.cs.princeton.edu/~bwk/btl.mirror/awk.zip> - - You can also retrieve it from GitHub: - - git clone git://github.com/onetrueawk/awk bwkawk - - This command creates a copy of the Git (http://git-scm.com) - repository in a directory named 'bwkawk'. If you leave that - argument off the 'git' command line, the repository copy is created - in a directory named 'awk'. - - This version requires an ISO C (1990 standard) compiler; the C - compiler from GCC (the GNU Compiler Collection) works quite nicely. - - *Note Common Extensions:: for a list of extensions in this 'awk' - that are not in POSIX 'awk'. - - As a side note, Dan Bornstein has created a Git repository tracking - all the versions of BWK 'awk' that he could find. It's available - at <git://github.com/danfuzz/one-true-awk>. - -'mawk' - Michael Brennan wrote an independent implementation of 'awk', - called 'mawk'. It is available under the GPL (*note Copying::), - just as 'gawk' is. - - The original distribution site for the 'mawk' source code no longer - has it. A copy is available at - <http://www.skeeve.com/gawk/mawk1.3.3.tar.gz>. - - In 2009, Thomas Dickey took on 'mawk' maintenance. Basic - information is available on the project's web page - (http://www.invisible-island.net/mawk). The download URL is - <http://invisible-island.net/datafiles/release/mawk.tar.gz>. - - Once you have it, 'gunzip' may be used to decompress this file. - Installation is similar to 'gawk''s (*note Unix Installation::). - - *Note Common Extensions:: for a list of extensions in 'mawk' that - are not in POSIX 'awk'. - -'awka' - Written by Andrew Sumner, 'awka' translates 'awk' programs into C, - compiles them, and links them with a library of functions that - provide the core 'awk' functionality. It also has a number of - extensions. - - The 'awk' translator is released under the GPL, and the library is - under the LGPL. - - To get 'awka', go to <http://sourceforge.net/projects/awka>. - - The project seems to be frozen; no new code changes have been made - since approximately 2001. - -'pawk' - Nelson H.F. Beebe at the University of Utah has modified BWK 'awk' - to provide timing and profiling information. It is different from - 'gawk' with the '--profile' option (*note Profiling::) in that it - uses CPU-based profiling, not line-count profiling. You may find - it at either - <ftp://ftp.math.utah.edu/pub/pawk/pawk-20030606.tar.gz> or - <http://www.math.utah.edu/pub/pawk/pawk-20030606.tar.gz>. - -BusyBox 'awk' - BusyBox is a GPL-licensed program providing small versions of many - applications within a single executable. It is aimed at embedded - systems. It includes a full implementation of POSIX 'awk'. When - building it, be careful not to do 'make install' as it will - overwrite copies of other applications in your '/usr/local/bin'. - For more information, see the project's home page - (http://busybox.net). - -The OpenSolaris POSIX 'awk' - The versions of 'awk' in '/usr/xpg4/bin' and '/usr/xpg6/bin' on - Solaris are more or less POSIX-compliant. They are based on the - 'awk' from Mortice Kern Systems for PCs. We were able to make this - code compile and work under GNU/Linux with 1-2 hours of work. - Making it more generally portable (using GNU Autoconf and/or - Automake) would take more work, and this has not been done, at - least to our knowledge. - - The source code used to be available from the OpenSolaris website. - However, that project was ended and the website shut down. - Fortunately, the Illumos project - (http://wiki.illumos.org/display/illumos/illumos+Home) makes this - implementation available. You can view the files one at a time - from - <https://github.com/joyent/illumos-joyent/blob/master/usr/src/cmd/awk_xpg4>. - -'jawk' - This is an interpreter for 'awk' written in Java. It claims to be - a full interpreter, although because it uses Java facilities for - I/O and for regexp matching, the language it supports is different - from POSIX 'awk'. More information is available on the project's - home page (http://jawk.sourceforge.net). - -Libmawk - This is an embeddable 'awk' interpreter derived from 'mawk'. For - more information, see <http://repo.hu/projects/libmawk/>. - -'pawk' - This is a Python module that claims to bring 'awk'-like features to - Python. See <https://github.com/alecthomas/pawk> for more - information. (This is not related to Nelson Beebe's modified - version of BWK 'awk', described earlier.) - -QSE 'awk' - This is an embeddable 'awk' interpreter. For more information, see - <http://code.google.com/p/qse/> and <http://awk.info/?tools/qse>. - -'QTawk' - This is an independent implementation of 'awk' distributed under - the GPL. It has a large number of extensions over standard 'awk' - and may not be 100% syntactically compatible with it. See - <http://www.quiktrim.org/QTawk.html> for more information, - including the manual. The download link there is out of date; see - <http://www.quiktrim.org/#AdditionalResources> for the latest - download link. - - The project may also be frozen; no new code changes have been made - since approximately 2014. - -Other versions - See also the "Versions and implementations" section of the - Wikipedia article - (http://en.wikipedia.org/wiki/Awk_language#Versions_and_implementations) - on 'awk' for information on additional versions. - - -File: gawk.info, Node: Installation summary, Prev: Other Versions, Up: Installation - -B.6 Summary -=========== - - * The 'gawk' distribution is available from the GNU Project's main - distribution site, 'ftp.gnu.org'. The canonical build recipe is: - - wget http://ftp.gnu.org/gnu/gawk/gawk-4.1.4.tar.gz - tar -xvpzf gawk-4.1.4.tar.gz - cd gawk-4.1.4 - ./configure && make && make check - - * 'gawk' may be built on non-POSIX systems as well. The currently - supported systems are MS-Windows using MSYS, MinGW, and Cygwin, and - both Vax/VMS and OpenVMS. Instructions for each system are included - in this major node. - - * Bug reports should be sent via email to <bug-gawk@gnu.org>. Bug - reports should be in English and should include the version of - 'gawk', how it was compiled, and a short program and data file that - demonstrate the problem. - - * There are a number of other freely available 'awk' implementations. - Many are POSIX-compliant; others are less so. - - -File: gawk.info, Node: Notes, Next: Basic Concepts, Prev: Installation, Up: Top - -Appendix C Implementation Notes -******************************* - -This appendix contains information mainly of interest to implementers -and maintainers of 'gawk'. Everything in it applies specifically to -'gawk' and not to other implementations. - -* Menu: - -* Compatibility Mode:: How to disable certain 'gawk' - extensions. -* Additions:: Making Additions To 'gawk'. -* Future Extensions:: New features that may be implemented one day. -* Implementation Limitations:: Some limitations of the implementation. -* Extension Design:: Design notes about the extension API. -* Old Extension Mechanism:: Some compatibility for old extensions. -* Notes summary:: Summary of implementation notes. - - -File: gawk.info, Node: Compatibility Mode, Next: Additions, Up: Notes - -C.1 Downward Compatibility and Debugging -======================================== - -*Note POSIX/GNU::, for a summary of the GNU extensions to the 'awk' -language and program. All of these features can be turned off by -invoking 'gawk' with the '--traditional' option or with the '--posix' -option. - - If 'gawk' is compiled for debugging with '-DDEBUG', then there is one -more option available on the command line: - -'-Y' -'--parsedebug' - Print out the parse stack information as the program is being - parsed. - - This option is intended only for serious 'gawk' developers and not -for the casual user. It probably has not even been compiled into your -version of 'gawk', since it slows down execution. - - -File: gawk.info, Node: Additions, Next: Future Extensions, Prev: Compatibility Mode, Up: Notes - -C.2 Making Additions to 'gawk' -============================== - -If you find that you want to enhance 'gawk' in a significant fashion, -you are perfectly free to do so. That is the point of having free -software; the source code is available and you are free to change it as -you want (*note Copying::). - - This minor node discusses the ways you might want to change 'gawk' as -well as any considerations you should bear in mind. - -* Menu: - -* Accessing The Source:: Accessing the Git repository. -* Adding Code:: Adding code to the main body of - 'gawk'. -* New Ports:: Porting 'gawk' to a new operating - system. -* Derived Files:: Why derived files are kept in the Git - repository. - - -File: gawk.info, Node: Accessing The Source, Next: Adding Code, Up: Additions - -C.2.1 Accessing The 'gawk' Git Repository ------------------------------------------ - -As 'gawk' is Free Software, the source code is always available. *note -Gawk Distribution:: describes how to get and build the formal, released -versions of 'gawk'. - - However, if you want to modify 'gawk' and contribute back your -changes, you will probably wish to work with the development version. -To do so, you will need to access the 'gawk' source code repository. -The code is maintained using the Git distributed version control system -(http://git-scm.com). You will need to install it if your system -doesn't have it. Once you have done so, use the command: - - git clone git://git.savannah.gnu.org/gawk.git - -This clones the 'gawk' repository. If you are behind a firewall that -does not allow you to use the Git native protocol, you can still access -the repository using: - - git clone http://git.savannah.gnu.org/r/gawk.git - - Once you have made changes, you can use 'git diff' to produce a -patch, and send that to the 'gawk' maintainer; see *note Bugs::, for how -to do that. - - Once upon a time there was Git-CVS gateway for use by people who -could not install Git. However, this gateway no longer works, so you -may have better luck using a more modern version control system like -Bazaar, that has a Git plug-in for working with Git repositories. - - -File: gawk.info, Node: Adding Code, Next: New Ports, Prev: Accessing The Source, Up: Additions - -C.2.2 Adding New Features -------------------------- - -You are free to add any new features you like to 'gawk'. However, if -you want your changes to be incorporated into the 'gawk' distribution, -there are several steps that you need to take in order to make it -possible to include them: - - 1. Before building the new feature into 'gawk' itself, consider - writing it as an extension (*note Dynamic Extensions::). If that's - not possible, continue with the rest of the steps in this list. - - 2. Be prepared to sign the appropriate paperwork. In order for the - FSF to distribute your changes, you must either place those changes - in the public domain and submit a signed statement to that effect, - or assign the copyright in your changes to the FSF. Both of these - actions are easy to do and _many_ people have done so already. If - you have questions, please contact me (*note Bugs::), or - <assign@gnu.org>. - - 3. Get the latest version. It is much easier for me to integrate - changes if they are relative to the most recent distributed version - of 'gawk', or better yet, relative to the latest code in the Git - repository. If your version of 'gawk' is very old, I may not be - able to integrate your changes at all. (*Note Getting::, for - information on getting the latest version of 'gawk'.) - - 4. See *note (Version, standards, GNU Coding Standards)Top::. This - document describes how GNU software should be written. If you - haven't read it, please do so, preferably _before_ starting to - modify 'gawk'. (The 'GNU Coding Standards' are available from the - GNU Project's website (http://www.gnu.org/prep/standards/). - Texinfo, Info, and DVI versions are also available.) - - 5. Use the 'gawk' coding style. The C code for 'gawk' follows the - instructions in the 'GNU Coding Standards', with minor exceptions. - The code is formatted using the traditional "K&R" style, - particularly as regards to the placement of braces and the use of - TABs. In brief, the coding rules for 'gawk' are as follows: - - * Use ANSI/ISO style (prototype) function headers when defining - functions. - - * Put the name of the function at the beginning of its own line. - - * Use '#elif' instead of nesting '#if' inside '#else'. - - * Put the return type of the function, even if it is 'int', on - the line above the line with the name and arguments of the - function. - - * Put spaces around parentheses used in control structures - ('if', 'while', 'for', 'do', 'switch', and 'return'). - - * Do not put spaces in front of parentheses used in function - calls. - - * Put spaces around all C operators and after commas in function - calls. - - * Do not use the comma operator to produce multiple side - effects, except in 'for' loop initialization and increment - parts, and in macro bodies. - - * Use real TABs for indenting, not spaces. - - * Use the "K&R" brace layout style. - - * Use comparisons against 'NULL' and ''\0'' in the conditions of - 'if', 'while', and 'for' statements, as well as in the 'case's - of 'switch' statements, instead of just the plain pointer or - character value. - - * Use 'true' and 'false' for 'bool' values, the 'NULL' symbolic - constant for pointer values, and the character constant ''\0'' - where appropriate, instead of '1' and '0'. - - * Provide one-line descriptive comments for each function. - - * Do not use the 'alloca()' function for allocating memory off - the stack. Its use causes more portability trouble than is - worth the minor benefit of not having to free the storage. - Instead, use 'malloc()' and 'free()'. - - * Do not use comparisons of the form '! strcmp(a, b)' or - similar. As Henry Spencer once said, "'strcmp()' is not a - boolean!" Instead, use 'strcmp(a, b) == 0'. - - * If adding new bit flag values, use explicit hexadecimal - constants ('0x001', '0x002', '0x004', and son on) instead of - shifting one left by successive amounts ('(1<<0)', '(1<<1)', - and so on). - - NOTE: If I have to reformat your code to follow the coding - style used in 'gawk', I may not bother to integrate your - changes at all. - - 6. Update the documentation. Along with your new code, please supply - new sections and/or chapters for this Info file. If at all - possible, please use real Texinfo, instead of just supplying - unformatted ASCII text (although even that is better than no - documentation at all). Conventions to be followed in 'GAWK: - Effective AWK Programming' are provided after the '@bye' at the end - of the Texinfo source file. If possible, please update the 'man' - page as well. - - You will also have to sign paperwork for your documentation - changes. - - 7. Submit changes as unified diffs. Use 'diff -u -r -N' to compare - the original 'gawk' source tree with your version. I recommend - using the GNU version of 'diff', or best of all, 'git diff' or 'git - format-patch'. Send the output produced by 'diff' to me when you - submit your changes. (*Note Bugs::, for the electronic mail - information.) - - Using this format makes it easy for me to apply your changes to the - master version of the 'gawk' source code (using 'patch'). If I - have to apply the changes manually, using a text editor, I may not - do so, particularly if there are lots of changes. - - 8. Include an entry for the 'ChangeLog' file with your submission. - This helps further minimize the amount of work I have to do, making - it easier for me to accept patches. It is simplest if you just - make this part of your diff. - - Although this sounds like a lot of work, please remember that while -you may write the new code, I have to maintain it and support it. If it -isn't possible for me to do that with a minimum of extra work, then I -probably will not. - - -File: gawk.info, Node: New Ports, Next: Derived Files, Prev: Adding Code, Up: Additions - -C.2.3 Porting 'gawk' to a New Operating System ----------------------------------------------- - -If you want to port 'gawk' to a new operating system, there are several -steps: - - 1. Follow the guidelines in *note Adding Code::, concerning coding - style, submission of diffs, and so on. - - 2. Be prepared to sign the appropriate paperwork. In order for the - FSF to distribute your code, you must either place your code in the - public domain and submit a signed statement to that effect, or - assign the copyright in your code to the FSF. Both of these actions - are easy to do and _many_ people have done so already. If you have - questions, please contact me, or <gnu@gnu.org>. - - 3. When doing a port, bear in mind that your code must coexist - peacefully with the rest of 'gawk' and the other ports. Avoid - gratuitous changes to the system-independent parts of the code. If - at all possible, avoid sprinkling '#ifdef's just for your port - throughout the code. - - If the changes needed for a particular system affect too much of - the code, I probably will not accept them. In such a case, you - can, of course, distribute your changes on your own, as long as you - comply with the GPL (*note Copying::). - - 4. A number of the files that come with 'gawk' are maintained by other - people. Thus, you should not change them unless it is for a very - good reason; i.e., changes are not out of the question, but changes - to these files are scrutinized extra carefully. The files are - 'dfa.c', 'dfa.h', 'getopt.c', 'getopt.h', 'getopt1.c', - 'getopt_int.h', 'gettext.h', 'regcomp.c', 'regex.c', 'regex.h', - 'regex_internal.c', 'regex_internal.h', and 'regexec.c'. - - 5. A number of other files are provided by the GNU Autotools - (Autoconf, Automake, and GNU 'gettext'). You should not change - them either, unless it is for a very good reason. The files are - 'ABOUT-NLS', 'config.guess', 'config.rpath', 'config.sub', - 'depcomp', 'INSTALL', 'install-sh', 'missing', 'mkinstalldirs', - 'xalloc.h', and 'ylwrap'. - - 6. Be willing to continue to maintain the port. Non-Unix operating - systems are supported by volunteers who maintain the code needed to - compile and run 'gawk' on their systems. If no-one volunteers to - maintain a port, it becomes unsupported and it may be necessary to - remove it from the distribution. - - 7. Supply an appropriate 'gawkmisc.???' file. Each port has its own - 'gawkmisc.???' that implements certain operating system specific - functions. This is cleaner than a plethora of '#ifdef's scattered - throughout the code. The 'gawkmisc.c' in the main source directory - includes the appropriate 'gawkmisc.???' file from each - subdirectory. Be sure to update it as well. - - Each port's 'gawkmisc.???' file has a suffix reminiscent of the - machine or operating system for the port--for example, - 'pc/gawkmisc.pc' and 'vms/gawkmisc.vms'. The use of separate - suffixes, instead of plain 'gawkmisc.c', makes it possible to move - files from a port's subdirectory into the main subdirectory, - without accidentally destroying the real 'gawkmisc.c' file. - (Currently, this is only an issue for the PC operating system - ports.) - - 8. Supply a 'Makefile' as well as any other C source and header files - that are necessary for your operating system. All your code should - be in a separate subdirectory, with a name that is the same as, or - reminiscent of, either your operating system or the computer - system. If possible, try to structure things so that it is not - necessary to move files out of the subdirectory into the main - source directory. If that is not possible, then be sure to avoid - using names for your files that duplicate the names of files in the - main source directory. - - 9. Update the documentation. Please write a section (or sections) for - this Info file describing the installation and compilation steps - needed to compile and/or install 'gawk' for your system. - - Following these steps makes it much easier to integrate your changes -into 'gawk' and have them coexist happily with other operating systems' -code that is already there. - - In the code that you supply and maintain, feel free to use a coding -style and brace layout that suits your taste. - - -File: gawk.info, Node: Derived Files, Prev: New Ports, Up: Additions - -C.2.4 Why Generated Files Are Kept In Git ------------------------------------------ - -If you look at the 'gawk' source in the Git repository, you will notice -that it includes files that are automatically generated by GNU -infrastructure tools, such as 'Makefile.in' from Automake and even -'configure' from Autoconf. - - This is different from many Free Software projects that do not store -the derived files, because that keeps the repository less cluttered, and -it is easier to see the substantive changes when comparing versions and -trying to understand what changed between commits. - - However, there are several reasons why the 'gawk' maintainer likes to -have everything in the repository. - - First, because it is then easy to reproduce any given version -completely, without relying upon the availability of (older, likely -obsolete, and maybe even impossible to find) other tools. - - As an extreme example, if you ever even think about trying to -compile, oh, say, the V7 'awk', you will discover that not only do you -have to bootstrap the V7 'yacc' to do so, but you also need the V7 -'lex'. And the latter is pretty much impossible to bring up on a modern -GNU/Linux system.(1) - - (Or, let's say 'gawk' 1.2 required 'bison' whatever-it-was in 1989 -and that there was no 'awkgram.c' file in the repository. Is there a -guarantee that we could find that 'bison' version? Or that _it_ would -build?) - - If the repository has all the generated files, then it's easy to just -check them out and build. (Or _easier_, depending upon how far back we -go.) - - And that brings us to the second (and stronger) reason why all the -files really need to be in Git. It boils down to who do you cater -to--the 'gawk' developer(s), or the user who just wants to check out a -version and try it out? - - The 'gawk' maintainer wants it to be possible for any interested -'awk' user in the world to just clone the repository, check out the -branch of interest and build it. Without their having to have the -correct version(s) of the autotools.(2) That is the point of the -'bootstrap.sh' file. It touches the various other files in the right -order such that - - # The canonical incantation for building GNU software: - ./bootstrap.sh && ./configure && make - -will _just work_. - - This is extremely important for the 'master' and 'gawk-X.Y-stable' -branches. - - Further, the 'gawk' maintainer would argue that it's also important -for the 'gawk' developers. When he tried to check out the 'xgawk' -branch(3) to build it, he couldn't. (No 'ltmain.sh' file, and he had no -idea how to create it, and that was not the only problem.) - - He felt _extremely_ frustrated. With respect to that branch, the -maintainer is no different than Jane User who wants to try to build -'gawk-4.1-stable' or 'master' from the repository. - - Thus, the maintainer thinks that it's not just important, but -critical, that for any given branch, the above incantation _just works_. - - A third reason to have all the files is that without them, using 'git -bisect' to try to find the commit that introduced a bug is exceedingly -difficult. The maintainer tried to do that on another project that -requires running bootstrapping scripts just to create 'configure' and so -on; it was really painful. When the repository is self-contained, using -'git bisect' in it is very easy. - - What are some of the consequences and/or actions to take? - - 1. We don't mind that there are differing files in the different - branches as a result of different versions of the autotools. - - A. It's the maintainer's job to merge them and he will deal with - it. - - B. He is really good at 'git diff x y > /tmp/diff1 ; gvim - /tmp/diff1' to remove the diffs that aren't of interest in - order to review code. - - 2. It would certainly help if everyone used the same versions of the - GNU tools as he does, which in general are the latest released - versions of Automake, Autoconf, 'bison', and GNU 'gettext'. - - Installing from source is quite easy. It's how the maintainer - worked for years (and still works). He had '/usr/local/bin' at the - front of his 'PATH' and just did: - - wget http://ftp.gnu.org/gnu/PACKAGE/PACKAGE-X.Y.Z.tar.gz - tar -xpzvf PACKAGE-X.Y.Z.tar.gz - cd PACKAGE-X.Y.Z - ./configure && make && make check - make install # as root - - Most of the above was originally written by the maintainer to other -'gawk' developers. It raised the objection from one of the developers -"... that anybody pulling down the source from Git is not an end user." - - However, this is not true. There are "power 'awk' users" who can -build 'gawk' (using the magic incantation shown previously) but who -can't program in C. Thus, the major branches should be kept buildable -all the time. - - It was then suggested that there be a 'cron' job to create nightly -tarballs of "the source." Here, the problem is that there are source -trees, corresponding to the various branches! So, nightly tarballs -aren't the answer, especially as the repository can go for weeks without -significant change being introduced. - - Fortunately, the Git server can meet this need. For any given branch -named BRANCHNAME, use: - - wget http://git.savannah.gnu.org/cgit/gawk.git/snapshot/gawk-BRANCHNAME.tar.gz - -to retrieve a snapshot of the given branch. - - ---------- Footnotes ---------- - - (1) We tried. It was painful. - - (2) There is one GNU program that is (in our opinion) severely -difficult to bootstrap from the Git repository. For example, on the -author's old (but still working) PowerPC Macintosh with Mac OS X 10.5, -it was necessary to bootstrap a ton of software, starting with Git -itself, in order to try to work with the latest code. It's not -pleasant, and especially on older systems, it's a big waste of time. - - Starting with the latest tarball was no picnic either. The -maintainers had dropped '.gz' and '.bz2' files and only distribute -'.tar.xz' files. It was necessary to bootstrap 'xz' first! - - (3) A branch (since removed) created by one of the other developers -that did not include the generated files. - - -File: gawk.info, Node: Future Extensions, Next: Implementation Limitations, Prev: Additions, Up: Notes - -C.3 Probable Future Extensions -============================== - - AWK is a language similar to PERL, only considerably more elegant. - -- _Arnold Robbins_ - - Hey! - -- _Larry Wall_ - - The 'TODO' file in the 'master' branch of the 'gawk' Git repository -lists possible future enhancements. Some of these relate to the source -code, and others to possible new features. Please see that file for the -list. *Note Additions::, if you are interested in tackling any of the -projects listed there. - - -File: gawk.info, Node: Implementation Limitations, Next: Extension Design, Prev: Future Extensions, Up: Notes - -C.4 Some Limitations of the Implementation -========================================== - -This following table describes limits of 'gawk' on a Unix-like system -(although it is variable even then). Other systems may have different -limits. - -Item Limit --------------------------------------------------------------------------- -Characters in a character 2^(number of bits per byte) -class -Length of input record 'MAX_INT' -Length of output record Unlimited -Length of source line Unlimited -Number of fields in a 'MAX_LONG' -record -Number of file redirections Unlimited -Number of input records in 'MAX_LONG' -one file -Number of input records 'MAX_LONG' -total -Number of pipe redirections min(number of processes per user, number - of open files) -Numeric values Double-precision floating point (if not - using MPFR) -Size of a field 'MAX_INT' -Size of a literal string 'MAX_INT' -Size of a printf string 'MAX_INT' - - -File: gawk.info, Node: Extension Design, Next: Old Extension Mechanism, Prev: Implementation Limitations, Up: Notes - -C.5 Extension API Design -======================== - -This minor node documents the design of the extension API, including a -discussion of some of the history and problems that needed to be solved. - - The first version of extensions for 'gawk' was developed in the -mid-1990s and released with 'gawk' 3.1 in the late 1990s. The basic -mechanisms and design remained unchanged for close to 15 years, until -2012. - - The old extension mechanism used data types and functions from 'gawk' -itself, with a "clever hack" to install extension functions. - - 'gawk' included some sample extensions, of which a few were really -useful. However, it was clear from the outset that the extension -mechanism was bolted onto the side and was not really well thought out. - -* Menu: - -* Old Extension Problems:: Problems with the old mechanism. -* Extension New Mechanism Goals:: Goals for the new mechanism. -* Extension Other Design Decisions:: Some other design decisions. -* Extension Future Growth:: Some room for future growth. - - -File: gawk.info, Node: Old Extension Problems, Next: Extension New Mechanism Goals, Up: Extension Design - -C.5.1 Problems With The Old Mechanism -------------------------------------- - -The old extension mechanism had several problems: - - * It depended heavily upon 'gawk' internals. Any time the 'NODE' - structure(1) changed, an extension would have to be recompiled. - Furthermore, to really write extensions required understanding - something about 'gawk''s internal functions. There was some - documentation in this Info file, but it was quite minimal. - - * Being able to call into 'gawk' from an extension required linker - facilities that are common on Unix-derived systems but that did not - work on MS-Windows systems; users wanting extensions on MS-Windows - had to statically link them into 'gawk', even though MS-Windows - supports dynamic loading of shared objects. - - * The API would change occasionally as 'gawk' changed; no - compatibility between versions was ever offered or planned for. - - Despite the drawbacks, the 'xgawk' project developers forked 'gawk' -and developed several significant extensions. They also enhanced -'gawk''s facilities relating to file inclusion and shared object access. - - A new API was desired for a long time, but only in 2012 did the -'gawk' maintainer and the 'xgawk' developers finally start working on it -together. More information about the 'xgawk' project is provided in -*note gawkextlib::. - - ---------- Footnotes ---------- - - (1) A critical central data structure inside 'gawk'. - - -File: gawk.info, Node: Extension New Mechanism Goals, Next: Extension Other Design Decisions, Prev: Old Extension Problems, Up: Extension Design - -C.5.2 Goals For A New Mechanism -------------------------------- - -Some goals for the new API were: - - * The API should be independent of 'gawk' internals. Changes in - 'gawk' internals should not be visible to the writer of an - extension function. - - * The API should provide _binary_ compatibility across 'gawk' - releases as long as the API itself does not change. - - * The API should enable extensions written in C or C++ to have - roughly the same "appearance" to 'awk'-level code as 'awk' - functions do. This means that extensions should have: - - - The ability to access function parameters. - - - The ability to turn an undefined parameter into an array (call - by reference). - - - The ability to create, access and update global variables. - - - Easy access to all the elements of an array at once ("array - flattening") in order to loop over all the element in an easy - fashion for C code. - - - The ability to create arrays (including 'gawk''s true arrays - of arrays). - - Some additional important goals were: - - * The API should use only features in ISO C 90, so that extensions - can be written using the widest range of C and C++ compilers. The - header should include the appropriate '#ifdef __cplusplus' and - 'extern "C"' magic so that a C++ compiler could be used. (If using - C++, the runtime system has to be smart enough to call any - constructors and destructors, as 'gawk' is a C program. As of this - writing, this has not been tested.) - - * The API mechanism should not require access to 'gawk''s symbols(1) - by the compile-time or dynamic linker, in order to enable creation - of extensions that also work on MS-Windows. - - During development, it became clear that there were other features -that should be available to extensions, which were also subsequently -provided: - - * Extensions should have the ability to hook into 'gawk''s I/O - redirection mechanism. In particular, the 'xgawk' developers - provided a so-called "open hook" to take over reading records. - During development, this was generalized to allow extensions to - hook into input processing, output processing, and two-way I/O. - - * An extension should be able to provide a "call back" function to - perform cleanup actions when 'gawk' exits. - - * An extension should be able to provide a version string so that - 'gawk''s '--version' option can provide information about - extensions as well. - - The requirement to avoid access to 'gawk''s symbols is, at first -glance, a difficult one to meet. - - One design, apparently used by Perl and Ruby and maybe others, would -be to make the mainline 'gawk' code into a library, with the 'gawk' -utility a small C 'main()' function linked against the library. - - This seemed like the tail wagging the dog, complicating build and -installation and making a simple copy of the 'gawk' executable from one -system to another (or one place to another on the same system!) into a -chancy operation. - - Pat Rankin suggested the solution that was adopted. *Note Extension -Mechanism Outline::, for the details. - - ---------- Footnotes ---------- - - (1) The "symbols" are the variables and functions defined inside -'gawk'. Access to these symbols by code external to 'gawk' loaded -dynamically at runtime is problematic on MS-Windows. - - -File: gawk.info, Node: Extension Other Design Decisions, Next: Extension Future Growth, Prev: Extension New Mechanism Goals, Up: Extension Design - -C.5.3 Other Design Decisions ----------------------------- - -As an arbitrary design decision, extensions can read the values of -predefined variables and arrays (such as 'ARGV' and 'FS'), but cannot -change them, with the exception of 'PROCINFO'. - - The reason for this is to prevent an extension function from -affecting the flow of an 'awk' program outside its control. While a -real 'awk' function can do what it likes, that is at the discretion of -the programmer. An extension function should provide a service or make -a C API available for use within 'awk', and not mess with 'FS' or 'ARGC' -and 'ARGV'. - - In addition, it becomes easy to start down a slippery slope. How -much access to 'gawk' facilities do extensions need? Do they need -'getline'? What about calling 'gsub()' or compiling regular -expressions? What about calling into 'awk' functions? (_That_ would be -messy.) - - In order to avoid these issues, the 'gawk' developers chose to start -with the simplest, most basic features that are still truly useful. - - Another decision is that although 'gawk' provides nice things like -MPFR, and arrays indexed internally by integers, these features are not -being brought out to the API in order to keep things simple and close to -traditional 'awk' semantics. (In fact, arrays indexed internally by -integers are so transparent that they aren't even documented!) - - Additionally, all functions in the API check that their pointer input -parameters are not 'NULL'. If they are, they return an error. (It is a -good idea for extension code to verify that pointers received from -'gawk' are not 'NULL'. Such a thing should not happen, but the 'gawk' -developers are only human, and they have been known to occasionally make -mistakes.) - - With time, the API will undoubtedly evolve; the 'gawk' developers -expect this to be driven by user needs. For now, the current API seems -to provide a minimal yet powerful set of features for creating -extensions. - - -File: gawk.info, Node: Extension Future Growth, Prev: Extension Other Design Decisions, Up: Extension Design - -C.5.4 Room For Future Growth ----------------------------- - -The API can later be expanded, in two ways: - - * 'gawk' passes an "extension id" into the extension when it first - loads the extension. The extension then passes this id back to - 'gawk' with each function call. This mechanism allows 'gawk' to - identify the extension calling into it, should it need to know. - - * Similarly, the extension passes a "name space" into 'gawk' when it - registers each extension function. This accommodates a possible - future mechanism for grouping extension functions and possibly - avoiding name conflicts. - - Of course, as of this writing, no decisions have been made with -respect to any of the above. - - -File: gawk.info, Node: Old Extension Mechanism, Next: Notes summary, Prev: Extension Design, Up: Notes - -C.6 Compatibility For Old Extensions -==================================== - -*note Dynamic Extensions::, describes the supported API and mechanisms -for writing extensions for 'gawk'. This API was introduced in version -4.1. However, for many years 'gawk' provided an extension mechanism -that required knowledge of 'gawk' internals and that was not as well -designed. - - In order to provide a transition period, 'gawk' version 4.1 continues -to support the original extension mechanism. This will be true for the -life of exactly one major release. This support will be withdrawn, and -removed from the source code, at the next major release. - - Briefly, original-style extensions should be compiled by including -the 'awk.h' header file in the extension source code. Additionally, you -must define the identifier 'GAWK' when building (use '-DGAWK' with -Unix-style compilers). Otherwise, the definitions in 'gawkapi.h' will -cause conflicts with those in 'awk.h' and your extension will not -compile. - - Just as in previous versions, you load an old-style extension with -the 'extension()' built-in function (which is not otherwise documented). -This function in turn finds and loads the shared object file containing -the extension and calls its 'dl_load()' C routine. - - Because original-style and new-style extensions use different -initialization routines ('dl_load()' versus 'dlload()'), they may safely -be installed in the same directory (to be found by 'AWKLIBPATH') without -conflict. - - The 'gawk' development team strongly recommends that you convert any -old extensions that you may have to use the new API described in *note -Dynamic Extensions::. - - -File: gawk.info, Node: Notes summary, Prev: Old Extension Mechanism, Up: Notes - -C.7 Summary -=========== - - * 'gawk''s extensions can be disabled with either the '--traditional' - option or with the '--posix' option. The '--parsedebug' option is - available if 'gawk' is compiled with '-DDEBUG'. - - * The source code for 'gawk' is maintained in a publicly accessible - Git repository. Anyone may check it out and view the source. - - * Contributions to 'gawk' are welcome. Following the steps outlined - in this major node will make it easier to integrate your - contributions into the code base. This applies both to new feature - contributions and to ports to additional operating systems. - - * 'gawk' has some limits--generally those that are imposed by the - machine architecture. - - * The extension API design was intended to solve a number of problems - with the previous extension mechanism, enable features needed by - the 'xgawk' project, and provide binary compatibility going - forward. - - * The previous extension mechanism is still supported in version 4.1 - of 'gawk', but it _will_ be removed in the next major release. - - -File: gawk.info, Node: Basic Concepts, Next: Glossary, Prev: Notes, Up: Top - -Appendix D Basic Programming Concepts -************************************* - -This major node attempts to define some of the basic concepts and terms -that are used throughout the rest of this Info file. As this Info file -is specifically about 'awk', and not about computer programming in -general, the coverage here is by necessity fairly cursory and -simplistic. (If you need more background, there are many other -introductory texts that you should refer to instead.) - -* Menu: - -* Basic High Level:: The high level view. -* Basic Data Typing:: A very quick intro to data types. - - -File: gawk.info, Node: Basic High Level, Next: Basic Data Typing, Up: Basic Concepts - -D.1 What a Program Does -======================= - -At the most basic level, the job of a program is to process some input -data and produce results. See *note Figure D.1: figure-general-flow. - - -+------+ / \\ +---------+ -| Data | -----> < Program > -----> | Results | -+------+ \\_______/ +---------+" - -Figure D.1: General Program Flow - - The "program" in the figure can be either a compiled program(1) (such -as 'ls'), or it may be "interpreted". In the latter case, a -machine-executable program such as 'awk' reads your program, and then -uses the instructions in your program to process the data. - - When you write a program, it usually consists of the following, very -basic set of steps, as shown in *note Figure D.2: figure-process-flow.: - - -+----------------+ / More \\ No +----------+ -| Initialization | -------> < Data > -------> | Clean Up | -+----------------+ ^ \\ ? / +----------+ - | +--+-+ - | | Yes - | | - | V - | +---------+ - +-----+ Process | - +---------+" - -Figure D.2: Basic Program Steps - -Initialization - These are the things you do before actually starting to process - data, such as checking arguments, initializing any data you need to - work with, and so on. This step corresponds to 'awk''s 'BEGIN' - rule (*note BEGIN/END::). - - If you were baking a cake, this might consist of laying out all the - mixing bowls and the baking pan, and making sure you have all the - ingredients that you need. - -Processing - This is where the actual work is done. Your program reads data, - one logical chunk at a time, and processes it as appropriate. - - In most programming languages, you have to manually manage the - reading of data, checking to see if there is more each time you - read a chunk. 'awk''s pattern-action paradigm (*note Getting - Started::) handles the mechanics of this for you. - - In baking a cake, the processing corresponds to the actual labor: - breaking eggs, mixing the flour, water, and other ingredients, and - then putting the cake into the oven. - -Clean Up - Once you've processed all the data, you may have things you need to - do before exiting. This step corresponds to 'awk''s 'END' rule - (*note BEGIN/END::). - - After the cake comes out of the oven, you still have to wrap it in - plastic wrap to keep anyone from tasting it, as well as wash the - mixing bowls and utensils. - - An "algorithm" is a detailed set of instructions necessary to -accomplish a task, or process data. It is much the same as a recipe for -baking a cake. Programs implement algorithms. Often, it is up to you -to design the algorithm and implement it, simultaneously. - - The "logical chunks" we talked about previously are called "records", -similar to the records a company keeps on employees, a school keeps for -students, or a doctor keeps for patients. Each record has many -component parts, such as first and last names, date of birth, address, -and so on. The component parts are referred to as the "fields" of the -record. - - The act of reading data is termed "input", and that of generating -results, not too surprisingly, is termed "output". They are often -referred to together as "input/output," and even more often, as "I/O" -for short. (You will also see "input" and "output" used as verbs.) - - 'awk' manages the reading of data for you, as well as the breaking it -up into records and fields. Your program's job is to tell 'awk' what to -do with the data. You do this by describing "patterns" in the data to -look for, and "actions" to execute when those patterns are seen. This -"data-driven" nature of 'awk' programs usually makes them both easier to -write and easier to read. - - ---------- Footnotes ---------- - - (1) Compiled programs are typically written in lower-level languages -such as C, C++, or Ada, and then translated, or "compiled", into a form -that the computer can execute directly. - - -File: gawk.info, Node: Basic Data Typing, Prev: Basic High Level, Up: Basic Concepts - -D.2 Data Values in a Computer -============================= - -In a program, you keep track of information and values in things called -"variables". A variable is just a name for a given value, such as -'first_name', 'last_name', 'address', and so on. 'awk' has several -predefined variables, and it has special names to refer to the current -input record and the fields of the record. You may also group multiple -associated values under one name, as an array. - - Data, particularly in 'awk', consists of either numeric values, such -as 42 or 3.1415927, or string values. String values are essentially -anything that's not a number, such as a name. Strings are sometimes -referred to as "character data", since they store the individual -characters that comprise them. Individual variables, as well as numeric -and string variables, are referred to as "scalar" values. Groups of -values, such as arrays, are not scalars. - - *note Computer Arithmetic::, provided a basic introduction to numeric -types (integer and floating-point) and how they are used in a computer. -Please review that information, including a number of caveats that were -presented. - - While you are probably used to the idea of a number without a value -(i.e., zero), it takes a bit more getting used to the idea of -zero-length character data. Nevertheless, such a thing exists. It is -called the "null string". The null string is character data that has no -value. In other words, it is empty. It is written in 'awk' programs -like this: '""'. - - Humans are used to working in decimal; i.e., base 10. In base 10, -numbers go from 0 to 9, and then "roll over" into the next column. -(Remember grade school? 42 = 4 x 10 + 2.) - - There are other number bases though. Computers commonly use base 2 -or "binary", base 8 or "octal", and base 16 or "hexadecimal". In -binary, each column represents two times the value in the column to its -right. Each column may contain either a 0 or a 1. Thus, binary 1010 -represents (1 x 8) + (0 x 4) + (1 x 2) + (0 x 1), or decimal 10. Octal -and hexadecimal are discussed more in *note Nondecimal-numbers::. - - At the very lowest level, computers store values as groups of binary -digits, or "bits". Modern computers group bits into groups of eight, -called "bytes". Advanced applications sometimes have to manipulate bits -directly, and 'gawk' provides functions for doing so. - - Programs are written in programming languages. Hundreds, if not -thousands, of programming languages exist. One of the most popular is -the C programming language. The C language had a very strong influence -on the design of the 'awk' language. - - There have been several versions of C. The first is often referred to -as "K&R" C, after the initials of Brian Kernighan and Dennis Ritchie, -the authors of the first book on C. (Dennis Ritchie created the -language, and Brian Kernighan was one of the creators of 'awk'.) - - In the mid-1980s, an effort began to produce an international -standard for C. This work culminated in 1989, with the production of the -ANSI standard for C. This standard became an ISO standard in 1990. In -1999, a revised ISO C standard was approved and released. Where it -makes sense, POSIX 'awk' is compatible with 1999 ISO C. - - -File: gawk.info, Node: Glossary, Next: Copying, Prev: Basic Concepts, Up: Top - -Glossary -******** - -Action - A series of 'awk' statements attached to a rule. If the rule's - pattern matches an input record, 'awk' executes the rule's action. - Actions are always enclosed in braces. (*Note Action Overview::.) - -Ada - A programming language originally defined by the U.S. Department of - Defense for embedded programming. It was designed to enforce good - Software Engineering practices. - -Amazing 'awk' Assembler - Henry Spencer at the University of Toronto wrote a retargetable - assembler completely as 'sed' and 'awk' scripts. It is thousands - of lines long, including machine descriptions for several eight-bit - microcomputers. It is a good example of a program that would have - been better written in another language. You can get it from - <http://awk.info/?awk100/aaa>. - -Amazingly Workable Formatter ('awf') - Henry Spencer at the University of Toronto wrote a formatter that - accepts a large subset of the 'nroff -ms' and 'nroff -man' - formatting commands, using 'awk' and 'sh'. It is available from - <http://awk.info/?tools/awf>. - -Anchor - The regexp metacharacters '^' and '$', which force the match to the - beginning or end of the string, respectively. - -ANSI - The American National Standards Institute. This organization - produces many standards, among them the standards for the C and C++ - programming languages. These standards often become international - standards as well. See also "ISO." - -Argument - An argument can be two different things. It can be an option or a - file name passed to a command while invoking it from the command - line, or it can be something passed to a "function" inside a - program, e.g. inside 'awk'. - - In the latter case, an argument can be passed to a function in two - ways. Either it is given to the called function by value, i.e., a - copy of the value of the variable is made available to the called - function, but the original variable cannot be modified by the - function itself; or it is given by reference, i.e., a pointer to - the interested variable is passed to the function, which can then - directly modify it. In 'awk' scalars are passed by value, and - arrays are passed by reference. See "Pass By Value/Reference." - -Array - A grouping of multiple values under the same name. Most languages - just provide sequential arrays. 'awk' provides associative arrays. - -Assertion - A statement in a program that a condition is true at this point in - the program. Useful for reasoning about how a program is supposed - to behave. - -Assignment - An 'awk' expression that changes the value of some 'awk' variable - or data object. An object that you can assign to is called an - "lvalue". The assigned values are called "rvalues". *Note - Assignment Ops::. - -Associative Array - Arrays in which the indices may be numbers or strings, not just - sequential integers in a fixed range. - -'awk' Language - The language in which 'awk' programs are written. - -'awk' Program - An 'awk' program consists of a series of "patterns" and "actions", - collectively known as "rules". For each input record given to the - program, the program's rules are all processed in turn. 'awk' - programs may also contain function definitions. - -'awk' Script - Another name for an 'awk' program. - -Bash - The GNU version of the standard shell (the Bourne-Again SHell). - See also "Bourne Shell." - -Binary - Base-two notation, where the digits are '0'-'1'. Since electronic - circuitry works "naturally" in base 2 (just think of Off/On), - everything inside a computer is calculated using base 2. Each - digit represents the presence (or absence) of a power of 2 and is - called a "bit". So, for example, the base-two number '10101' is - the same as decimal 21, ((1 x 16) + (1 x 4) + (1 x 1)). - - Since base-two numbers quickly become very long to read and write, - they are usually grouped by 3 (i.e., they are read as octal - numbers), or by 4 (i.e., they are read as hexadecimal numbers). - There is no direct way to insert base 2 numbers in a C program. If - need arises, such numbers are usually inserted as octal or - hexadecimal numbers. The number of base-two digits that fit into - registers used for representing integer numbers in computers is a - rough indication of the computing power of the computer itself. - Most computers nowadays use 64 bits for representing integer - numbers in their registers, but 32-bit, 16-bit and 8-bit registers - have been widely used in the past. *Note Nondecimal-numbers::. -Bit - Short for "Binary Digit." All values in computer memory ultimately - reduce to binary digits: values that are either zero or one. - Groups of bits may be interpreted differently--as integers, - floating-point numbers, character data, addresses of other memory - objects, or other data. 'awk' lets you work with floating-point - numbers and strings. 'gawk' lets you manipulate bit values with - the built-in functions described in *note Bitwise Functions::. - - Computers are often defined by how many bits they use to represent - integer values. Typical systems are 32-bit systems, but 64-bit - systems are becoming increasingly popular, and 16-bit systems have - essentially disappeared. - -Boolean Expression - Named after the English mathematician Boole. See also "Logical - Expression." - -Bourne Shell - The standard shell ('/bin/sh') on Unix and Unix-like systems, - originally written by Steven R. Bourne at Bell Laboratories. Many - shells (Bash, 'ksh', 'pdksh', 'zsh') are generally upwardly - compatible with the Bourne shell. - -Braces - The characters '{' and '}'. Braces are used in 'awk' for - delimiting actions, compound statements, and function bodies. - -Bracket Expression - Inside a "regular expression", an expression included in square - brackets, meant to designate a single character as belonging to a - specified character class. A bracket expression can contain a list - of one or more characters, like '[abc]', a range of characters, - like '[A-Z]', or a name, delimited by ':', that designates a known - set of characters, like '[:digit:]'. The form of bracket - expression enclosed between ':' is independent of the underlying - representation of the character themselves, which could utilize the - ASCII, ECBDIC, or Unicode codesets, depending on the architecture - of the computer system, and on localization. See also "Regular - Expression." - -Built-in Function - The 'awk' language provides built-in functions that perform various - numerical, I/O-related, and string computations. Examples are - 'sqrt()' (for the square root of a number) and 'substr()' (for a - substring of a string). 'gawk' provides functions for timestamp - management, bit manipulation, array sorting, type checking, and - runtime string translation. (*Note Built-in::.) - -Built-in Variable - 'ARGC', 'ARGV', 'CONVFMT', 'ENVIRON', 'FILENAME', 'FNR', 'FS', - 'NF', 'NR', 'OFMT', 'OFS', 'ORS', 'RLENGTH', 'RSTART', 'RS', and - 'SUBSEP' are the variables that have special meaning to 'awk'. In - addition, 'ARGIND', 'BINMODE', 'ERRNO', 'FIELDWIDTHS', 'FPAT', - 'IGNORECASE', 'LINT', 'PROCINFO', 'RT', and 'TEXTDOMAIN' are the - variables that have special meaning to 'gawk'. Changing some of - them affects 'awk''s running environment. (*Note Built-in - Variables::.) - -C - The system programming language that most GNU software is written - in. The 'awk' programming language has C-like syntax, and this - Info file points out similarities between 'awk' and C when - appropriate. - - In general, 'gawk' attempts to be as similar to the 1990 version of - ISO C as makes sense. - -C Shell - The C Shell ('csh' or its improved version, 'tcsh') is a Unix shell - that was created by Bill Joy in the late 1970s. The C shell was - differentiated from other shells by its interactive features and - overall style, which looks more like C. The C Shell is not backward - compatible with the Bourne Shell, so special attention is required - when converting scripts written for other Unix shells to the C - shell, especially with regard to the management of shell variables. - See also "Bourne Shell." - -C++ - A popular object-oriented programming language derived from C. - -Character Class - See "Bracket Expression." - -Character List - See "Bracket Expression." - -Character Set - The set of numeric codes used by a computer system to represent the - characters (letters, numbers, punctuation, etc.) of a particular - country or place. The most common character set in use today is - ASCII (American Standard Code for Information Interchange). Many - European countries use an extension of ASCII known as ISO-8859-1 - (ISO Latin-1). The Unicode character set (http://www.unicode.org) - is increasingly popular and standard, and is particularly widely - used on GNU/Linux systems. - -CHEM - A preprocessor for 'pic' that reads descriptions of molecules and - produces 'pic' input for drawing them. It was written in 'awk' by - Brian Kernighan and Jon Bentley, and is available from - <http://netlib.org/typesetting/chem>. - -Comparison Expression - A relation that is either true or false, such as 'a < b'. - Comparison expressions are used in 'if', 'while', 'do', and 'for' - statements, and in patterns to select which input records to - process. (*Note Typing and Comparison::.) - -Compiler - A program that translates human-readable source code into - machine-executable object code. The object code is then executed - directly by the computer. See also "Interpreter." - -Complemented Bracket Expression - The negation of a "bracket expression". All that is _not_ - described by a given bracket expression. The symbol '^' precedes - the negated bracket expression. E.g.: '[[^:digit:]' designates - whatever character is not a digit. '[^bad]' designates whatever - character is not one of the letters 'b', 'a', or 'd'. See "Bracket - Expression." - -Compound Statement - A series of 'awk' statements, enclosed in curly braces. Compound - statements may be nested. (*Note Statements::.) - -Computed Regexps - See "Dynamic Regular Expressions." - -Concatenation - Concatenating two strings means sticking them together, one after - another, producing a new string. For example, the string 'foo' - concatenated with the string 'bar' gives the string 'foobar'. - (*Note Concatenation::.) - -Conditional Expression - An expression using the '?:' ternary operator, such as 'EXPR1 ? - EXPR2 : EXPR3'. The expression EXPR1 is evaluated; if the result - is true, the value of the whole expression is the value of EXPR2; - otherwise the value is EXPR3. In either case, only one of EXPR2 - and EXPR3 is evaluated. (*Note Conditional Exp::.) - -Control Statement - A control statement is an instruction to perform a given operation - or a set of operations inside an 'awk' program, if a given - condition is true. Control statements are: 'if', 'for', 'while', - and 'do' (*note Statements::). - -Cookie - A peculiar goodie, token, saying or remembrance produced by or - presented to a program. (With thanks to Professor Doug McIlroy.) - -Coprocess - A subordinate program with which two-way communications is - possible. - -Curly Braces - See "Braces." - -Dark Corner - An area in the language where specifications often were (or still - are) not clear, leading to unexpected or undesirable behavior. - Such areas are marked in this Info file with "(d.c.)" in the text - and are indexed under the heading "dark corner." - -Data Driven - A description of 'awk' programs, where you specify the data you are - interested in processing, and what to do when that data is seen. - -Data Objects - These are numbers and strings of characters. Numbers are converted - into strings and vice versa, as needed. (*Note Conversion::.) - -Deadlock - The situation in which two communicating processes are each waiting - for the other to perform an action. - -Debugger - A program used to help developers remove "bugs" from (de-bug) their - programs. - -Double Precision - An internal representation of numbers that can have fractional - parts. Double precision numbers keep track of more digits than do - single precision numbers, but operations on them are sometimes more - expensive. This is the way 'awk' stores numeric values. It is the - C type 'double'. - -Dynamic Regular Expression - A dynamic regular expression is a regular expression written as an - ordinary expression. It could be a string constant, such as - '"foo"', but it may also be an expression whose value can vary. - (*Note Computed Regexps::.) - -Empty String - See "Null String." - -Environment - A collection of strings, of the form 'NAME=VAL', that each program - has available to it. Users generally place values into the - environment in order to provide information to various programs. - Typical examples are the environment variables 'HOME' and 'PATH'. - -Epoch - The date used as the "beginning of time" for timestamps. Time - values in most systems are represented as seconds since the epoch, - with library functions available for converting these values into - standard date and time formats. - - The epoch on Unix and POSIX systems is 1970-01-01 00:00:00 UTC. See - also "GMT" and "UTC." - -Escape Sequences - A special sequence of characters used for describing nonprinting - characters, such as '\n' for newline or '\033' for the ASCII ESC - (Escape) character. (*Note Escape Sequences::.) - -Extension - An additional feature or change to a programming language or - utility not defined by that language's or utility's standard. - 'gawk' has (too) many extensions over POSIX 'awk'. - -FDL - See "Free Documentation License." - -Field - When 'awk' reads an input record, it splits the record into pieces - separated by whitespace (or by a separator regexp that you can - change by setting the predefined variable 'FS'). Such pieces are - called fields. If the pieces are of fixed length, you can use the - built-in variable 'FIELDWIDTHS' to describe their lengths. If you - wish to specify the contents of fields instead of the field - separator, you can use the predefined variable 'FPAT' to do so. - (*Note Field Separators::, *note Constant Size::, and *note - Splitting By Content::.) - -Flag - A variable whose truth value indicates the existence or - nonexistence of some condition. - -Floating-Point Number - Often referred to in mathematical terms as a "rational" or real - number, this is just a number that can have a fractional part. See - also "Double Precision" and "Single Precision." - -Format - Format strings control the appearance of output in the 'strftime()' - and 'sprintf()' functions, and in the 'printf' statement as well. - Also, data conversions from numbers to strings are controlled by - the format strings contained in the predefined variables 'CONVFMT' - and 'OFMT'. (*Note Control Letters::.) - -Fortran - Shorthand for FORmula TRANslator, one of the first programming - languages available for scientific calculations. It was created by - John Backus, and has been available since 1957. It is still in use - today. - -Free Documentation License - This document describes the terms under which this Info file is - published and may be copied. (*Note GNU Free Documentation - License::.) - -Free Software Foundation - A nonprofit organization dedicated to the production and - distribution of freely distributable software. It was founded by - Richard M. Stallman, the author of the original Emacs editor. GNU - Emacs is the most widely used version of Emacs today. - -FSF - See "Free Software Foundation." - -Function - A part of an 'awk' program that can be invoked from every point of - the program, to perform a task. 'awk' has several built-in - functions. Users can define their own functions in every part of - the program. Function can be recursive, i.e., they may invoke - themselves. *Note Functions::. In 'gawk' it is also possible to - have functions shared among different programs, and included where - required using the '@include' directive (*note Include Files::). - In 'gawk' the name of the function that should be invoked can be - generated at run time, i.e., dynamically. The 'gawk' extension API - provides constructor functions (*note Constructor Functions::). - -'gawk' - The GNU implementation of 'awk'. - -General Public License - This document describes the terms under which 'gawk' and its source - code may be distributed. (*Note Copying::.) - -GMT - "Greenwich Mean Time." This is the old term for UTC. It is the - time of day used internally for Unix and POSIX systems. See also - "Epoch" and "UTC." - -GNU - "GNU's not Unix". An on-going project of the Free Software - Foundation to create a complete, freely distributable, - POSIX-compliant computing environment. - -GNU/Linux - A variant of the GNU system using the Linux kernel, instead of the - Free Software Foundation's Hurd kernel. The Linux kernel is a - stable, efficient, full-featured clone of Unix that has been ported - to a variety of architectures. It is most popular on PC-class - systems, but runs well on a variety of other systems too. The - Linux kernel source code is available under the terms of the GNU - General Public License, which is perhaps its most important aspect. - -GPL - See "General Public License." - -Hexadecimal - Base 16 notation, where the digits are '0'-'9' and 'A'-'F', with - 'A' representing 10, 'B' representing 11, and so on, up to 'F' for - 15. Hexadecimal numbers are written in C using a leading '0x', to - indicate their base. Thus, '0x12' is 18 ((1 x 16) + 2). *Note - Nondecimal-numbers::. - -I/O - Abbreviation for "Input/Output," the act of moving data into and/or - out of a running program. - -Input Record - A single chunk of data that is read in by 'awk'. Usually, an 'awk' - input record consists of one line of text. (*Note Records::.) - -Integer - A whole number, i.e., a number that does not have a fractional - part. - -Internationalization - The process of writing or modifying a program so that it can use - multiple languages without requiring further source code changes. - -Interpreter - A program that reads human-readable source code directly, and uses - the instructions in it to process data and produce results. 'awk' - is typically (but not always) implemented as an interpreter. See - also "Compiler." - -Interval Expression - A component of a regular expression that lets you specify repeated - matches of some part of the regexp. Interval expressions were not - originally available in 'awk' programs. - -ISO - The International Organization for Standardization. This - organization produces international standards for many things, - including programming languages, such as C and C++. In the - computer arena, important standards like those for C, C++, and - POSIX become both American national and ISO international standards - simultaneously. This Info file refers to Standard C as "ISO C" - throughout. See the ISO website - (http://www.iso.org/iso/home/about.htm) for more information about - the name of the organization and its language-independent - three-letter acronym. - -Java - A modern programming language originally developed by Sun - Microsystems (now Oracle) supporting Object-Oriented programming. - Although usually implemented by compiling to the instructions for a - standard virtual machine (the JVM), the language can be compiled to - native code. - -Keyword - In the 'awk' language, a keyword is a word that has special - meaning. Keywords are reserved and may not be used as variable - names. - - 'gawk''s keywords are: 'BEGIN', 'BEGINFILE', 'END', 'ENDFILE', - 'break', 'case', 'continue', 'default' 'delete', 'do...while', - 'else', 'exit', 'for...in', 'for', 'function', 'func', 'if', - 'next', 'nextfile', 'switch', and 'while'. - -Korn Shell - The Korn Shell ('ksh') is a Unix shell which was developed by David - Korn at Bell Laboratories in the early 1980s. The Korn Shell is - backward-compatible with the Bourne shell and includes many - features of the C shell. See also "Bourne Shell." - -Lesser General Public License - This document describes the terms under which binary library - archives or shared objects, and their source code may be - distributed. - -LGPL - See "Lesser General Public License." - -Linux - See "GNU/Linux." - -Localization - The process of providing the data necessary for an - internationalized program to work in a particular language. - -Logical Expression - An expression using the operators for logic, AND, OR, and NOT, - written '&&', '||', and '!' in 'awk'. Often called Boolean - expressions, after the mathematician who pioneered this kind of - mathematical logic. - -Lvalue - An expression that can appear on the left side of an assignment - operator. In most languages, lvalues can be variables or array - elements. In 'awk', a field designator can also be used as an - lvalue. - -Matching - The act of testing a string against a regular expression. If the - regexp describes the contents of the string, it is said to "match" - it. - -Metacharacters - Characters used within a regexp that do not stand for themselves. - Instead, they denote regular expression operations, such as - repetition, grouping, or alternation. - -Nesting - Nesting is where information is organized in layers, or where - objects contain other similar objects. In 'gawk' the '@include' - directive can be nested. The "natural" nesting of arithmetic and - logical operations can be changed using parentheses (*note - Precedence::). - -No-op - An operation that does nothing. - -Null String - A string with no characters in it. It is represented explicitly in - 'awk' programs by placing two double quote characters next to each - other ('""'). It can appear in input data by having two successive - occurrences of the field separator appear next to each other. - -Number - A numeric-valued data object. Modern 'awk' implementations use - double precision floating-point to represent numbers. Ancient - 'awk' implementations used single precision floating-point. - -Octal - Base-eight notation, where the digits are '0'-'7'. Octal numbers - are written in C using a leading '0', to indicate their base. - Thus, '013' is 11 ((1 x 8) + 3). *Note Nondecimal-numbers::. - -Output Record - A single chunk of data that is written out by 'awk'. Usually, an - 'awk' output record consists of one or more lines of text. *Note - Records::. - -Pattern - Patterns tell 'awk' which input records are interesting to which - rules. - - A pattern is an arbitrary conditional expression against which - input is tested. If the condition is satisfied, the pattern is - said to "match" the input record. A typical pattern might compare - the input record against a regular expression. (*Note Pattern - Overview::.) - -PEBKAC - An acronym describing what is possibly the most frequent source of - computer usage problems. (Problem Exists Between Keyboard And - Chair.) - -Plug-in - See "Extensions." - -POSIX - The name for a series of standards that specify a Portable - Operating System interface. The "IX" denotes the Unix heritage of - these standards. The main standard of interest for 'awk' users is - 'IEEE Standard for Information Technology, Standard 1003.1-2008'. - The 2008 POSIX standard can be found online at - <http://www.opengroup.org/onlinepubs/9699919799/>. - -Precedence - The order in which operations are performed when operators are used - without explicit parentheses. - -Private - Variables and/or functions that are meant for use exclusively by - library functions and not for the main 'awk' program. Special care - must be taken when naming such variables and functions. (*Note - Library Names::.) - -Range (of input lines) - A sequence of consecutive lines from the input file(s). A pattern - can specify ranges of input lines for 'awk' to process or it can - specify single lines. (*Note Pattern Overview::.) - -Record - See "Input record" and "Output record." - -Recursion - When a function calls itself, either directly or indirectly. If - this is clear, stop, and proceed to the next entry. Otherwise, - refer to the entry for "recursion." - -Redirection - Redirection means performing input from something other than the - standard input stream, or performing output to something other than - the standard output stream. - - You can redirect input to the 'getline' statement using the '<', - '|', and '|&' operators. You can redirect the output of the - 'print' and 'printf' statements to a file or a system command, - using the '>', '>>', '|', and '|&' operators. (*Note Getline::, - and *note Redirection::.) - -Reference Counts - An internal mechanism in 'gawk' to minimize the amount of memory - needed to store the value of string variables. If the value - assumed by a variable is used in more than one place, only one copy - of the value itself is kept, and the associated reference count is - increased when the same value is used by an additional variable, - and decreased when the related variable is no longer in use. When - the reference count goes to zero, the memory space used to store - the value of the variable is freed. - -Regexp - See "Regular Expression." - -Regular Expression - A regular expression ("regexp" for short) is a pattern that denotes - a set of strings, possibly an infinite set. For example, the - regular expression 'R.*xp' matches any string starting with the - letter 'R' and ending with the letters 'xp'. In 'awk', regular - expressions are used in patterns and in conditional expressions. - Regular expressions may contain escape sequences. (*Note - Regexp::.) - -Regular Expression Constant - A regular expression constant is a regular expression written - within slashes, such as '/foo/'. This regular expression is chosen - when you write the 'awk' program and cannot be changed during its - execution. (*Note Regexp Usage::.) - -Regular Expression Operators - See "Metacharacters." - -Rounding - Rounding the result of an arithmetic operation can be tricky. More - than one way of rounding exists, and in 'gawk' it is possible to - choose which method should be used in a program. *Note Setting the - rounding mode::. - -Rule - A segment of an 'awk' program that specifies how to process single - input records. A rule consists of a "pattern" and an "action". - 'awk' reads an input record; then, for each rule, if the input - record satisfies the rule's pattern, 'awk' executes the rule's - action. Otherwise, the rule does nothing for that input record. - -Rvalue - A value that can appear on the right side of an assignment - operator. In 'awk', essentially every expression has a value. - These values are rvalues. - -Scalar - A single value, be it a number or a string. Regular variables are - scalars; arrays and functions are not. - -Search Path - In 'gawk', a list of directories to search for 'awk' program source - files. In the shell, a list of directories to search for - executable programs. - -'sed' - See "Stream Editor." - -Seed - The initial value, or starting point, for a sequence of random - numbers. - -Shell - The command interpreter for Unix and POSIX-compliant systems. The - shell works both interactively, and as a programming language for - batch files, or shell scripts. - -Short-Circuit - The nature of the 'awk' logical operators '&&' and '||'. If the - value of the entire expression is determinable from evaluating just - the lefthand side of these operators, the righthand side is not - evaluated. (*Note Boolean Ops::.) - -Side Effect - A side effect occurs when an expression has an effect aside from - merely producing a value. Assignment expressions, increment and - decrement expressions, and function calls have side effects. - (*Note Assignment Ops::.) - -Single Precision - An internal representation of numbers that can have fractional - parts. Single precision numbers keep track of fewer digits than do - double precision numbers, but operations on them are sometimes less - expensive in terms of CPU time. This is the type used by some - ancient versions of 'awk' to store numeric values. It is the C - type 'float'. - -Space - The character generated by hitting the space bar on the keyboard. - -Special File - A file name interpreted internally by 'gawk', instead of being - handed directly to the underlying operating system--for example, - '/dev/stderr'. (*Note Special Files::.) - -Statement - An expression inside an 'awk' program in the action part of a - pattern-action rule, or inside an 'awk' function. A statement can - be a variable assignment, an array operation, a loop, etc. - -Stream Editor - A program that reads records from an input stream and processes - them one or more at a time. This is in contrast with batch - programs, which may expect to read their input files in entirety - before starting to do anything, as well as with interactive - programs which require input from the user. - -String - A datum consisting of a sequence of characters, such as 'I am a - string'. Constant strings are written with double quotes in the - 'awk' language and may contain escape sequences. (*Note Escape - Sequences::.) - -Tab - The character generated by hitting the 'TAB' key on the keyboard. - It usually expands to up to eight spaces upon output. - -Text Domain - A unique name that identifies an application. Used for grouping - messages that are translated at runtime into the local language. - -Timestamp - A value in the "seconds since the epoch" format used by Unix and - POSIX systems. Used for the 'gawk' functions 'mktime()', - 'strftime()', and 'systime()'. See also "Epoch," "GMT," and "UTC." - -Unix - A computer operating system originally developed in the early - 1970's at AT&T Bell Laboratories. It initially became popular in - universities around the world and later moved into commercial - environments as a software development system and network server - system. There are many commercial versions of Unix, as well as - several work-alike systems whose source code is freely available - (such as GNU/Linux, NetBSD (http://www.netbsd.org), FreeBSD - (http://www.freebsd.org), and OpenBSD (http://www.openbsd.org)). - -UTC - The accepted abbreviation for "Universal Coordinated Time." This - is standard time in Greenwich, England, which is used as a - reference time for day and date calculations. See also "Epoch" and - "GMT." - -Variable - A name for a value. In 'awk', variables may be either scalars or - arrays. - -Whitespace - A sequence of space, TAB, or newline characters occurring inside an - input record or a string. - - -File: gawk.info, Node: Copying, Next: GNU Free Documentation License, Prev: Glossary, Up: Top - -GNU General Public License -************************** - - Version 3, 29 June 2007 - - Copyright (C) 2007 Free Software Foundation, Inc. <http://fsf.org/> - - Everyone is permitted to copy and distribute verbatim copies of this - license document, but changing it is not allowed. - -Preamble -======== - -The GNU General Public License is a free, copyleft license for software -and other kinds of works. - - The licenses for most software and other practical works are designed -to take away your freedom to share and change the works. By contrast, -the GNU General Public License is intended to guarantee your freedom to -share and change all versions of a program--to make sure it remains free -software for all its users. We, the Free Software Foundation, use the -GNU General Public License for most of our software; it applies also to -any other work released this way by its authors. You can apply it to -your programs, too. - - When we speak of free software, we are referring to freedom, not -price. Our General Public Licenses are designed to make sure that you -have the freedom to distribute copies of free software (and charge for -them if you wish), that you receive source code or can get it if you -want it, that you can change the software or use pieces of it in new -free programs, and that you know you can do these things. - - To protect your rights, we need to prevent others from denying you -these rights or asking you to surrender the rights. Therefore, you have -certain responsibilities if you distribute copies of the software, or if -you modify it: responsibilities to respect the freedom of others. - - For example, if you distribute copies of such a program, whether -gratis or for a fee, you must pass on to the recipients the same -freedoms that you received. You must make sure that they, too, receive -or can get the source code. And you must show them these terms so they -know their rights. - - Developers that use the GNU GPL protect your rights with two steps: -(1) assert copyright on the software, and (2) offer you this License -giving you legal permission to copy, distribute and/or modify it. - - For the developers' and authors' protection, the GPL clearly explains -that there is no warranty for this free software. For both users' and -authors' sake, the GPL requires that modified versions be marked as -changed, so that their problems will not be attributed erroneously to -authors of previous versions. - - Some devices are designed to deny users access to install or run -modified versions of the software inside them, although the manufacturer -can do so. This is fundamentally incompatible with the aim of -protecting users' freedom to change the software. The systematic -pattern of such abuse occurs in the area of products for individuals to -use, which is precisely where it is most unacceptable. Therefore, we -have designed this version of the GPL to prohibit the practice for those -products. If such problems arise substantially in other domains, we -stand ready to extend this provision to those domains in future versions -of the GPL, as needed to protect the freedom of users. - - Finally, every program is threatened constantly by software patents. -States should not allow patents to restrict development and use of -software on general-purpose computers, but in those that do, we wish to -avoid the special danger that patents applied to a free program could -make it effectively proprietary. To prevent this, the GPL assures that -patents cannot be used to render the program non-free. - - The precise terms and conditions for copying, distribution and -modification follow. - -TERMS AND CONDITIONS -==================== - - 0. Definitions. - - "This License" refers to version 3 of the GNU General Public - License. - - "Copyright" also means copyright-like laws that apply to other - kinds of works, such as semiconductor masks. - - "The Program" refers to any copyrightable work licensed under this - License. Each licensee is addressed as "you". "Licensees" and - "recipients" may be individuals or organizations. - - To "modify" a work means to copy from or adapt all or part of the - work in a fashion requiring copyright permission, other than the - making of an exact copy. The resulting work is called a "modified - version" of the earlier work or a work "based on" the earlier work. - - A "covered work" means either the unmodified Program or a work - based on the Program. - - To "propagate" a work means to do anything with it that, without - permission, would make you directly or secondarily liable for - infringement under applicable copyright law, except executing it on - a computer or modifying a private copy. Propagation includes - copying, distribution (with or without modification), making - available to the public, and in some countries other activities as - well. - - To "convey" a work means any kind of propagation that enables other - parties to make or receive copies. Mere interaction with a user - through a computer network, with no transfer of a copy, is not - conveying. - - An interactive user interface displays "Appropriate Legal Notices" - to the extent that it includes a convenient and prominently visible - feature that (1) displays an appropriate copyright notice, and (2) - tells the user that there is no warranty for the work (except to - the extent that warranties are provided), that licensees may convey - the work under this License, and how to view a copy of this - License. If the interface presents a list of user commands or - options, such as a menu, a prominent item in the list meets this - criterion. - - 1. Source Code. - - The "source code" for a work means the preferred form of the work - for making modifications to it. "Object code" means any non-source - form of a work. - - A "Standard Interface" means an interface that either is an - official standard defined by a recognized standards body, or, in - the case of interfaces specified for a particular programming - language, one that is widely used among developers working in that - language. - - The "System Libraries" of an executable work include anything, - other than the work as a whole, that (a) is included in the normal - form of packaging a Major Component, but which is not part of that - Major Component, and (b) serves only to enable use of the work with - that Major Component, or to implement a Standard Interface for - which an implementation is available to the public in source code - form. A "Major Component", in this context, means a major - essential component (kernel, window system, and so on) of the - specific operating system (if any) on which the executable work - runs, or a compiler used to produce the work, or an object code - interpreter used to run it. - - The "Corresponding Source" for a work in object code form means all - the source code needed to generate, install, and (for an executable - work) run the object code and to modify the work, including scripts - to control those activities. However, it does not include the - work's System Libraries, or general-purpose tools or generally - available free programs which are used unmodified in performing - those activities but which are not part of the work. For example, - Corresponding Source includes interface definition files associated - with source files for the work, and the source code for shared - libraries and dynamically linked subprograms that the work is - specifically designed to require, such as by intimate data - communication or control flow between those subprograms and other - parts of the work. - - The Corresponding Source need not include anything that users can - regenerate automatically from other parts of the Corresponding - Source. - - The Corresponding Source for a work in source code form is that - same work. - - 2. Basic Permissions. - - All rights granted under this License are granted for the term of - copyright on the Program, and are irrevocable provided the stated - conditions are met. This License explicitly affirms your unlimited - permission to run the unmodified Program. The output from running - a covered work is covered by this License only if the output, given - its content, constitutes a covered work. This License acknowledges - your rights of fair use or other equivalent, as provided by - copyright law. - - You may make, run and propagate covered works that you do not - convey, without conditions so long as your license otherwise - remains in force. You may convey covered works to others for the - sole purpose of having them make modifications exclusively for you, - or provide you with facilities for running those works, provided - that you comply with the terms of this License in conveying all - material for which you do not control copyright. Those thus making - or running the covered works for you must do so exclusively on your - behalf, under your direction and control, on terms that prohibit - them from making any copies of your copyrighted material outside - their relationship with you. - - Conveying under any other circumstances is permitted solely under - the conditions stated below. Sublicensing is not allowed; section - 10 makes it unnecessary. - - 3. Protecting Users' Legal Rights From Anti-Circumvention Law. - - No covered work shall be deemed part of an effective technological - measure under any applicable law fulfilling obligations under - article 11 of the WIPO copyright treaty adopted on 20 December - 1996, or similar laws prohibiting or restricting circumvention of - such measures. - - When you convey a covered work, you waive any legal power to forbid - circumvention of technological measures to the extent such - circumvention is effected by exercising rights under this License - with respect to the covered work, and you disclaim any intention to - limit operation or modification of the work as a means of - enforcing, against the work's users, your or third parties' legal - rights to forbid circumvention of technological measures. - - 4. Conveying Verbatim Copies. - - You may convey verbatim copies of the Program's source code as you - receive it, in any medium, provided that you conspicuously and - appropriately publish on each copy an appropriate copyright notice; - keep intact all notices stating that this License and any - non-permissive terms added in accord with section 7 apply to the - code; keep intact all notices of the absence of any warranty; and - give all recipients a copy of this License along with the Program. - - You may charge any price or no price for each copy that you convey, - and you may offer support or warranty protection for a fee. - - 5. Conveying Modified Source Versions. - - You may convey a work based on the Program, or the modifications to - produce it from the Program, in the form of source code under the - terms of section 4, provided that you also meet all of these - conditions: - - a. The work must carry prominent notices stating that you - modified it, and giving a relevant date. - - b. The work must carry prominent notices stating that it is - released under this License and any conditions added under - section 7. This requirement modifies the requirement in - section 4 to "keep intact all notices". - - c. You must license the entire work, as a whole, under this - License to anyone who comes into possession of a copy. This - License will therefore apply, along with any applicable - section 7 additional terms, to the whole of the work, and all - its parts, regardless of how they are packaged. This License - gives no permission to license the work in any other way, but - it does not invalidate such permission if you have separately - received it. - - d. If the work has interactive user interfaces, each must display - Appropriate Legal Notices; however, if the Program has - interactive interfaces that do not display Appropriate Legal - Notices, your work need not make them do so. - - A compilation of a covered work with other separate and independent - works, which are not by their nature extensions of the covered - work, and which are not combined with it such as to form a larger - program, in or on a volume of a storage or distribution medium, is - called an "aggregate" if the compilation and its resulting - copyright are not used to limit the access or legal rights of the - compilation's users beyond what the individual works permit. - Inclusion of a covered work in an aggregate does not cause this - License to apply to the other parts of the aggregate. - - 6. Conveying Non-Source Forms. - - You may convey a covered work in object code form under the terms - of sections 4 and 5, provided that you also convey the - machine-readable Corresponding Source under the terms of this - License, in one of these ways: - - a. Convey the object code in, or embodied in, a physical product - (including a physical distribution medium), accompanied by the - Corresponding Source fixed on a durable physical medium - customarily used for software interchange. - - b. Convey the object code in, or embodied in, a physical product - (including a physical distribution medium), accompanied by a - written offer, valid for at least three years and valid for as - long as you offer spare parts or customer support for that - product model, to give anyone who possesses the object code - either (1) a copy of the Corresponding Source for all the - software in the product that is covered by this License, on a - durable physical medium customarily used for software - interchange, for a price no more than your reasonable cost of - physically performing this conveying of source, or (2) access - to copy the Corresponding Source from a network server at no - charge. - - c. Convey individual copies of the object code with a copy of the - written offer to provide the Corresponding Source. This - alternative is allowed only occasionally and noncommercially, - and only if you received the object code with such an offer, - in accord with subsection 6b. - - d. Convey the object code by offering access from a designated - place (gratis or for a charge), and offer equivalent access to - the Corresponding Source in the same way through the same - place at no further charge. You need not require recipients - to copy the Corresponding Source along with the object code. - If the place to copy the object code is a network server, the - Corresponding Source may be on a different server (operated by - you or a third party) that supports equivalent copying - facilities, provided you maintain clear directions next to the - object code saying where to find the Corresponding Source. - Regardless of what server hosts the Corresponding Source, you - remain obligated to ensure that it is available for as long as - needed to satisfy these requirements. - - e. Convey the object code using peer-to-peer transmission, - provided you inform other peers where the object code and - Corresponding Source of the work are being offered to the - general public at no charge under subsection 6d. - - A separable portion of the object code, whose source code is - excluded from the Corresponding Source as a System Library, need - not be included in conveying the object code work. - - A "User Product" is either (1) a "consumer product", which means - any tangible personal property which is normally used for personal, - family, or household purposes, or (2) anything designed or sold for - incorporation into a dwelling. In determining whether a product is - a consumer product, doubtful cases shall be resolved in favor of - coverage. For a particular product received by a particular user, - "normally used" refers to a typical or common use of that class of - product, regardless of the status of the particular user or of the - way in which the particular user actually uses, or expects or is - expected to use, the product. A product is a consumer product - regardless of whether the product has substantial commercial, - industrial or non-consumer uses, unless such uses represent the - only significant mode of use of the product. - - "Installation Information" for a User Product means any methods, - procedures, authorization keys, or other information required to - install and execute modified versions of a covered work in that - User Product from a modified version of its Corresponding Source. - The information must suffice to ensure that the continued - functioning of the modified object code is in no case prevented or - interfered with solely because modification has been made. - - If you convey an object code work under this section in, or with, - or specifically for use in, a User Product, and the conveying - occurs as part of a transaction in which the right of possession - and use of the User Product is transferred to the recipient in - perpetuity or for a fixed term (regardless of how the transaction - is characterized), the Corresponding Source conveyed under this - section must be accompanied by the Installation Information. But - this requirement does not apply if neither you nor any third party - retains the ability to install modified object code on the User - Product (for example, the work has been installed in ROM). - - The requirement to provide Installation Information does not - include a requirement to continue to provide support service, - warranty, or updates for a work that has been modified or installed - by the recipient, or for the User Product in which it has been - modified or installed. Access to a network may be denied when the - modification itself materially and adversely affects the operation - of the network or violates the rules and protocols for - communication across the network. - - Corresponding Source conveyed, and Installation Information - provided, in accord with this section must be in a format that is - publicly documented (and with an implementation available to the - public in source code form), and must require no special password - or key for unpacking, reading or copying. - - 7. Additional Terms. - - "Additional permissions" are terms that supplement the terms of - this License by making exceptions from one or more of its - conditions. Additional permissions that are applicable to the - entire Program shall be treated as though they were included in - this License, to the extent that they are valid under applicable - law. If additional permissions apply only to part of the Program, - that part may be used separately under those permissions, but the - entire Program remains governed by this License without regard to - the additional permissions. - - When you convey a copy of a covered work, you may at your option - remove any additional permissions from that copy, or from any part - of it. (Additional permissions may be written to require their own - removal in certain cases when you modify the work.) You may place - additional permissions on material, added by you to a covered work, - for which you have or can give appropriate copyright permission. - - Notwithstanding any other provision of this License, for material - you add to a covered work, you may (if authorized by the copyright - holders of that material) supplement the terms of this License with - terms: - - a. Disclaiming warranty or limiting liability differently from - the terms of sections 15 and 16 of this License; or - - b. Requiring preservation of specified reasonable legal notices - or author attributions in that material or in the Appropriate - Legal Notices displayed by works containing it; or - - c. Prohibiting misrepresentation of the origin of that material, - or requiring that modified versions of such material be marked - in reasonable ways as different from the original version; or - - d. Limiting the use for publicity purposes of names of licensors - or authors of the material; or - - e. Declining to grant rights under trademark law for use of some - trade names, trademarks, or service marks; or - - f. Requiring indemnification of licensors and authors of that - material by anyone who conveys the material (or modified - versions of it) with contractual assumptions of liability to - the recipient, for any liability that these contractual - assumptions directly impose on those licensors and authors. - - All other non-permissive additional terms are considered "further - restrictions" within the meaning of section 10. If the Program as - you received it, or any part of it, contains a notice stating that - it is governed by this License along with a term that is a further - restriction, you may remove that term. If a license document - contains a further restriction but permits relicensing or conveying - under this License, you may add to a covered work material governed - by the terms of that license document, provided that the further - restriction does not survive such relicensing or conveying. - - If you add terms to a covered work in accord with this section, you - must place, in the relevant source files, a statement of the - additional terms that apply to those files, or a notice indicating - where to find the applicable terms. - - Additional terms, permissive or non-permissive, may be stated in - the form of a separately written license, or stated as exceptions; - the above requirements apply either way. - - 8. Termination. - - You may not propagate or modify a covered work except as expressly - provided under this License. Any attempt otherwise to propagate or - modify it is void, and will automatically terminate your rights - under this License (including any patent licenses granted under the - third paragraph of section 11). - - However, if you cease all violation of this License, then your - license from a particular copyright holder is reinstated (a) - provisionally, unless and until the copyright holder explicitly and - finally terminates your license, and (b) permanently, if the - copyright holder fails to notify you of the violation by some - reasonable means prior to 60 days after the cessation. - - Moreover, your license from a particular copyright holder is - reinstated permanently if the copyright holder notifies you of the - violation by some reasonable means, this is the first time you have - received notice of violation of this License (for any work) from - that copyright holder, and you cure the violation prior to 30 days - after your receipt of the notice. - - Termination of your rights under this section does not terminate - the licenses of parties who have received copies or rights from you - under this License. If your rights have been terminated and not - permanently reinstated, you do not qualify to receive new licenses - for the same material under section 10. - - 9. Acceptance Not Required for Having Copies. - - You are not required to accept this License in order to receive or - run a copy of the Program. Ancillary propagation of a covered work - occurring solely as a consequence of using peer-to-peer - transmission to receive a copy likewise does not require - acceptance. However, nothing other than this License grants you - permission to propagate or modify any covered work. These actions - infringe copyright if you do not accept this License. Therefore, - by modifying or propagating a covered work, you indicate your - acceptance of this License to do so. - - 10. Automatic Licensing of Downstream Recipients. - - Each time you convey a covered work, the recipient automatically - receives a license from the original licensors, to run, modify and - propagate that work, subject to this License. You are not - responsible for enforcing compliance by third parties with this - License. - - An "entity transaction" is a transaction transferring control of an - organization, or substantially all assets of one, or subdividing an - organization, or merging organizations. If propagation of a - covered work results from an entity transaction, each party to that - transaction who receives a copy of the work also receives whatever - licenses to the work the party's predecessor in interest had or - could give under the previous paragraph, plus a right to possession - of the Corresponding Source of the work from the predecessor in - interest, if the predecessor has it or can get it with reasonable - efforts. - - You may not impose any further restrictions on the exercise of the - rights granted or affirmed under this License. For example, you - may not impose a license fee, royalty, or other charge for exercise - of rights granted under this License, and you may not initiate - litigation (including a cross-claim or counterclaim in a lawsuit) - alleging that any patent claim is infringed by making, using, - selling, offering for sale, or importing the Program or any portion - of it. - - 11. Patents. - - A "contributor" is a copyright holder who authorizes use under this - License of the Program or a work on which the Program is based. - The work thus licensed is called the contributor's "contributor - version". - - A contributor's "essential patent claims" are all patent claims - owned or controlled by the contributor, whether already acquired or - hereafter acquired, that would be infringed by some manner, - permitted by this License, of making, using, or selling its - contributor version, but do not include claims that would be - infringed only as a consequence of further modification of the - contributor version. For purposes of this definition, "control" - includes the right to grant patent sublicenses in a manner - consistent with the requirements of this License. - - Each contributor grants you a non-exclusive, worldwide, - royalty-free patent license under the contributor's essential - patent claims, to make, use, sell, offer for sale, import and - otherwise run, modify and propagate the contents of its contributor - version. - - In the following three paragraphs, a "patent license" is any - express agreement or commitment, however denominated, not to - enforce a patent (such as an express permission to practice a - patent or covenant not to sue for patent infringement). To "grant" - such a patent license to a party means to make such an agreement or - commitment not to enforce a patent against the party. - - If you convey a covered work, knowingly relying on a patent - license, and the Corresponding Source of the work is not available - for anyone to copy, free of charge and under the terms of this - License, through a publicly available network server or other - readily accessible means, then you must either (1) cause the - Corresponding Source to be so available, or (2) arrange to deprive - yourself of the benefit of the patent license for this particular - work, or (3) arrange, in a manner consistent with the requirements - of this License, to extend the patent license to downstream - recipients. "Knowingly relying" means you have actual knowledge - that, but for the patent license, your conveying the covered work - in a country, or your recipient's use of the covered work in a - country, would infringe one or more identifiable patents in that - country that you have reason to believe are valid. - - If, pursuant to or in connection with a single transaction or - arrangement, you convey, or propagate by procuring conveyance of, a - covered work, and grant a patent license to some of the parties - receiving the covered work authorizing them to use, propagate, - modify or convey a specific copy of the covered work, then the - patent license you grant is automatically extended to all - recipients of the covered work and works based on it. - - A patent license is "discriminatory" if it does not include within - the scope of its coverage, prohibits the exercise of, or is - conditioned on the non-exercise of one or more of the rights that - are specifically granted under this License. You may not convey a - covered work if you are a party to an arrangement with a third - party that is in the business of distributing software, under which - you make payment to the third party based on the extent of your - activity of conveying the work, and under which the third party - grants, to any of the parties who would receive the covered work - from you, a discriminatory patent license (a) in connection with - copies of the covered work conveyed by you (or copies made from - those copies), or (b) primarily for and in connection with specific - products or compilations that contain the covered work, unless you - entered into that arrangement, or that patent license was granted, - prior to 28 March 2007. - - Nothing in this License shall be construed as excluding or limiting - any implied license or other defenses to infringement that may - otherwise be available to you under applicable patent law. - - 12. No Surrender of Others' Freedom. - - If conditions are imposed on you (whether by court order, agreement - or otherwise) that contradict the conditions of this License, they - do not excuse you from the conditions of this License. If you - cannot convey a covered work so as to satisfy simultaneously your - obligations under this License and any other pertinent obligations, - then as a consequence you may not convey it at all. For example, - if you agree to terms that obligate you to collect a royalty for - further conveying from those to whom you convey the Program, the - only way you could satisfy both those terms and this License would - be to refrain entirely from conveying the Program. - - 13. Use with the GNU Affero General Public License. - - Notwithstanding any other provision of this License, you have - permission to link or combine any covered work with a work licensed - under version 3 of the GNU Affero General Public License into a - single combined work, and to convey the resulting work. The terms - of this License will continue to apply to the part which is the - covered work, but the special requirements of the GNU Affero - General Public License, section 13, concerning interaction through - a network will apply to the combination as such. - - 14. Revised Versions of this License. - - The Free Software Foundation may publish revised and/or new - versions of the GNU General Public License from time to time. Such - new versions will be similar in spirit to the present version, but - may differ in detail to address new problems or concerns. - - Each version is given a distinguishing version number. If the - Program specifies that a certain numbered version of the GNU - General Public License "or any later version" applies to it, you - have the option of following the terms and conditions either of - that numbered version or of any later version published by the Free - Software Foundation. If the Program does not specify a version - number of the GNU General Public License, you may choose any - version ever published by the Free Software Foundation. - - If the Program specifies that a proxy can decide which future - versions of the GNU General Public License can be used, that - proxy's public statement of acceptance of a version permanently - authorizes you to choose that version for the Program. - - Later license versions may give you additional or different - permissions. However, no additional obligations are imposed on any - author or copyright holder as a result of your choosing to follow a - later version. - - 15. Disclaimer of Warranty. - - THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY - APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE - COPYRIGHT HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" - WITHOUT WARRANTY OF ANY KIND, EITHER EXPRESSED OR IMPLIED, - INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF - MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE. THE ENTIRE - RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM IS WITH YOU. - SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF ALL - NECESSARY SERVICING, REPAIR OR CORRECTION. - - 16. Limitation of Liability. - - IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN - WRITING WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES - AND/OR CONVEYS THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR - DAMAGES, INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR - CONSEQUENTIAL DAMAGES ARISING OUT OF THE USE OR INABILITY TO USE - THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF DATA OR DATA - BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD - PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER - PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF - THE POSSIBILITY OF SUCH DAMAGES. - - 17. Interpretation of Sections 15 and 16. - - If the disclaimer of warranty and limitation of liability provided - above cannot be given local legal effect according to their terms, - reviewing courts shall apply local law that most closely - approximates an absolute waiver of all civil liability in - connection with the Program, unless a warranty or assumption of - liability accompanies a copy of the Program in return for a fee. - -END OF TERMS AND CONDITIONS -=========================== - -How to Apply These Terms to Your New Programs -============================================= - -If you develop a new program, and you want it to be of the greatest -possible use to the public, the best way to achieve this is to make it -free software which everyone can redistribute and change under these -terms. - - To do so, attach the following notices to the program. It is safest -to attach them to the start of each source file to most effectively -state the exclusion of warranty; and each file should have at least the -"copyright" line and a pointer to where the full notice is found. - - ONE LINE TO GIVE THE PROGRAM'S NAME AND A BRIEF IDEA OF WHAT IT DOES. - Copyright (C) YEAR NAME OF AUTHOR - - This program is free software: you can redistribute it and/or modify - it under the terms of the GNU General Public License as published by - the Free Software Foundation, either version 3 of the License, or (at - your option) any later version. - - This program is distributed in the hope that it will be useful, but - WITHOUT ANY WARRANTY; without even the implied warranty of - MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU - General Public License for more details. - - You should have received a copy of the GNU General Public License - along with this program. If not, see <http://www.gnu.org/licenses/>. - - Also add information on how to contact you by electronic and paper -mail. - - If the program does terminal interaction, make it output a short -notice like this when it starts in an interactive mode: - - PROGRAM Copyright (C) YEAR NAME OF AUTHOR - This program comes with ABSOLUTELY NO WARRANTY; for details type 'show w'. - This is free software, and you are welcome to redistribute it - under certain conditions; type 'show c' for details. - - The hypothetical commands 'show w' and 'show c' should show the -appropriate parts of the General Public License. Of course, your -program's commands might be different; for a GUI interface, you would -use an "about box". - - You should also get your employer (if you work as a programmer) or -school, if any, to sign a "copyright disclaimer" for the program, if -necessary. For more information on this, and how to apply and follow -the GNU GPL, see <http://www.gnu.org/licenses/>. - - The GNU General Public License does not permit incorporating your -program into proprietary programs. If your program is a subroutine -library, you may consider it more useful to permit linking proprietary -applications with the library. If this is what you want to do, use the -GNU Lesser General Public License instead of this License. But first, -please read <http://www.gnu.org/philosophy/why-not-lgpl.html>. - - -File: gawk.info, Node: GNU Free Documentation License, Next: Index, Prev: Copying, Up: Top - -GNU Free Documentation License -****************************** - - Version 1.3, 3 November 2008 - - Copyright (C) 2000, 2001, 2002, 2007, 2008 Free Software Foundation, Inc. - <http://fsf.org/> - - Everyone is permitted to copy and distribute verbatim copies - of this license document, but changing it is not allowed. - - 0. PREAMBLE - - The purpose of this License is to make a manual, textbook, or other - functional and useful document "free" in the sense of freedom: to - assure everyone the effective freedom to copy and redistribute it, - with or without modifying it, either commercially or - noncommercially. Secondarily, this License preserves for the - author and publisher a way to get credit for their work, while not - being considered responsible for modifications made by others. - - This License is a kind of "copyleft", which means that derivative - works of the document must themselves be free in the same sense. - It complements the GNU General Public License, which is a copyleft - license designed for free software. - - We have designed this License in order to use it for manuals for - free software, because free software needs free documentation: a - free program should come with manuals providing the same freedoms - that the software does. But this License is not limited to - software manuals; it can be used for any textual work, regardless - of subject matter or whether it is published as a printed book. We - recommend this License principally for works whose purpose is - instruction or reference. - - 1. APPLICABILITY AND DEFINITIONS - - This License applies to any manual or other work, in any medium, - that contains a notice placed by the copyright holder saying it can - be distributed under the terms of this License. Such a notice - grants a world-wide, royalty-free license, unlimited in duration, - to use that work under the conditions stated herein. The - "Document", below, refers to any such manual or work. Any member - of the public is a licensee, and is addressed as "you". You accept - the license if you copy, modify or distribute the work in a way - requiring permission under copyright law. - - A "Modified Version" of the Document means any work containing the - Document or a portion of it, either copied verbatim, or with - modifications and/or translated into another language. - - A "Secondary Section" is a named appendix or a front-matter section - of the Document that deals exclusively with the relationship of the - publishers or authors of the Document to the Document's overall - subject (or to related matters) and contains nothing that could - fall directly within that overall subject. (Thus, if the Document - is in part a textbook of mathematics, a Secondary Section may not - explain any mathematics.) The relationship could be a matter of - historical connection with the subject or with related matters, or - of legal, commercial, philosophical, ethical or political position - regarding them. - - The "Invariant Sections" are certain Secondary Sections whose - titles are designated, as being those of Invariant Sections, in the - notice that says that the Document is released under this License. - If a section does not fit the above definition of Secondary then it - is not allowed to be designated as Invariant. The Document may - contain zero Invariant Sections. If the Document does not identify - any Invariant Sections then there are none. - - The "Cover Texts" are certain short passages of text that are - listed, as Front-Cover Texts or Back-Cover Texts, in the notice - that says that the Document is released under this License. A - Front-Cover Text may be at most 5 words, and a Back-Cover Text may - be at most 25 words. - - A "Transparent" copy of the Document means a machine-readable copy, - represented in a format whose specification is available to the - general public, that is suitable for revising the document - straightforwardly with generic text editors or (for images composed - of pixels) generic paint programs or (for drawings) some widely - available drawing editor, and that is suitable for input to text - formatters or for automatic translation to a variety of formats - suitable for input to text formatters. A copy made in an otherwise - Transparent file format whose markup, or absence of markup, has - been arranged to thwart or discourage subsequent modification by - readers is not Transparent. An image format is not Transparent if - used for any substantial amount of text. A copy that is not - "Transparent" is called "Opaque". - - Examples of suitable formats for Transparent copies include plain - ASCII without markup, Texinfo input format, LaTeX input format, - SGML or XML using a publicly available DTD, and standard-conforming - simple HTML, PostScript or PDF designed for human modification. - Examples of transparent image formats include PNG, XCF and JPG. - Opaque formats include proprietary formats that can be read and - edited only by proprietary word processors, SGML or XML for which - the DTD and/or processing tools are not generally available, and - the machine-generated HTML, PostScript or PDF produced by some word - processors for output purposes only. - - The "Title Page" means, for a printed book, the title page itself, - plus such following pages as are needed to hold, legibly, the - material this License requires to appear in the title page. For - works in formats which do not have any title page as such, "Title - Page" means the text near the most prominent appearance of the - work's title, preceding the beginning of the body of the text. - - The "publisher" means any person or entity that distributes copies - of the Document to the public. - - A section "Entitled XYZ" means a named subunit of the Document - whose title either is precisely XYZ or contains XYZ in parentheses - following text that translates XYZ in another language. (Here XYZ - stands for a specific section name mentioned below, such as - "Acknowledgements", "Dedications", "Endorsements", or "History".) - To "Preserve the Title" of such a section when you modify the - Document means that it remains a section "Entitled XYZ" according - to this definition. - - The Document may include Warranty Disclaimers next to the notice - which states that this License applies to the Document. These - Warranty Disclaimers are considered to be included by reference in - this License, but only as regards disclaiming warranties: any other - implication that these Warranty Disclaimers may have is void and - has no effect on the meaning of this License. - - 2. VERBATIM COPYING - - You may copy and distribute the Document in any medium, either - commercially or noncommercially, provided that this License, the - copyright notices, and the license notice saying this License - applies to the Document are reproduced in all copies, and that you - add no other conditions whatsoever to those of this License. You - may not use technical measures to obstruct or control the reading - or further copying of the copies you make or distribute. However, - you may accept compensation in exchange for copies. If you - distribute a large enough number of copies you must also follow the - conditions in section 3. - - You may also lend copies, under the same conditions stated above, - and you may publicly display copies. - - 3. COPYING IN QUANTITY - - If you publish printed copies (or copies in media that commonly - have printed covers) of the Document, numbering more than 100, and - the Document's license notice requires Cover Texts, you must - enclose the copies in covers that carry, clearly and legibly, all - these Cover Texts: Front-Cover Texts on the front cover, and - Back-Cover Texts on the back cover. Both covers must also clearly - and legibly identify you as the publisher of these copies. The - front cover must present the full title with all words of the title - equally prominent and visible. You may add other material on the - covers in addition. Copying with changes limited to the covers, as - long as they preserve the title of the Document and satisfy these - conditions, can be treated as verbatim copying in other respects. - - If the required texts for either cover are too voluminous to fit - legibly, you should put the first ones listed (as many as fit - reasonably) on the actual cover, and continue the rest onto - adjacent pages. - - If you publish or distribute Opaque copies of the Document - numbering more than 100, you must either include a machine-readable - Transparent copy along with each Opaque copy, or state in or with - each Opaque copy a computer-network location from which the general - network-using public has access to download using public-standard - network protocols a complete Transparent copy of the Document, free - of added material. If you use the latter option, you must take - reasonably prudent steps, when you begin distribution of Opaque - copies in quantity, to ensure that this Transparent copy will - remain thus accessible at the stated location until at least one - year after the last time you distribute an Opaque copy (directly or - through your agents or retailers) of that edition to the public. - - It is requested, but not required, that you contact the authors of - the Document well before redistributing any large number of copies, - to give them a chance to provide you with an updated version of the - Document. - - 4. MODIFICATIONS - - You may copy and distribute a Modified Version of the Document - under the conditions of sections 2 and 3 above, provided that you - release the Modified Version under precisely this License, with the - Modified Version filling the role of the Document, thus licensing - distribution and modification of the Modified Version to whoever - possesses a copy of it. In addition, you must do these things in - the Modified Version: - - A. Use in the Title Page (and on the covers, if any) a title - distinct from that of the Document, and from those of previous - versions (which should, if there were any, be listed in the - History section of the Document). You may use the same title - as a previous version if the original publisher of that - version gives permission. - - B. List on the Title Page, as authors, one or more persons or - entities responsible for authorship of the modifications in - the Modified Version, together with at least five of the - principal authors of the Document (all of its principal - authors, if it has fewer than five), unless they release you - from this requirement. - - C. State on the Title page the name of the publisher of the - Modified Version, as the publisher. - - D. Preserve all the copyright notices of the Document. - - E. Add an appropriate copyright notice for your modifications - adjacent to the other copyright notices. - - F. Include, immediately after the copyright notices, a license - notice giving the public permission to use the Modified - Version under the terms of this License, in the form shown in - the Addendum below. - - G. Preserve in that license notice the full lists of Invariant - Sections and required Cover Texts given in the Document's - license notice. - - H. Include an unaltered copy of this License. - - I. Preserve the section Entitled "History", Preserve its Title, - and add to it an item stating at least the title, year, new - authors, and publisher of the Modified Version as given on the - Title Page. If there is no section Entitled "History" in the - Document, create one stating the title, year, authors, and - publisher of the Document as given on its Title Page, then add - an item describing the Modified Version as stated in the - previous sentence. - - J. Preserve the network location, if any, given in the Document - for public access to a Transparent copy of the Document, and - likewise the network locations given in the Document for - previous versions it was based on. These may be placed in the - "History" section. You may omit a network location for a work - that was published at least four years before the Document - itself, or if the original publisher of the version it refers - to gives permission. - - K. For any section Entitled "Acknowledgements" or "Dedications", - Preserve the Title of the section, and preserve in the section - all the substance and tone of each of the contributor - acknowledgements and/or dedications given therein. - - L. Preserve all the Invariant Sections of the Document, unaltered - in their text and in their titles. Section numbers or the - equivalent are not considered part of the section titles. - - M. Delete any section Entitled "Endorsements". Such a section - may not be included in the Modified Version. - - N. Do not retitle any existing section to be Entitled - "Endorsements" or to conflict in title with any Invariant - Section. - - O. Preserve any Warranty Disclaimers. - - If the Modified Version includes new front-matter sections or - appendices that qualify as Secondary Sections and contain no - material copied from the Document, you may at your option designate - some or all of these sections as invariant. To do this, add their - titles to the list of Invariant Sections in the Modified Version's - license notice. These titles must be distinct from any other - section titles. - - You may add a section Entitled "Endorsements", provided it contains - nothing but endorsements of your Modified Version by various - parties--for example, statements of peer review or that the text - has been approved by an organization as the authoritative - definition of a standard. - - You may add a passage of up to five words as a Front-Cover Text, - and a passage of up to 25 words as a Back-Cover Text, to the end of - the list of Cover Texts in the Modified Version. Only one passage - of Front-Cover Text and one of Back-Cover Text may be added by (or - through arrangements made by) any one entity. If the Document - already includes a cover text for the same cover, previously added - by you or by arrangement made by the same entity you are acting on - behalf of, you may not add another; but you may replace the old - one, on explicit permission from the previous publisher that added - the old one. - - The author(s) and publisher(s) of the Document do not by this - License give permission to use their names for publicity for or to - assert or imply endorsement of any Modified Version. - - 5. COMBINING DOCUMENTS - - You may combine the Document with other documents released under - this License, under the terms defined in section 4 above for - modified versions, provided that you include in the combination all - of the Invariant Sections of all of the original documents, - unmodified, and list them all as Invariant Sections of your - combined work in its license notice, and that you preserve all - their Warranty Disclaimers. - - The combined work need only contain one copy of this License, and - multiple identical Invariant Sections may be replaced with a single - copy. If there are multiple Invariant Sections with the same name - but different contents, make the title of each such section unique - by adding at the end of it, in parentheses, the name of the - original author or publisher of that section if known, or else a - unique number. Make the same adjustment to the section titles in - the list of Invariant Sections in the license notice of the - combined work. - - In the combination, you must combine any sections Entitled - "History" in the various original documents, forming one section - Entitled "History"; likewise combine any sections Entitled - "Acknowledgements", and any sections Entitled "Dedications". You - must delete all sections Entitled "Endorsements." - - 6. COLLECTIONS OF DOCUMENTS - - You may make a collection consisting of the Document and other - documents released under this License, and replace the individual - copies of this License in the various documents with a single copy - that is included in the collection, provided that you follow the - rules of this License for verbatim copying of each of the documents - in all other respects. - - You may extract a single document from such a collection, and - distribute it individually under this License, provided you insert - a copy of this License into the extracted document, and follow this - License in all other respects regarding verbatim copying of that - document. - - 7. AGGREGATION WITH INDEPENDENT WORKS - - A compilation of the Document or its derivatives with other - separate and independent documents or works, in or on a volume of a - storage or distribution medium, is called an "aggregate" if the - copyright resulting from the compilation is not used to limit the - legal rights of the compilation's users beyond what the individual - works permit. When the Document is included in an aggregate, this - License does not apply to the other works in the aggregate which - are not themselves derivative works of the Document. - - If the Cover Text requirement of section 3 is applicable to these - copies of the Document, then if the Document is less than one half - of the entire aggregate, the Document's Cover Texts may be placed - on covers that bracket the Document within the aggregate, or the - electronic equivalent of covers if the Document is in electronic - form. Otherwise they must appear on printed covers that bracket - the whole aggregate. - - 8. TRANSLATION - - Translation is considered a kind of modification, so you may - distribute translations of the Document under the terms of section - 4. Replacing Invariant Sections with translations requires special - permission from their copyright holders, but you may include - translations of some or all Invariant Sections in addition to the - original versions of these Invariant Sections. You may include a - translation of this License, and all the license notices in the - Document, and any Warranty Disclaimers, provided that you also - include the original English version of this License and the - original versions of those notices and disclaimers. In case of a - disagreement between the translation and the original version of - this License or a notice or disclaimer, the original version will - prevail. - - If a section in the Document is Entitled "Acknowledgements", - "Dedications", or "History", the requirement (section 4) to - Preserve its Title (section 1) will typically require changing the - actual title. - - 9. TERMINATION - - You may not copy, modify, sublicense, or distribute the Document - except as expressly provided under this License. Any attempt - otherwise to copy, modify, sublicense, or distribute it is void, - and will automatically terminate your rights under this License. - - However, if you cease all violation of this License, then your - license from a particular copyright holder is reinstated (a) - provisionally, unless and until the copyright holder explicitly and - finally terminates your license, and (b) permanently, if the - copyright holder fails to notify you of the violation by some - reasonable means prior to 60 days after the cessation. - - Moreover, your license from a particular copyright holder is - reinstated permanently if the copyright holder notifies you of the - violation by some reasonable means, this is the first time you have - received notice of violation of this License (for any work) from - that copyright holder, and you cure the violation prior to 30 days - after your receipt of the notice. - - Termination of your rights under this section does not terminate - the licenses of parties who have received copies or rights from you - under this License. If your rights have been terminated and not - permanently reinstated, receipt of a copy of some or all of the - same material does not give you any rights to use it. - - 10. FUTURE REVISIONS OF THIS LICENSE - - The Free Software Foundation may publish new, revised versions of - the GNU Free Documentation License from time to time. Such new - versions will be similar in spirit to the present version, but may - differ in detail to address new problems or concerns. See - <http://www.gnu.org/copyleft/>. - - Each version of the License is given a distinguishing version - number. If the Document specifies that a particular numbered - version of this License "or any later version" applies to it, you - have the option of following the terms and conditions either of - that specified version or of any later version that has been - published (not as a draft) by the Free Software Foundation. If the - Document does not specify a version number of this License, you may - choose any version ever published (not as a draft) by the Free - Software Foundation. If the Document specifies that a proxy can - decide which future versions of this License can be used, that - proxy's public statement of acceptance of a version permanently - authorizes you to choose that version for the Document. - - 11. RELICENSING - - "Massive Multiauthor Collaboration Site" (or "MMC Site") means any - World Wide Web server that publishes copyrightable works and also - provides prominent facilities for anybody to edit those works. A - public wiki that anybody can edit is an example of such a server. - A "Massive Multiauthor Collaboration" (or "MMC") contained in the - site means any set of copyrightable works thus published on the MMC - site. - - "CC-BY-SA" means the Creative Commons Attribution-Share Alike 3.0 - license published by Creative Commons Corporation, a not-for-profit - corporation with a principal place of business in San Francisco, - California, as well as future copyleft versions of that license - published by that same organization. - - "Incorporate" means to publish or republish a Document, in whole or - in part, as part of another Document. - - An MMC is "eligible for relicensing" if it is licensed under this - License, and if all works that were first published under this - License somewhere other than this MMC, and subsequently - incorporated in whole or in part into the MMC, (1) had no cover - texts or invariant sections, and (2) were thus incorporated prior - to November 1, 2008. - - The operator of an MMC Site may republish an MMC contained in the - site under CC-BY-SA on the same site at any time before August 1, - 2009, provided the MMC is eligible for relicensing. - -ADDENDUM: How to use this License for your documents -==================================================== - -To use this License in a document you have written, include a copy of -the License in the document and put the following copyright and license -notices just after the title page: - - Copyright (C) YEAR YOUR NAME. - Permission is granted to copy, distribute and/or modify this document - under the terms of the GNU Free Documentation License, Version 1.3 - or any later version published by the Free Software Foundation; - with no Invariant Sections, no Front-Cover Texts, and no Back-Cover - Texts. A copy of the license is included in the section entitled ``GNU - Free Documentation License''. - - If you have Invariant Sections, Front-Cover Texts and Back-Cover -Texts, replace the "with...Texts." line with this: - - with the Invariant Sections being LIST THEIR TITLES, with - the Front-Cover Texts being LIST, and with the Back-Cover Texts - being LIST. - - If you have Invariant Sections without Cover Texts, or some other -combination of the three, merge those two alternatives to suit the -situation. - - If your document contains nontrivial examples of program code, we -recommend releasing these examples in parallel under your choice of free -software license, such as the GNU General Public License, to permit -their use in free software. - - -File: gawk.info, Node: Index, Prev: GNU Free Documentation License, Up: Top - -Index -***** - - -* Menu: - -* ! (exclamation point), ! operator: Boolean Ops. (line 69) -* ! (exclamation point), ! operator <1>: Precedence. (line 51) -* ! (exclamation point), ! operator <2>: Ranges. (line 47) -* ! (exclamation point), ! operator <3>: Egrep Program. (line 174) -* ! (exclamation point), != operator: Comparison Operators. - (line 11) -* ! (exclamation point), != operator <1>: Precedence. (line 64) -* ! (exclamation point), !~ operator: Regexp Usage. (line 19) -* ! (exclamation point), !~ operator <1>: Computed Regexps. (line 6) -* ! (exclamation point), !~ operator <2>: Case-sensitivity. (line 26) -* ! (exclamation point), !~ operator <3>: Regexp Constants. (line 6) -* ! (exclamation point), !~ operator <4>: Comparison Operators. - (line 11) -* ! (exclamation point), !~ operator <5>: Comparison Operators. - (line 98) -* ! (exclamation point), !~ operator <6>: Precedence. (line 79) -* ! (exclamation point), !~ operator <7>: Expression Patterns. - (line 24) -* " (double quote), in regexp constants: Computed Regexps. (line 30) -* " (double quote), in shell commands: Quoting. (line 54) -* # (number sign), #! (executable scripts): Executable Scripts. - (line 6) -* # (number sign), commenting: Comments. (line 6) -* $ (dollar sign), $ field operator: Fields. (line 19) -* $ (dollar sign), $ field operator <1>: Precedence. (line 42) -* $ (dollar sign), incrementing fields and arrays: Increment Ops. - (line 30) -* $ (dollar sign), regexp operator: Regexp Operators. (line 35) -* % (percent sign), % operator: Precedence. (line 54) -* % (percent sign), %= operator: Assignment Ops. (line 129) -* % (percent sign), %= operator <1>: Precedence. (line 94) -* & (ampersand), && operator: Boolean Ops. (line 59) -* & (ampersand), && operator <1>: Precedence. (line 85) -* & (ampersand), gsub()/gensub()/sub() functions and: Gory Details. - (line 6) -* ' (single quote): One-shot. (line 15) -* ' (single quote) in gawk command lines: Long. (line 35) -* ' (single quote), in shell commands: Quoting. (line 48) -* ' (single quote), vs. apostrophe: Comments. (line 27) -* ' (single quote), with double quotes: Quoting. (line 73) -* () (parentheses), in a profile: Profiling. (line 146) -* () (parentheses), regexp operator: Regexp Operators. (line 81) -* * (asterisk), * operator, as multiplication operator: Precedence. - (line 54) -* * (asterisk), * operator, as regexp operator: Regexp Operators. - (line 89) -* * (asterisk), * operator, null strings, matching: String Functions. - (line 537) -* * (asterisk), ** operator: Arithmetic Ops. (line 81) -* * (asterisk), ** operator <1>: Precedence. (line 48) -* * (asterisk), **= operator: Assignment Ops. (line 129) -* * (asterisk), **= operator <1>: Precedence. (line 94) -* * (asterisk), *= operator: Assignment Ops. (line 129) -* * (asterisk), *= operator <1>: Precedence. (line 94) -* + (plus sign), + operator: Precedence. (line 51) -* + (plus sign), + operator <1>: Precedence. (line 57) -* + (plus sign), ++ operator: Increment Ops. (line 11) -* + (plus sign), ++ operator <1>: Increment Ops. (line 40) -* + (plus sign), ++ operator <2>: Precedence. (line 45) -* + (plus sign), += operator: Assignment Ops. (line 81) -* + (plus sign), += operator <1>: Precedence. (line 94) -* + (plus sign), regexp operator: Regexp Operators. (line 105) -* , (comma), in range patterns: Ranges. (line 6) -* - (hyphen), - operator: Precedence. (line 51) -* - (hyphen), - operator <1>: Precedence. (line 57) -* - (hyphen), -- operator: Increment Ops. (line 48) -* - (hyphen), -- operator <1>: Precedence. (line 45) -* - (hyphen), -= operator: Assignment Ops. (line 129) -* - (hyphen), -= operator <1>: Precedence. (line 94) -* - (hyphen), filenames beginning with: Options. (line 60) -* - (hyphen), in bracket expressions: Bracket Expressions. (line 25) -* --assign option: Options. (line 32) -* --bignum option: Options. (line 203) -* --characters-as-bytes option: Options. (line 69) -* --copyright option: Options. (line 89) -* --debug option: Options. (line 108) -* --disable-extensions configuration option: Additional Configuration Options. - (line 9) -* --disable-lint configuration option: Additional Configuration Options. - (line 15) -* --disable-nls configuration option: Additional Configuration Options. - (line 32) -* --dump-variables option: Options. (line 94) -* --dump-variables option, using for library functions: Library Names. - (line 45) -* --exec option: Options. (line 125) -* --field-separator option: Options. (line 21) -* --file option: Options. (line 25) -* --gen-pot option: Options. (line 147) -* --gen-pot option <1>: String Extraction. (line 6) -* --gen-pot option <2>: String Extraction. (line 6) -* --help option: Options. (line 154) -* --include option: Options. (line 159) -* --lint option: Command Line. (line 20) -* --lint option <1>: Options. (line 184) -* --lint-old option: Options. (line 299) -* --load option: Options. (line 172) -* --no-optimize option: Options. (line 285) -* --non-decimal-data option: Options. (line 209) -* --non-decimal-data option <1>: Nondecimal Data. (line 6) -* --non-decimal-data option, strtonum() function and: Nondecimal Data. - (line 35) -* --optimize option: Options. (line 234) -* --posix option: Options. (line 257) -* --posix option, --traditional option and: Options. (line 272) -* --pretty-print option: Options. (line 223) -* --profile option: Options. (line 245) -* --profile option <1>: Profiling. (line 12) -* --re-interval option: Options. (line 278) -* --sandbox option: Options. (line 290) -* --sandbox option, disabling system() function: I/O Functions. - (line 129) -* --sandbox option, input redirection with getline: Getline. (line 19) -* --sandbox option, output redirection with print, printf: Redirection. - (line 6) -* --source option: Options. (line 117) -* --traditional option: Options. (line 82) -* --traditional option, --posix option and: Options. (line 272) -* --use-lc-numeric option: Options. (line 218) -* --version option: Options. (line 304) -* --with-whiny-user-strftime configuration option: Additional Configuration Options. - (line 37) -* -b option: Options. (line 69) -* -c option: Options. (line 82) -* -C option: Options. (line 89) -* -d option: Options. (line 94) -* -D option: Options. (line 108) -* -e option: Options. (line 117) -* -E option: Options. (line 125) -* -e option <1>: Options. (line 340) -* -f option: Long. (line 12) -* -F option: Options. (line 21) -* -f option <1>: Options. (line 25) -* -F option, -Ft sets FS to TAB: Options. (line 312) -* -F option, command-line: Command Line Field Separator. - (line 6) -* -f option, multiple uses: Options. (line 317) -* -g option: Options. (line 147) -* -h option: Options. (line 154) -* -i option: Options. (line 159) -* -l option: Options. (line 172) -* -l option <1>: Options. (line 184) -* -L option: Options. (line 299) -* -M option: Options. (line 203) -* -n option: Options. (line 209) -* -N option: Options. (line 218) -* -o option: Options. (line 223) -* -O option: Options. (line 234) -* -p option: Options. (line 245) -* -P option: Options. (line 257) -* -r option: Options. (line 278) -* -s option: Options. (line 285) -* -S option: Options. (line 290) -* -v option: Options. (line 32) -* -V option: Options. (line 304) -* -v option <1>: Assignment Options. (line 12) -* -W option: Options. (line 47) -* . (period), regexp operator: Regexp Operators. (line 44) -* .gmo files: Explaining gettext. (line 42) -* .gmo files, specifying directory of: Explaining gettext. (line 54) -* .gmo files, specifying directory of <1>: Programmer i18n. (line 48) -* .mo files, converting from .po: I18N Example. (line 66) -* .po files: Explaining gettext. (line 37) -* .po files <1>: Translator i18n. (line 6) -* .po files, converting to .mo: I18N Example. (line 66) -* .pot files: Explaining gettext. (line 31) -* / (forward slash) to enclose regular expressions: Regexp. (line 10) -* / (forward slash), / operator: Precedence. (line 54) -* / (forward slash), /= operator: Assignment Ops. (line 129) -* / (forward slash), /= operator <1>: Precedence. (line 94) -* / (forward slash), /= operator, vs. /=.../ regexp constant: Assignment Ops. - (line 149) -* / (forward slash), patterns and: Expression Patterns. (line 24) -* /= operator vs. /=.../ regexp constant: Assignment Ops. (line 149) -* /dev/... special files: Special FD. (line 48) -* /dev/fd/N special files (gawk): Special FD. (line 48) -* /inet/... special files (gawk): TCP/IP Networking. (line 6) -* /inet4/... special files (gawk): TCP/IP Networking. (line 6) -* /inet6/... special files (gawk): TCP/IP Networking. (line 6) -* ; (semicolon), AWKPATH variable and: PC Using. (line 9) -* ; (semicolon), separating statements in actions: Statements/Lines. - (line 90) -* ; (semicolon), separating statements in actions <1>: Action Overview. - (line 19) -* ; (semicolon), separating statements in actions <2>: Statements. - (line 10) -* < (left angle bracket), < operator: Comparison Operators. - (line 11) -* < (left angle bracket), < operator <1>: Precedence. (line 64) -* < (left angle bracket), < operator (I/O): Getline/File. (line 6) -* < (left angle bracket), <= operator: Comparison Operators. - (line 11) -* < (left angle bracket), <= operator <1>: Precedence. (line 64) -* = (equals sign), = operator: Assignment Ops. (line 6) -* = (equals sign), == operator: Comparison Operators. - (line 11) -* = (equals sign), == operator <1>: Precedence. (line 64) -* > (right angle bracket), > operator: Comparison Operators. - (line 11) -* > (right angle bracket), > operator <1>: Precedence. (line 64) -* > (right angle bracket), > operator (I/O): Redirection. (line 22) -* > (right angle bracket), >= operator: Comparison Operators. - (line 11) -* > (right angle bracket), >= operator <1>: Precedence. (line 64) -* > (right angle bracket), >> operator (I/O): Redirection. (line 50) -* > (right angle bracket), >> operator (I/O) <1>: Precedence. (line 64) -* ? (question mark), ?: operator: Precedence. (line 91) -* ? (question mark), regexp operator: Regexp Operators. (line 111) -* ? (question mark), regexp operator <1>: GNU Regexp Operators. - (line 62) -* @-notation for indirect function calls: Indirect Calls. (line 47) -* @include directive: Include Files. (line 8) -* @load directive: Loading Shared Libraries. - (line 8) -* [] (square brackets), regexp operator: Regexp Operators. (line 56) -* \ (backslash): Comments. (line 50) -* \ (backslash), as field separator: Command Line Field Separator. - (line 24) -* \ (backslash), continuing lines and: Statements/Lines. (line 19) -* \ (backslash), continuing lines and, comments and: Statements/Lines. - (line 75) -* \ (backslash), continuing lines and, in csh: Statements/Lines. - (line 43) -* \ (backslash), gsub()/gensub()/sub() functions and: Gory Details. - (line 6) -* \ (backslash), in bracket expressions: Bracket Expressions. (line 25) -* \ (backslash), in escape sequences: Escape Sequences. (line 6) -* \ (backslash), in escape sequences <1>: Escape Sequences. (line 103) -* \ (backslash), in escape sequences, POSIX and: Escape Sequences. - (line 108) -* \ (backslash), in regexp constants: Computed Regexps. (line 30) -* \ (backslash), in shell commands: Quoting. (line 48) -* \ (backslash), regexp operator: Regexp Operators. (line 18) -* \ (backslash), \" escape sequence: Escape Sequences. (line 85) -* \ (backslash), \' operator (gawk): GNU Regexp Operators. - (line 59) -* \ (backslash), \/ escape sequence: Escape Sequences. (line 76) -* \ (backslash), \< operator (gawk): GNU Regexp Operators. - (line 33) -* \ (backslash), \> operator (gawk): GNU Regexp Operators. - (line 37) -* \ (backslash), \a escape sequence: Escape Sequences. (line 34) -* \ (backslash), \b escape sequence: Escape Sequences. (line 38) -* \ (backslash), \B operator (gawk): GNU Regexp Operators. - (line 46) -* \ (backslash), \f escape sequence: Escape Sequences. (line 41) -* \ (backslash), \n escape sequence: Escape Sequences. (line 44) -* \ (backslash), \NNN escape sequence: Escape Sequences. (line 56) -* \ (backslash), \r escape sequence: Escape Sequences. (line 47) -* \ (backslash), \s operator (gawk): GNU Regexp Operators. - (line 13) -* \ (backslash), \S operator (gawk): GNU Regexp Operators. - (line 17) -* \ (backslash), \t escape sequence: Escape Sequences. (line 50) -* \ (backslash), \v escape sequence: Escape Sequences. (line 53) -* \ (backslash), \w operator (gawk): GNU Regexp Operators. - (line 22) -* \ (backslash), \W operator (gawk): GNU Regexp Operators. - (line 28) -* \ (backslash), \x escape sequence: Escape Sequences. (line 61) -* \ (backslash), \y operator (gawk): GNU Regexp Operators. - (line 41) -* \ (backslash), \` operator (gawk): GNU Regexp Operators. - (line 57) -* ^ (caret), in bracket expressions: Bracket Expressions. (line 25) -* ^ (caret), in FS: Regexp Field Splitting. - (line 59) -* ^ (caret), regexp operator: Regexp Operators. (line 22) -* ^ (caret), regexp operator <1>: GNU Regexp Operators. - (line 62) -* ^ (caret), ^ operator: Precedence. (line 48) -* ^ (caret), ^= operator: Assignment Ops. (line 129) -* ^ (caret), ^= operator <1>: Precedence. (line 94) -* _ (underscore), C macro: Explaining gettext. (line 71) -* _ (underscore), in names of private variables: Library Names. - (line 29) -* _ (underscore), translatable string: Programmer i18n. (line 69) -* _gr_init() user-defined function: Group Functions. (line 83) -* _ord_init() user-defined function: Ordinal Functions. (line 16) -* _pw_init() user-defined function: Passwd Functions. (line 105) -* {} (braces): Profiling. (line 142) -* {} (braces), actions and: Action Overview. (line 19) -* {} (braces), statements, grouping: Statements. (line 10) -* | (vertical bar): Regexp Operators. (line 70) -* | (vertical bar), | operator (I/O): Getline/Pipe. (line 10) -* | (vertical bar), | operator (I/O) <1>: Redirection. (line 57) -* | (vertical bar), | operator (I/O) <2>: Precedence. (line 64) -* | (vertical bar), |& operator (I/O): Getline/Coprocess. (line 6) -* | (vertical bar), |& operator (I/O) <1>: Redirection. (line 96) -* | (vertical bar), |& operator (I/O) <2>: Precedence. (line 64) -* | (vertical bar), |& operator (I/O) <3>: Two-way I/O. (line 27) -* | (vertical bar), |& operator (I/O), pipes, closing: Close Files And Pipes. - (line 120) -* | (vertical bar), || operator: Boolean Ops. (line 59) -* | (vertical bar), || operator <1>: Precedence. (line 88) -* ~ (tilde), ~ operator: Regexp Usage. (line 19) -* ~ (tilde), ~ operator <1>: Computed Regexps. (line 6) -* ~ (tilde), ~ operator <2>: Case-sensitivity. (line 26) -* ~ (tilde), ~ operator <3>: Regexp Constants. (line 6) -* ~ (tilde), ~ operator <4>: Comparison Operators. - (line 11) -* ~ (tilde), ~ operator <5>: Comparison Operators. - (line 98) -* ~ (tilde), ~ operator <6>: Precedence. (line 79) -* ~ (tilde), ~ operator <7>: Expression Patterns. (line 24) -* accessing fields: Fields. (line 6) -* accessing global variables from extensions: Symbol Table Access. - (line 6) -* account information: Passwd Functions. (line 16) -* account information <1>: Group Functions. (line 6) -* actions: Action Overview. (line 6) -* actions, control statements in: Statements. (line 6) -* actions, default: Very Simple. (line 35) -* actions, empty: Very Simple. (line 40) -* Ada programming language: Glossary. (line 11) -* adding, features to gawk: Adding Code. (line 6) -* adding, fields: Changing Fields. (line 53) -* advanced features, fixed-width data: Constant Size. (line 6) -* advanced features, gawk: Advanced Features. (line 6) -* advanced features, network programming: TCP/IP Networking. (line 6) -* advanced features, nondecimal input data: Nondecimal Data. (line 6) -* advanced features, processes, communicating with: Two-way I/O. - (line 6) -* advanced features, specifying field content: Splitting By Content. - (line 9) -* Aho, Alfred: History. (line 17) -* Aho, Alfred <1>: Contributors. (line 12) -* alarm clock example program: Alarm Program. (line 11) -* alarm.awk program: Alarm Program. (line 31) -* algorithms: Basic High Level. (line 57) -* allocating memory for extensions: Memory Allocation Functions. - (line 6) -* amazing awk assembler (aaa): Glossary. (line 16) -* amazingly workable formatter (awf): Glossary. (line 24) -* ambiguity, syntactic: /= operator vs. /=.../ regexp constant: Assignment Ops. - (line 149) -* ampersand (&), && operator: Boolean Ops. (line 59) -* ampersand (&), && operator <1>: Precedence. (line 85) -* ampersand (&), gsub()/gensub()/sub() functions and: Gory Details. - (line 6) -* anagram.awk program: Anagram Program. (line 21) -* anagrams, finding: Anagram Program. (line 6) -* and: Bitwise Functions. (line 40) -* AND bitwise operation: Bitwise Functions. (line 6) -* and Boolean-logic operator: Boolean Ops. (line 6) -* ANSI: Glossary. (line 34) -* API informational variables: Extension API Informational Variables. - (line 6) -* API version: Extension Versioning. - (line 6) -* arbitrary precision: Arbitrary Precision Arithmetic. - (line 6) -* arbitrary precision integers: Arbitrary Precision Integers. - (line 6) -* archaeologists: Bugs. (line 6) -* arctangent: Numeric Functions. (line 12) -* ARGC/ARGV variables: Auto-set. (line 15) -* ARGC/ARGV variables, command-line arguments: Other Arguments. - (line 15) -* ARGC/ARGV variables, how to use: ARGC and ARGV. (line 6) -* ARGC/ARGV variables, portability and: Executable Scripts. (line 59) -* ARGIND variable: Auto-set. (line 44) -* ARGIND variable, command-line arguments: Other Arguments. (line 15) -* arguments, command-line: Other Arguments. (line 6) -* arguments, command-line <1>: Auto-set. (line 15) -* arguments, command-line <2>: ARGC and ARGV. (line 6) -* arguments, command-line, invoking awk: Command Line. (line 6) -* arguments, in function calls: Function Calls. (line 18) -* arguments, processing: Getopt Function. (line 6) -* ARGV array, indexing into: Other Arguments. (line 15) -* arithmetic operators: Arithmetic Ops. (line 6) -* array manipulation in extensions: Array Manipulation. (line 6) -* array members: Reference to Elements. - (line 6) -* array scanning order, controlling: Controlling Scanning. - (line 14) -* array, number of elements: String Functions. (line 200) -* arrays: Arrays. (line 6) -* arrays of arrays: Arrays of Arrays. (line 6) -* arrays, an example of using: Array Example. (line 6) -* arrays, and IGNORECASE variable: Array Intro. (line 100) -* arrays, as parameters to functions: Pass By Value/Reference. - (line 44) -* arrays, associative: Array Intro. (line 48) -* arrays, associative, library functions and: Library Names. (line 58) -* arrays, deleting entire contents: Delete. (line 39) -* arrays, elements that don't exist: Reference to Elements. - (line 23) -* arrays, elements, assigning values: Assigning Elements. (line 6) -* arrays, elements, deleting: Delete. (line 6) -* arrays, elements, order of access by in operator: Scanning an Array. - (line 48) -* arrays, elements, retrieving number of: String Functions. (line 42) -* arrays, for statement and: Scanning an Array. (line 20) -* arrays, indexing: Array Intro. (line 48) -* arrays, merging into strings: Join Function. (line 6) -* arrays, multidimensional: Multidimensional. (line 10) -* arrays, multidimensional, scanning: Multiscanning. (line 11) -* arrays, numeric subscripts: Numeric Array Subscripts. - (line 6) -* arrays, referencing elements: Reference to Elements. - (line 6) -* arrays, scanning: Scanning an Array. (line 6) -* arrays, sorting: Array Sorting Functions. - (line 6) -* arrays, sorting, and IGNORECASE variable: Array Sorting Functions. - (line 83) -* arrays, sparse: Array Intro. (line 76) -* arrays, subscripts, uninitialized variables as: Uninitialized Subscripts. - (line 6) -* arrays, unassigned elements: Reference to Elements. - (line 18) -* artificial intelligence, gawk and: Distribution contents. - (line 52) -* ASCII: Ordinal Functions. (line 45) -* ASCII <1>: Glossary. (line 196) -* asort: String Functions. (line 42) -* asort <1>: Array Sorting Functions. - (line 6) -* asort() function (gawk), arrays, sorting: Array Sorting Functions. - (line 6) -* asorti: String Functions. (line 42) -* asorti <1>: Array Sorting Functions. - (line 6) -* asorti() function (gawk), arrays, sorting: Array Sorting Functions. - (line 6) -* assert() function (C library): Assert Function. (line 6) -* assert() user-defined function: Assert Function. (line 28) -* assertions: Assert Function. (line 6) -* assign values to variables, in debugger: Viewing And Changing Data. - (line 58) -* assignment operators: Assignment Ops. (line 6) -* assignment operators, evaluation order: Assignment Ops. (line 110) -* assignment operators, lvalues/rvalues: Assignment Ops. (line 31) -* assignments as filenames: Ignoring Assigns. (line 6) -* associative arrays: Array Intro. (line 48) -* asterisk (*), * operator, as multiplication operator: Precedence. - (line 54) -* asterisk (*), * operator, as regexp operator: Regexp Operators. - (line 89) -* asterisk (*), * operator, null strings, matching: String Functions. - (line 537) -* asterisk (*), ** operator: Arithmetic Ops. (line 81) -* asterisk (*), ** operator <1>: Precedence. (line 48) -* asterisk (*), **= operator: Assignment Ops. (line 129) -* asterisk (*), **= operator <1>: Precedence. (line 94) -* asterisk (*), *= operator: Assignment Ops. (line 129) -* asterisk (*), *= operator <1>: Precedence. (line 94) -* atan2: Numeric Functions. (line 12) -* automatic displays, in debugger: Debugger Info. (line 24) -* awf (amazingly workable formatter) program: Glossary. (line 24) -* awk debugging, enabling: Options. (line 108) -* awk language, POSIX version: Assignment Ops. (line 138) -* awk profiling, enabling: Options. (line 245) -* awk programs: Getting Started. (line 12) -* awk programs <1>: Executable Scripts. (line 6) -* awk programs <2>: Two Rules. (line 6) -* awk programs, complex: When. (line 27) -* awk programs, documenting: Comments. (line 6) -* awk programs, documenting <1>: Library Names. (line 6) -* awk programs, examples of: Sample Programs. (line 6) -* awk programs, execution of: Next Statement. (line 16) -* awk programs, internationalizing: I18N Functions. (line 6) -* awk programs, internationalizing <1>: Programmer i18n. (line 6) -* awk programs, lengthy: Long. (line 6) -* awk programs, lengthy, assertions: Assert Function. (line 6) -* awk programs, location of: Options. (line 25) -* awk programs, location of <1>: Options. (line 125) -* awk programs, location of <2>: Options. (line 159) -* awk programs, one-line examples: Very Simple. (line 46) -* awk programs, profiling: Profiling. (line 6) -* awk programs, running: Running gawk. (line 6) -* awk programs, running <1>: Long. (line 6) -* awk programs, running, from shell scripts: One-shot. (line 22) -* awk programs, running, without input files: Read Terminal. (line 16) -* awk programs, shell variables in: Using Shell Variables. - (line 6) -* awk, function of: Getting Started. (line 6) -* awk, gawk and: Preface. (line 21) -* awk, gawk and <1>: This Manual. (line 14) -* awk, history of: History. (line 17) -* awk, implementation issues, pipes: Redirection. (line 129) -* awk, implementations: Other Versions. (line 6) -* awk, implementations, limits: Getline Notes. (line 14) -* awk, invoking: Command Line. (line 6) -* awk, new vs. old: Names. (line 6) -* awk, new vs. old, OFMT variable: Strings And Numbers. (line 56) -* awk, POSIX and: Preface. (line 21) -* awk, POSIX and, See Also POSIX awk: Preface. (line 21) -* awk, regexp constants and: Comparison Operators. - (line 103) -* awk, See Also gawk: Preface. (line 34) -* awk, terms describing: This Manual. (line 6) -* awk, uses for: Preface. (line 21) -* awk, uses for <1>: Getting Started. (line 12) -* awk, uses for <2>: When. (line 6) -* awk, versions of: V7/SVR3.1. (line 6) -* awk, versions of, changes between SVR3.1 and SVR4: SVR4. (line 6) -* awk, versions of, changes between SVR4 and POSIX awk: POSIX. - (line 6) -* awk, versions of, changes between V7 and SVR3.1: V7/SVR3.1. (line 6) -* awk, versions of, See Also Brian Kernighan's awk: BTL. (line 6) -* awk, versions of, See Also Brian Kernighan's awk <1>: Other Versions. - (line 13) -* awka compiler for awk: Other Versions. (line 68) -* AWKLIBPATH environment variable: AWKLIBPATH Variable. (line 6) -* AWKPATH environment variable: AWKPATH Variable. (line 6) -* AWKPATH environment variable <1>: PC Using. (line 9) -* awkprof.out file: Profiling. (line 6) -* awksed.awk program: Simple Sed. (line 25) -* awkvars.out file: Options. (line 94) -* b debugger command (alias for break): Breakpoint Control. (line 11) -* backslash (\): Comments. (line 50) -* backslash (\), as field separator: Command Line Field Separator. - (line 24) -* backslash (\), continuing lines and: Statements/Lines. (line 19) -* backslash (\), continuing lines and, comments and: Statements/Lines. - (line 75) -* backslash (\), continuing lines and, in csh: Statements/Lines. - (line 43) -* backslash (\), gsub()/gensub()/sub() functions and: Gory Details. - (line 6) -* backslash (\), in bracket expressions: Bracket Expressions. (line 25) -* backslash (\), in escape sequences: Escape Sequences. (line 6) -* backslash (\), in escape sequences <1>: Escape Sequences. (line 103) -* backslash (\), in escape sequences, POSIX and: Escape Sequences. - (line 108) -* backslash (\), in regexp constants: Computed Regexps. (line 30) -* backslash (\), in shell commands: Quoting. (line 48) -* backslash (\), regexp operator: Regexp Operators. (line 18) -* backslash (\), \" escape sequence: Escape Sequences. (line 85) -* backslash (\), \' operator (gawk): GNU Regexp Operators. - (line 59) -* backslash (\), \/ escape sequence: Escape Sequences. (line 76) -* backslash (\), \< operator (gawk): GNU Regexp Operators. - (line 33) -* backslash (\), \> operator (gawk): GNU Regexp Operators. - (line 37) -* backslash (\), \a escape sequence: Escape Sequences. (line 34) -* backslash (\), \b escape sequence: Escape Sequences. (line 38) -* backslash (\), \B operator (gawk): GNU Regexp Operators. - (line 46) -* backslash (\), \f escape sequence: Escape Sequences. (line 41) -* backslash (\), \n escape sequence: Escape Sequences. (line 44) -* backslash (\), \NNN escape sequence: Escape Sequences. (line 56) -* backslash (\), \r escape sequence: Escape Sequences. (line 47) -* backslash (\), \s operator (gawk): GNU Regexp Operators. - (line 13) -* backslash (\), \S operator (gawk): GNU Regexp Operators. - (line 17) -* backslash (\), \t escape sequence: Escape Sequences. (line 50) -* backslash (\), \v escape sequence: Escape Sequences. (line 53) -* backslash (\), \w operator (gawk): GNU Regexp Operators. - (line 22) -* backslash (\), \W operator (gawk): GNU Regexp Operators. - (line 28) -* backslash (\), \x escape sequence: Escape Sequences. (line 61) -* backslash (\), \y operator (gawk): GNU Regexp Operators. - (line 41) -* backslash (\), \` operator (gawk): GNU Regexp Operators. - (line 57) -* backtrace debugger command: Execution Stack. (line 13) -* Beebe, Nelson H.F.: Acknowledgments. (line 60) -* Beebe, Nelson H.F. <1>: Other Versions. (line 82) -* BEGIN pattern: Field Separators. (line 44) -* BEGIN pattern <1>: BEGIN/END. (line 6) -* BEGIN pattern <2>: Using BEGIN/END. (line 6) -* BEGIN pattern, and profiling: Profiling. (line 62) -* BEGIN pattern, assert() user-defined function and: Assert Function. - (line 83) -* BEGIN pattern, Boolean patterns and: Expression Patterns. (line 70) -* BEGIN pattern, exit statement and: Exit Statement. (line 12) -* BEGIN pattern, getline and: Getline Notes. (line 19) -* BEGIN pattern, headings, adding: Print Examples. (line 42) -* BEGIN pattern, next/nextfile statements and: I/O And BEGIN/END. - (line 36) -* BEGIN pattern, next/nextfile statements and <1>: Next Statement. - (line 44) -* BEGIN pattern, OFS/ORS variables, assigning values to: Output Separators. - (line 20) -* BEGIN pattern, operators and: Using BEGIN/END. (line 17) -* BEGIN pattern, print statement and: I/O And BEGIN/END. (line 15) -* BEGIN pattern, pwcat program: Passwd Functions. (line 143) -* BEGIN pattern, running awk programs and: Cut Program. (line 63) -* BEGIN pattern, TEXTDOMAIN variable and: Programmer i18n. (line 60) -* BEGINFILE pattern: BEGINFILE/ENDFILE. (line 6) -* BEGINFILE pattern, Boolean patterns and: Expression Patterns. - (line 70) -* beginfile() user-defined function: Filetrans Function. (line 62) -* Bentley, Jon: Glossary. (line 206) -* Benzinger, Michael: Contributors. (line 98) -* Berry, Karl: Acknowledgments. (line 33) -* Berry, Karl <1>: Acknowledgments. (line 75) -* Berry, Karl <2>: Ranges and Locales. (line 74) -* binary input/output: User-modified. (line 15) -* bindtextdomain: I18N Functions. (line 11) -* bindtextdomain <1>: Programmer i18n. (line 48) -* bindtextdomain() function (C library): Explaining gettext. (line 50) -* bindtextdomain() function (gawk), portability and: I18N Portability. - (line 33) -* BINMODE variable: User-modified. (line 15) -* BINMODE variable <1>: PC Using. (line 16) -* bit-manipulation functions: Bitwise Functions. (line 6) -* bits2str() user-defined function: Bitwise Functions. (line 72) -* bitwise AND: Bitwise Functions. (line 40) -* bitwise complement: Bitwise Functions. (line 44) -* bitwise OR: Bitwise Functions. (line 50) -* bitwise XOR: Bitwise Functions. (line 57) -* bitwise, complement: Bitwise Functions. (line 25) -* bitwise, operations: Bitwise Functions. (line 6) -* bitwise, shift: Bitwise Functions. (line 32) -* body, in actions: Statements. (line 10) -* body, in loops: While Statement. (line 14) -* Boolean expressions: Boolean Ops. (line 6) -* Boolean expressions, as patterns: Expression Patterns. (line 39) -* Boolean operators, See Boolean expressions: Boolean Ops. (line 6) -* Bourne shell, quoting rules for: Quoting. (line 18) -* braces ({}): Profiling. (line 142) -* braces ({}), actions and: Action Overview. (line 19) -* braces ({}), statements, grouping: Statements. (line 10) -* bracket expressions: Regexp Operators. (line 56) -* bracket expressions <1>: Bracket Expressions. (line 6) -* bracket expressions, character classes: Bracket Expressions. - (line 40) -* bracket expressions, collating elements: Bracket Expressions. - (line 86) -* bracket expressions, collating symbols: Bracket Expressions. - (line 93) -* bracket expressions, complemented: Regexp Operators. (line 64) -* bracket expressions, equivalence classes: Bracket Expressions. - (line 99) -* bracket expressions, non-ASCII: Bracket Expressions. (line 86) -* bracket expressions, range expressions: Bracket Expressions. - (line 6) -* break debugger command: Breakpoint Control. (line 11) -* break statement: Break Statement. (line 6) -* breakpoint: Debugging Terms. (line 33) -* breakpoint at location, how to delete: Breakpoint Control. (line 36) -* breakpoint commands: Debugger Execution Control. - (line 10) -* breakpoint condition: Breakpoint Control. (line 54) -* breakpoint, delete by number: Breakpoint Control. (line 64) -* breakpoint, how to disable or enable: Breakpoint Control. (line 69) -* breakpoint, setting: Breakpoint Control. (line 11) -* Brennan, Michael: Foreword3. (line 84) -* Brennan, Michael <1>: Foreword4. (line 33) -* Brennan, Michael <2>: Acknowledgments. (line 79) -* Brennan, Michael <3>: Delete. (line 56) -* Brennan, Michael <4>: Simple Sed. (line 25) -* Brennan, Michael <5>: Other Versions. (line 6) -* Brennan, Michael <6>: Other Versions. (line 48) -* Brian Kernighan's awk: When. (line 21) -* Brian Kernighan's awk <1>: Escape Sequences. (line 112) -* Brian Kernighan's awk <2>: GNU Regexp Operators. - (line 85) -* Brian Kernighan's awk <3>: Regexp Field Splitting. - (line 67) -* Brian Kernighan's awk <4>: Getline/Pipe. (line 62) -* Brian Kernighan's awk <5>: Concatenation. (line 36) -* Brian Kernighan's awk <6>: I/O And BEGIN/END. (line 15) -* Brian Kernighan's awk <7>: Break Statement. (line 51) -* Brian Kernighan's awk <8>: Continue Statement. (line 44) -* Brian Kernighan's awk <9>: Nextfile Statement. (line 47) -* Brian Kernighan's awk <10>: Delete. (line 51) -* Brian Kernighan's awk <11>: String Functions. (line 493) -* Brian Kernighan's awk <12>: Gory Details. (line 19) -* Brian Kernighan's awk <13>: I/O Functions. (line 43) -* Brian Kernighan's awk, extensions: BTL. (line 6) -* Brian Kernighan's awk, source code: Other Versions. (line 13) -* Brini, Davide: Signature Program. (line 6) -* Brink, Jeroen: DOS Quoting. (line 10) -* Broder, Alan J.: Contributors. (line 89) -* Brown, Martin: Contributors. (line 83) -* BSD-based operating systems: Glossary. (line 748) -* bt debugger command (alias for backtrace): Execution Stack. (line 13) -* Buening, Andreas: Acknowledgments. (line 60) -* Buening, Andreas <1>: Contributors. (line 93) -* Buening, Andreas <2>: Maintainers. (line 14) -* buffering, input/output: I/O Functions. (line 166) -* buffering, input/output <1>: Two-way I/O. (line 53) -* buffering, interactive vs. noninteractive: I/O Functions. (line 76) -* buffers, flushing: I/O Functions. (line 32) -* buffers, flushing <1>: I/O Functions. (line 166) -* buffers, operators for: GNU Regexp Operators. - (line 51) -* bug reports, email address, bug-gawk@gnu.org: Bug address. (line 22) -* bug-gawk@gnu.org bug reporting address: Bug address. (line 22) -* built-in functions: Functions. (line 6) -* built-in functions, evaluation order: Calling Built-in. (line 30) -* BusyBox Awk: Other Versions. (line 92) -* c.e., See common extensions: Conventions. (line 51) -* call by reference: Pass By Value/Reference. - (line 44) -* call by value: Pass By Value/Reference. - (line 15) -* call stack, display in debugger: Execution Stack. (line 13) -* caret (^), in bracket expressions: Bracket Expressions. (line 25) -* caret (^), regexp operator: Regexp Operators. (line 22) -* caret (^), regexp operator <1>: GNU Regexp Operators. - (line 62) -* caret (^), ^ operator: Precedence. (line 48) -* caret (^), ^= operator: Assignment Ops. (line 129) -* caret (^), ^= operator <1>: Precedence. (line 94) -* case keyword: Switch Statement. (line 6) -* case sensitivity, and regexps: User-modified. (line 76) -* case sensitivity, and string comparisons: User-modified. (line 76) -* case sensitivity, array indices and: Array Intro. (line 100) -* case sensitivity, converting case: String Functions. (line 523) -* case sensitivity, example programs: Library Functions. (line 53) -* case sensitivity, gawk: Case-sensitivity. (line 26) -* case sensitivity, regexps and: Case-sensitivity. (line 6) -* CGI, awk scripts for: Options. (line 125) -* character classes, See bracket expressions: Regexp Operators. - (line 56) -* character lists in regular expression: Bracket Expressions. (line 6) -* character lists, See bracket expressions: Regexp Operators. (line 56) -* character sets (machine character encodings): Ordinal Functions. - (line 45) -* character sets (machine character encodings) <1>: Glossary. (line 196) -* character sets, See Also bracket expressions: Regexp Operators. - (line 56) -* characters, counting: Wc Program. (line 6) -* characters, transliterating: Translate Program. (line 6) -* characters, values of as numbers: Ordinal Functions. (line 6) -* Chassell, Robert J.: Acknowledgments. (line 33) -* chdir() extension function: Extension Sample File Functions. - (line 12) -* chem utility: Glossary. (line 206) -* chr() extension function: Extension Sample Ord. - (line 15) -* chr() user-defined function: Ordinal Functions. (line 16) -* clear debugger command: Breakpoint Control. (line 36) -* Cliff random numbers: Cliff Random Function. - (line 6) -* cliff_rand() user-defined function: Cliff Random Function. - (line 12) -* close: Close Files And Pipes. - (line 18) -* close <1>: I/O Functions. (line 10) -* close file or coprocess: I/O Functions. (line 10) -* close() function, portability: Close Files And Pipes. - (line 81) -* close() function, return value: Close Files And Pipes. - (line 132) -* close() function, two-way pipes and: Two-way I/O. (line 60) -* Close, Diane: Manual History. (line 34) -* Close, Diane <1>: Contributors. (line 21) -* Collado, Manuel: Acknowledgments. (line 60) -* collating elements: Bracket Expressions. (line 86) -* collating symbols: Bracket Expressions. (line 93) -* Colombo, Antonio: Acknowledgments. (line 60) -* Colombo, Antonio <1>: Contributors. (line 141) -* columns, aligning: Print Examples. (line 69) -* columns, cutting: Cut Program. (line 6) -* comma (,), in range patterns: Ranges. (line 6) -* command completion, in debugger: Readline Support. (line 6) -* command line, arguments: Other Arguments. (line 6) -* command line, arguments <1>: Auto-set. (line 15) -* command line, arguments <2>: ARGC and ARGV. (line 6) -* command line, directories on: Command-line directories. - (line 6) -* command line, formats: Running gawk. (line 12) -* command line, FS on, setting: Command Line Field Separator. - (line 6) -* command line, invoking awk from: Command Line. (line 6) -* command line, option -f: Long. (line 12) -* command line, options: Options. (line 6) -* command line, options, end of: Options. (line 55) -* command line, variables, assigning on: Assignment Options. (line 6) -* command-line options, processing: Getopt Function. (line 6) -* command-line options, string extraction: String Extraction. (line 6) -* commands debugger command: Debugger Execution Control. - (line 10) -* commands to execute at breakpoint: Debugger Execution Control. - (line 10) -* commenting: Comments. (line 6) -* commenting, backslash continuation and: Statements/Lines. (line 75) -* common extensions, ** operator: Arithmetic Ops. (line 30) -* common extensions, **= operator: Assignment Ops. (line 138) -* common extensions, /dev/stderr special file: Special FD. (line 48) -* common extensions, /dev/stdin special file: Special FD. (line 48) -* common extensions, /dev/stdout special file: Special FD. (line 48) -* common extensions, BINMODE variable: PC Using. (line 16) -* common extensions, delete to delete entire arrays: Delete. (line 39) -* common extensions, func keyword: Definition Syntax. (line 99) -* common extensions, length() applied to an array: String Functions. - (line 200) -* common extensions, RS as a regexp: gawk split records. (line 6) -* common extensions, single character fields: Single Character Fields. - (line 6) -* common extensions, \x escape sequence: Escape Sequences. (line 61) -* comp.lang.awk newsgroup: Usenet. (line 11) -* comparison expressions: Typing and Comparison. - (line 9) -* comparison expressions, as patterns: Expression Patterns. (line 14) -* comparison expressions, string vs. regexp: Comparison Operators. - (line 79) -* compatibility mode (gawk), extensions: POSIX/GNU. (line 6) -* compatibility mode (gawk), file names: Special Caveats. (line 9) -* compatibility mode (gawk), hexadecimal numbers: Nondecimal-numbers. - (line 59) -* compatibility mode (gawk), octal numbers: Nondecimal-numbers. - (line 59) -* compatibility mode (gawk), specifying: Options. (line 82) -* compiled programs: Basic High Level. (line 13) -* compiled programs <1>: Glossary. (line 218) -* compiling gawk for Cygwin: Cygwin. (line 6) -* compiling gawk for MS-Windows: PC Compiling. (line 11) -* compiling gawk for VMS: VMS Compilation. (line 6) -* compl: Bitwise Functions. (line 44) -* complement, bitwise: Bitwise Functions. (line 25) -* compound statements, control statements and: Statements. (line 10) -* concatenating: Concatenation. (line 9) -* condition debugger command: Breakpoint Control. (line 54) -* conditional expressions: Conditional Exp. (line 6) -* configuration option, --disable-extensions: Additional Configuration Options. - (line 9) -* configuration option, --disable-lint: Additional Configuration Options. - (line 15) -* configuration option, --disable-nls: Additional Configuration Options. - (line 32) -* configuration option, --with-whiny-user-strftime: Additional Configuration Options. - (line 37) -* configuration options, gawk: Additional Configuration Options. - (line 6) -* constant regexps: Regexp Usage. (line 57) -* constants, nondecimal: Nondecimal Data. (line 6) -* constants, numeric: Scalar Constants. (line 6) -* constants, types of: Constants. (line 6) -* continue program, in debugger: Debugger Execution Control. - (line 33) -* continue statement: Continue Statement. (line 6) -* control statements: Statements. (line 6) -* controlling array scanning order: Controlling Scanning. - (line 14) -* convert string to lower case: String Functions. (line 524) -* convert string to number: String Functions. (line 391) -* convert string to upper case: String Functions. (line 530) -* converting integer array subscripts: Numeric Array Subscripts. - (line 31) -* converting, dates to timestamps: Time Functions. (line 76) -* converting, numbers to strings: Strings And Numbers. (line 6) -* converting, numbers to strings <1>: Bitwise Functions. (line 111) -* converting, strings to numbers: Strings And Numbers. (line 6) -* converting, strings to numbers <1>: Bitwise Functions. (line 111) -* CONVFMT variable: Strings And Numbers. (line 29) -* CONVFMT variable <1>: User-modified. (line 30) -* CONVFMT variable, and array subscripts: Numeric Array Subscripts. - (line 6) -* cookie: Glossary. (line 257) -* coprocesses: Redirection. (line 96) -* coprocesses <1>: Two-way I/O. (line 27) -* coprocesses, closing: Close Files And Pipes. - (line 6) -* coprocesses, getline from: Getline/Coprocess. (line 6) -* cos: Numeric Functions. (line 16) -* cosine: Numeric Functions. (line 16) -* counting: Wc Program. (line 6) -* csh utility: Statements/Lines. (line 43) -* csh utility, POSIXLY_CORRECT environment variable: Options. (line 358) -* csh utility, |& operator, comparison with: Two-way I/O. (line 27) -* ctime() user-defined function: Function Example. (line 74) -* currency symbols, localization: Explaining gettext. (line 104) -* current system time: Time Functions. (line 66) -* custom.h file: Configuration Philosophy. - (line 30) -* customized input parser: Input Parsers. (line 6) -* customized output wrapper: Output Wrappers. (line 6) -* customized two-way processor: Two-way processors. (line 6) -* cut utility: Cut Program. (line 6) -* cut utility <1>: Cut Program. (line 6) -* cut.awk program: Cut Program. (line 45) -* d debugger command (alias for delete): Breakpoint Control. (line 64) -* d.c., See dark corner: Conventions. (line 42) -* dark corner: Conventions. (line 42) -* dark corner <1>: Glossary. (line 268) -* dark corner, "0" is actually true: Truth Values. (line 24) -* dark corner, /= operator vs. /=.../ regexp constant: Assignment Ops. - (line 149) -* dark corner, array subscripts: Uninitialized Subscripts. - (line 43) -* dark corner, break statement: Break Statement. (line 51) -* dark corner, close() function: Close Files And Pipes. - (line 132) -* dark corner, command-line arguments: Assignment Options. (line 43) -* dark corner, continue statement: Continue Statement. (line 44) -* dark corner, CONVFMT variable: Strings And Numbers. (line 39) -* dark corner, escape sequences: Other Arguments. (line 38) -* dark corner, escape sequences, for metacharacters: Escape Sequences. - (line 144) -* dark corner, exit statement: Exit Statement. (line 30) -* dark corner, field separators: Full Line Fields. (line 22) -* dark corner, FILENAME variable: Getline Notes. (line 19) -* dark corner, FILENAME variable <1>: Auto-set. (line 108) -* dark corner, FNR/NR variables: Auto-set. (line 357) -* dark corner, format-control characters: Control Letters. (line 18) -* dark corner, format-control characters <1>: Control Letters. - (line 93) -* dark corner, FS as null string: Single Character Fields. - (line 20) -* dark corner, input files: awk split records. (line 110) -* dark corner, invoking awk: Command Line. (line 16) -* dark corner, length() function: String Functions. (line 186) -* dark corner, locale's decimal point character: Locale influences conversions. - (line 17) -* dark corner, multiline records: Multiple Line. (line 35) -* dark corner, NF variable, decrementing: Changing Fields. (line 107) -* dark corner, OFMT variable: OFMT. (line 27) -* dark corner, regexp as second argument to index(): String Functions. - (line 164) -* dark corner, regexp constants: Using Constant Regexps. - (line 6) -* dark corner, regexp constants, /= operator and: Assignment Ops. - (line 149) -* dark corner, regexp constants, as arguments to user-defined functions: Using Constant Regexps. - (line 43) -* dark corner, split() function: String Functions. (line 361) -* dark corner, strings, storing: gawk split records. (line 82) -* dark corner, value of ARGV[0]: Auto-set. (line 39) -* dark corner, ^, in FS: Regexp Field Splitting. - (line 59) -* data, fixed-width: Constant Size. (line 6) -* data-driven languages: Basic High Level. (line 74) -* database, group, reading: Group Functions. (line 6) -* database, users, reading: Passwd Functions. (line 6) -* date utility, GNU: Time Functions. (line 17) -* date utility, POSIX: Time Functions. (line 253) -* dates, converting to timestamps: Time Functions. (line 76) -* dates, information related to, localization: Explaining gettext. - (line 112) -* Davies, Stephen: Acknowledgments. (line 60) -* Davies, Stephen <1>: Contributors. (line 75) -* Day, Robert P.J.: Acknowledgments. (line 79) -* dcgettext: I18N Functions. (line 21) -* dcgettext <1>: Programmer i18n. (line 20) -* dcgettext() function (gawk), portability and: I18N Portability. - (line 33) -* dcngettext: I18N Functions. (line 27) -* dcngettext <1>: Programmer i18n. (line 37) -* dcngettext() function (gawk), portability and: I18N Portability. - (line 33) -* deadlocks: Two-way I/O. (line 53) -* debugger commands, b (break): Breakpoint Control. (line 11) -* debugger commands, backtrace: Execution Stack. (line 13) -* debugger commands, break: Breakpoint Control. (line 11) -* debugger commands, bt (backtrace): Execution Stack. (line 13) -* debugger commands, c (continue): Debugger Execution Control. - (line 33) -* debugger commands, clear: Breakpoint Control. (line 36) -* debugger commands, commands: Debugger Execution Control. - (line 10) -* debugger commands, condition: Breakpoint Control. (line 54) -* debugger commands, continue: Debugger Execution Control. - (line 33) -* debugger commands, d (delete): Breakpoint Control. (line 64) -* debugger commands, delete: Breakpoint Control. (line 64) -* debugger commands, disable: Breakpoint Control. (line 69) -* debugger commands, display: Viewing And Changing Data. - (line 8) -* debugger commands, down: Execution Stack. (line 23) -* debugger commands, dump: Miscellaneous Debugger Commands. - (line 9) -* debugger commands, e (enable): Breakpoint Control. (line 73) -* debugger commands, enable: Breakpoint Control. (line 73) -* debugger commands, end: Debugger Execution Control. - (line 10) -* debugger commands, eval: Viewing And Changing Data. - (line 23) -* debugger commands, f (frame): Execution Stack. (line 27) -* debugger commands, finish: Debugger Execution Control. - (line 39) -* debugger commands, frame: Execution Stack. (line 27) -* debugger commands, h (help): Miscellaneous Debugger Commands. - (line 69) -* debugger commands, help: Miscellaneous Debugger Commands. - (line 69) -* debugger commands, i (info): Debugger Info. (line 13) -* debugger commands, ignore: Breakpoint Control. (line 87) -* debugger commands, info: Debugger Info. (line 13) -* debugger commands, l (list): Miscellaneous Debugger Commands. - (line 75) -* debugger commands, list: Miscellaneous Debugger Commands. - (line 75) -* debugger commands, n (next): Debugger Execution Control. - (line 43) -* debugger commands, next: Debugger Execution Control. - (line 43) -* debugger commands, nexti: Debugger Execution Control. - (line 49) -* debugger commands, ni (nexti): Debugger Execution Control. - (line 49) -* debugger commands, o (option): Debugger Info. (line 57) -* debugger commands, option: Debugger Info. (line 57) -* debugger commands, p (print): Viewing And Changing Data. - (line 35) -* debugger commands, print: Viewing And Changing Data. - (line 35) -* debugger commands, printf: Viewing And Changing Data. - (line 53) -* debugger commands, q (quit): Miscellaneous Debugger Commands. - (line 102) -* debugger commands, quit: Miscellaneous Debugger Commands. - (line 102) -* debugger commands, r (run): Debugger Execution Control. - (line 62) -* debugger commands, return: Debugger Execution Control. - (line 54) -* debugger commands, run: Debugger Execution Control. - (line 62) -* debugger commands, s (step): Debugger Execution Control. - (line 68) -* debugger commands, set: Viewing And Changing Data. - (line 58) -* debugger commands, si (stepi): Debugger Execution Control. - (line 75) -* debugger commands, silent: Debugger Execution Control. - (line 10) -* debugger commands, step: Debugger Execution Control. - (line 68) -* debugger commands, stepi: Debugger Execution Control. - (line 75) -* debugger commands, t (tbreak): Breakpoint Control. (line 90) -* debugger commands, tbreak: Breakpoint Control. (line 90) -* debugger commands, trace: Miscellaneous Debugger Commands. - (line 110) -* debugger commands, u (until): Debugger Execution Control. - (line 82) -* debugger commands, undisplay: Viewing And Changing Data. - (line 79) -* debugger commands, until: Debugger Execution Control. - (line 82) -* debugger commands, unwatch: Viewing And Changing Data. - (line 83) -* debugger commands, up: Execution Stack. (line 36) -* debugger commands, w (watch): Viewing And Changing Data. - (line 66) -* debugger commands, watch: Viewing And Changing Data. - (line 66) -* debugger commands, where (backtrace): Execution Stack. (line 13) -* debugger default list amount: Debugger Info. (line 69) -* debugger history file: Debugger Info. (line 81) -* debugger history size: Debugger Info. (line 65) -* debugger options: Debugger Info. (line 57) -* debugger prompt: Debugger Info. (line 78) -* debugger, how to start: Debugger Invocation. (line 6) -* debugger, read commands from a file: Debugger Info. (line 97) -* debugging awk programs: Debugger. (line 6) -* debugging gawk, bug reports: Bugs. (line 9) -* decimal point character, locale specific: Options. (line 269) -* decrement operators: Increment Ops. (line 35) -* default keyword: Switch Statement. (line 6) -* Deifik, Scott: Acknowledgments. (line 60) -* Deifik, Scott <1>: Contributors. (line 54) -* Deifik, Scott <2>: Maintainers. (line 14) -* delete ARRAY: Delete. (line 39) -* delete breakpoint at location: Breakpoint Control. (line 36) -* delete breakpoint by number: Breakpoint Control. (line 64) -* delete debugger command: Breakpoint Control. (line 64) -* delete statement: Delete. (line 6) -* delete watchpoint: Viewing And Changing Data. - (line 83) -* deleting elements in arrays: Delete. (line 6) -* deleting entire arrays: Delete. (line 39) -* Demaille, Akim: Acknowledgments. (line 60) -* describe call stack frame, in debugger: Debugger Info. (line 27) -* differences between gawk and awk: String Functions. (line 200) -* differences in awk and gawk, ARGC/ARGV variables: ARGC and ARGV. - (line 89) -* differences in awk and gawk, ARGIND variable: Auto-set. (line 44) -* differences in awk and gawk, array elements, deleting: Delete. - (line 39) -* differences in awk and gawk, AWKLIBPATH environment variable: AWKLIBPATH Variable. - (line 6) -* differences in awk and gawk, AWKPATH environment variable: AWKPATH Variable. - (line 6) -* differences in awk and gawk, BEGIN/END patterns: I/O And BEGIN/END. - (line 15) -* differences in awk and gawk, BEGINFILE/ENDFILE patterns: BEGINFILE/ENDFILE. - (line 6) -* differences in awk and gawk, BINMODE variable: User-modified. - (line 15) -* differences in awk and gawk, BINMODE variable <1>: PC Using. - (line 16) -* differences in awk and gawk, close() function: Close Files And Pipes. - (line 81) -* differences in awk and gawk, close() function <1>: Close Files And Pipes. - (line 132) -* differences in awk and gawk, command-line directories: Command-line directories. - (line 6) -* differences in awk and gawk, ERRNO variable: Auto-set. (line 87) -* differences in awk and gawk, error messages: Special FD. (line 19) -* differences in awk and gawk, FIELDWIDTHS variable: User-modified. - (line 37) -* differences in awk and gawk, FPAT variable: User-modified. (line 43) -* differences in awk and gawk, FUNCTAB variable: Auto-set. (line 134) -* differences in awk and gawk, function arguments (gawk): Calling Built-in. - (line 16) -* differences in awk and gawk, getline command: Getline. (line 19) -* differences in awk and gawk, IGNORECASE variable: User-modified. - (line 76) -* differences in awk and gawk, implementation limitations: Getline Notes. - (line 14) -* differences in awk and gawk, implementation limitations <1>: Redirection. - (line 129) -* differences in awk and gawk, indirect function calls: Indirect Calls. - (line 6) -* differences in awk and gawk, input/output operators: Getline/Coprocess. - (line 6) -* differences in awk and gawk, input/output operators <1>: Redirection. - (line 96) -* differences in awk and gawk, line continuations: Conditional Exp. - (line 34) -* differences in awk and gawk, LINT variable: User-modified. (line 87) -* differences in awk and gawk, match() function: String Functions. - (line 262) -* differences in awk and gawk, print/printf statements: Format Modifiers. - (line 13) -* differences in awk and gawk, PROCINFO array: Auto-set. (line 148) -* differences in awk and gawk, read timeouts: Read Timeout. (line 6) -* differences in awk and gawk, record separators: awk split records. - (line 124) -* differences in awk and gawk, regexp constants: Using Constant Regexps. - (line 43) -* differences in awk and gawk, regular expressions: Case-sensitivity. - (line 26) -* differences in awk and gawk, retrying input: Retrying Input. - (line 6) -* differences in awk and gawk, RS/RT variables: gawk split records. - (line 58) -* differences in awk and gawk, RT variable: Auto-set. (line 295) -* differences in awk and gawk, single-character fields: Single Character Fields. - (line 6) -* differences in awk and gawk, split() function: String Functions. - (line 348) -* differences in awk and gawk, strings: Scalar Constants. (line 20) -* differences in awk and gawk, strings, storing: gawk split records. - (line 76) -* differences in awk and gawk, SYMTAB variable: Auto-set. (line 299) -* differences in awk and gawk, TEXTDOMAIN variable: User-modified. - (line 152) -* differences in awk and gawk, trunc-mod operation: Arithmetic Ops. - (line 66) -* directories, command-line: Command-line directories. - (line 6) -* directories, searching: Programs Exercises. (line 70) -* directories, searching for loadable extensions: AWKLIBPATH Variable. - (line 6) -* directories, searching for source files: AWKPATH Variable. (line 6) -* disable breakpoint: Breakpoint Control. (line 69) -* disable debugger command: Breakpoint Control. (line 69) -* display debugger command: Viewing And Changing Data. - (line 8) -* display debugger options: Debugger Info. (line 57) -* division: Arithmetic Ops. (line 44) -* do-while statement: Do Statement. (line 6) -* do-while statement, use of regexps in: Regexp Usage. (line 19) -* documentation, of awk programs: Library Names. (line 6) -* documentation, online: Manual History. (line 11) -* documents, searching: Dupword Program. (line 6) -* dollar sign ($), $ field operator: Fields. (line 19) -* dollar sign ($), $ field operator <1>: Precedence. (line 42) -* dollar sign ($), incrementing fields and arrays: Increment Ops. - (line 30) -* dollar sign ($), regexp operator: Regexp Operators. (line 35) -* double quote ("), in regexp constants: Computed Regexps. (line 30) -* double quote ("), in shell commands: Quoting. (line 54) -* down debugger command: Execution Stack. (line 23) -* Drepper, Ulrich: Acknowledgments. (line 52) -* Duman, Patrice: Acknowledgments. (line 75) -* dump all variables of a program: Options. (line 94) -* dump debugger command: Miscellaneous Debugger Commands. - (line 9) -* dupword.awk program: Dupword Program. (line 31) -* dynamic profiling: Profiling. (line 177) -* dynamically loaded extensions: Dynamic Extensions. (line 6) -* e debugger command (alias for enable): Breakpoint Control. (line 73) -* EBCDIC: Ordinal Functions. (line 45) -* effective group ID of gawk user: Auto-set. (line 153) -* effective user ID of gawk user: Auto-set. (line 161) -* egrep utility: Bracket Expressions. (line 34) -* egrep utility <1>: Egrep Program. (line 6) -* egrep.awk program: Egrep Program. (line 53) -* elements in arrays, assigning values: Assigning Elements. (line 6) -* elements in arrays, deleting: Delete. (line 6) -* elements in arrays, order of access by in operator: Scanning an Array. - (line 48) -* elements in arrays, scanning: Scanning an Array. (line 6) -* elements of arrays: Reference to Elements. - (line 6) -* email address for bug reports, bug-gawk@gnu.org: Bug address. - (line 22) -* empty array elements: Reference to Elements. - (line 18) -* empty pattern: Empty. (line 6) -* empty strings: awk split records. (line 114) -* empty strings, See null strings: Regexp Field Splitting. - (line 43) -* EMRED: TCP/IP Networking. (line 6) -* enable breakpoint: Breakpoint Control. (line 73) -* enable debugger command: Breakpoint Control. (line 73) -* end debugger command: Debugger Execution Control. - (line 10) -* END pattern: BEGIN/END. (line 6) -* END pattern <1>: Using BEGIN/END. (line 6) -* END pattern, and profiling: Profiling. (line 62) -* END pattern, assert() user-defined function and: Assert Function. - (line 75) -* END pattern, Boolean patterns and: Expression Patterns. (line 70) -* END pattern, exit statement and: Exit Statement. (line 12) -* END pattern, next/nextfile statements and: I/O And BEGIN/END. - (line 36) -* END pattern, next/nextfile statements and <1>: Next Statement. - (line 44) -* END pattern, operators and: Using BEGIN/END. (line 17) -* END pattern, print statement and: I/O And BEGIN/END. (line 15) -* ENDFILE pattern: BEGINFILE/ENDFILE. (line 6) -* ENDFILE pattern, Boolean patterns and: Expression Patterns. (line 70) -* endfile() user-defined function: Filetrans Function. (line 62) -* endgrent() function (C library): Group Functions. (line 213) -* endgrent() user-defined function: Group Functions. (line 216) -* endpwent() function (C library): Passwd Functions. (line 208) -* endpwent() user-defined function: Passwd Functions. (line 211) -* English, Steve: Advanced Features. (line 6) -* ENVIRON array: Auto-set. (line 59) -* environment variables used by gawk: Environment Variables. - (line 6) -* environment variables, in ENVIRON array: Auto-set. (line 59) -* epoch, definition of: Glossary. (line 312) -* equals sign (=), = operator: Assignment Ops. (line 6) -* equals sign (=), == operator: Comparison Operators. - (line 11) -* equals sign (=), == operator <1>: Precedence. (line 64) -* EREs (Extended Regular Expressions): Bracket Expressions. (line 34) -* ERRNO variable: Auto-set. (line 87) -* ERRNO variable <1>: TCP/IP Networking. (line 54) -* ERRNO variable, with BEGINFILE pattern: BEGINFILE/ENDFILE. (line 26) -* ERRNO variable, with close() function: Close Files And Pipes. - (line 140) -* ERRNO variable, with getline command: Getline. (line 19) -* error handling: Special FD. (line 19) -* error handling, ERRNO variable and: Auto-set. (line 87) -* error output: Special FD. (line 6) -* escape processing, gsub()/gensub()/sub() functions: Gory Details. - (line 6) -* escape sequences, in strings: Escape Sequences. (line 6) -* eval debugger command: Viewing And Changing Data. - (line 23) -* evaluate expressions, in debugger: Viewing And Changing Data. - (line 23) -* evaluation order: Increment Ops. (line 60) -* evaluation order, concatenation: Concatenation. (line 41) -* evaluation order, functions: Calling Built-in. (line 30) -* examining fields: Fields. (line 6) -* exclamation point (!), ! operator: Boolean Ops. (line 69) -* exclamation point (!), ! operator <1>: Precedence. (line 51) -* exclamation point (!), ! operator <2>: Egrep Program. (line 174) -* exclamation point (!), != operator: Comparison Operators. - (line 11) -* exclamation point (!), != operator <1>: Precedence. (line 64) -* exclamation point (!), !~ operator: Regexp Usage. (line 19) -* exclamation point (!), !~ operator <1>: Computed Regexps. (line 6) -* exclamation point (!), !~ operator <2>: Case-sensitivity. (line 26) -* exclamation point (!), !~ operator <3>: Regexp Constants. (line 6) -* exclamation point (!), !~ operator <4>: Comparison Operators. - (line 11) -* exclamation point (!), !~ operator <5>: Comparison Operators. - (line 98) -* exclamation point (!), !~ operator <6>: Precedence. (line 79) -* exclamation point (!), !~ operator <7>: Expression Patterns. - (line 24) -* exit debugger command: Miscellaneous Debugger Commands. - (line 66) -* exit statement: Exit Statement. (line 6) -* exit status, of gawk: Exit Status. (line 6) -* exit status, of VMS: VMS Running. (line 28) -* exit the debugger: Miscellaneous Debugger Commands. - (line 66) -* exit the debugger <1>: Miscellaneous Debugger Commands. - (line 102) -* exp: Numeric Functions. (line 19) -* expand utility: Very Simple. (line 73) -* Expat XML parser library: gawkextlib. (line 37) -* exponent: Numeric Functions. (line 19) -* expressions: Expressions. (line 6) -* expressions, as patterns: Expression Patterns. (line 6) -* expressions, assignment: Assignment Ops. (line 6) -* expressions, Boolean: Boolean Ops. (line 6) -* expressions, comparison: Typing and Comparison. - (line 9) -* expressions, conditional: Conditional Exp. (line 6) -* expressions, matching, See comparison expressions: Typing and Comparison. - (line 9) -* expressions, selecting: Conditional Exp. (line 6) -* Extended Regular Expressions (EREs): Bracket Expressions. (line 34) -* extension API: Extension API Description. - (line 6) -* extension API informational variables: Extension API Informational Variables. - (line 6) -* extension API version: Extension Versioning. - (line 6) -* extension API, version number: Auto-set. (line 246) -* extension example: Extension Example. (line 6) -* extension registration: Registration Functions. - (line 6) -* extension search path: Finding Extensions. (line 6) -* extensions distributed with gawk: Extension Samples. (line 6) -* extensions, allocating memory: Memory Allocation Functions. - (line 6) -* extensions, Brian Kernighan's awk: BTL. (line 6) -* extensions, Brian Kernighan's awk <1>: Common Extensions. (line 6) -* extensions, common, ** operator: Arithmetic Ops. (line 30) -* extensions, common, **= operator: Assignment Ops. (line 138) -* extensions, common, /dev/stderr special file: Special FD. (line 48) -* extensions, common, /dev/stdin special file: Special FD. (line 48) -* extensions, common, /dev/stdout special file: Special FD. (line 48) -* extensions, common, BINMODE variable: PC Using. (line 16) -* extensions, common, delete to delete entire arrays: Delete. (line 39) -* extensions, common, fflush() function: I/O Functions. (line 43) -* extensions, common, func keyword: Definition Syntax. (line 99) -* extensions, common, length() applied to an array: String Functions. - (line 200) -* extensions, common, RS as a regexp: gawk split records. (line 6) -* extensions, common, single character fields: Single Character Fields. - (line 6) -* extensions, common, \x escape sequence: Escape Sequences. (line 61) -* extensions, in gawk, not in POSIX awk: POSIX/GNU. (line 6) -* extensions, loading, @load directive: Loading Shared Libraries. - (line 8) -* extensions, mawk: Common Extensions. (line 6) -* extensions, where to find: gawkextlib. (line 6) -* extract.awk program: Extract Program. (line 79) -* extraction, of marked strings (internationalization): String Extraction. - (line 6) -* f debugger command (alias for frame): Execution Stack. (line 27) -* false, logical: Truth Values. (line 6) -* FDL (Free Documentation License): GNU Free Documentation License. - (line 8) -* features, adding to gawk: Adding Code. (line 6) -* features, deprecated: Obsolete. (line 6) -* features, undocumented: Undocumented. (line 6) -* Fenlason, Jay: History. (line 30) -* Fenlason, Jay <1>: Contributors. (line 19) -* fflush: I/O Functions. (line 28) -* field numbers: Nonconstant Fields. (line 6) -* field operator $: Fields. (line 19) -* field operators, dollar sign as: Fields. (line 19) -* field separator, in multiline records: Multiple Line. (line 41) -* field separator, on command line: Command Line Field Separator. - (line 6) -* field separator, POSIX and: Full Line Fields. (line 16) -* field separators: Field Separators. (line 15) -* field separators <1>: User-modified. (line 50) -* field separators <2>: User-modified. (line 113) -* field separators, choice of: Field Separators. (line 50) -* field separators, FIELDWIDTHS variable and: User-modified. (line 37) -* field separators, FPAT variable and: User-modified. (line 43) -* field separators, regular expressions as: Field Separators. (line 50) -* field separators, regular expressions as <1>: Regexp Field Splitting. - (line 6) -* field separators, See Also OFS: Changing Fields. (line 64) -* field separators, spaces as: Cut Program. (line 103) -* fields: Reading Files. (line 14) -* fields <1>: Fields. (line 6) -* fields <2>: Basic High Level. (line 62) -* fields, adding: Changing Fields. (line 53) -* fields, changing contents of: Changing Fields. (line 6) -* fields, cutting: Cut Program. (line 6) -* fields, examining: Fields. (line 6) -* fields, number of: Fields. (line 33) -* fields, numbers: Nonconstant Fields. (line 6) -* fields, printing: Print Examples. (line 20) -* fields, separating: Field Separators. (line 15) -* fields, separating <1>: Field Separators. (line 15) -* fields, single-character: Single Character Fields. - (line 6) -* FIELDWIDTHS variable: Constant Size. (line 22) -* FIELDWIDTHS variable <1>: User-modified. (line 37) -* file descriptors: Special FD. (line 6) -* file inclusion, @include directive: Include Files. (line 8) -* file names, distinguishing: Auto-set. (line 55) -* file names, in compatibility mode: Special Caveats. (line 9) -* file names, standard streams in gawk: Special FD. (line 48) -* FILENAME variable: Reading Files. (line 6) -* FILENAME variable <1>: Auto-set. (line 108) -* FILENAME variable, getline, setting with: Getline Notes. (line 19) -* filenames, assignments as: Ignoring Assigns. (line 6) -* files, .gmo: Explaining gettext. (line 42) -* files, .gmo, specifying directory of: Explaining gettext. (line 54) -* files, .gmo, specifying directory of <1>: Programmer i18n. (line 48) -* files, .mo, converting from .po: I18N Example. (line 66) -* files, .po: Explaining gettext. (line 37) -* files, .po <1>: Translator i18n. (line 6) -* files, .po, converting to .mo: I18N Example. (line 66) -* files, .pot: Explaining gettext. (line 31) -* files, /dev/... special files: Special FD. (line 48) -* files, /inet/... (gawk): TCP/IP Networking. (line 6) -* files, /inet4/... (gawk): TCP/IP Networking. (line 6) -* files, /inet6/... (gawk): TCP/IP Networking. (line 6) -* files, awk programs in: Long. (line 6) -* files, awkprof.out: Profiling. (line 6) -* files, awkvars.out: Options. (line 94) -* files, closing: I/O Functions. (line 10) -* files, descriptors, See file descriptors: Special FD. (line 6) -* files, group: Group Functions. (line 6) -* files, initialization and cleanup: Filetrans Function. (line 6) -* files, input, See input files: Read Terminal. (line 16) -* files, log, timestamps in: Time Functions. (line 6) -* files, managing: Data File Management. - (line 6) -* files, managing, data file boundaries: Filetrans Function. (line 6) -* files, message object: Explaining gettext. (line 42) -* files, message object, converting from portable object files: I18N Example. - (line 66) -* files, message object, specifying directory of: Explaining gettext. - (line 54) -* files, message object, specifying directory of <1>: Programmer i18n. - (line 48) -* files, multiple passes over: Other Arguments. (line 56) -* files, multiple, duplicating output into: Tee Program. (line 6) -* files, output, See output files: Close Files And Pipes. - (line 6) -* files, password: Passwd Functions. (line 16) -* files, portable object: Explaining gettext. (line 37) -* files, portable object <1>: Translator i18n. (line 6) -* files, portable object template: Explaining gettext. (line 31) -* files, portable object, converting to message object files: I18N Example. - (line 66) -* files, portable object, generating: Options. (line 147) -* files, processing, ARGIND variable and: Auto-set. (line 50) -* files, reading: Rewind Function. (line 6) -* files, reading, multiline records: Multiple Line. (line 6) -* files, searching for regular expressions: Egrep Program. (line 6) -* files, skipping: File Checking. (line 6) -* files, source, search path for: Programs Exercises. (line 70) -* files, splitting: Split Program. (line 6) -* files, Texinfo, extracting programs from: Extract Program. (line 6) -* find substring in string: String Functions. (line 155) -* finding extensions: Finding Extensions. (line 6) -* finish debugger command: Debugger Execution Control. - (line 39) -* Fish, Fred: Contributors. (line 51) -* fixed-width data: Constant Size. (line 6) -* flag variables: Boolean Ops. (line 69) -* flag variables <1>: Tee Program. (line 20) -* floating-point, numbers, arbitrary precision: Arbitrary Precision Arithmetic. - (line 6) -* floating-point, VAX/VMS: VMS Running. (line 50) -* flush buffered output: I/O Functions. (line 28) -* fnmatch() extension function: Extension Sample Fnmatch. - (line 12) -* FNR variable: Records. (line 6) -* FNR variable <1>: Auto-set. (line 118) -* FNR variable, changing: Auto-set. (line 357) -* for statement: For Statement. (line 6) -* for statement, looping over arrays: Scanning an Array. (line 20) -* fork() extension function: Extension Sample Fork. - (line 11) -* format specifiers: Basic Printf. (line 15) -* format specifiers, mixing regular with positional specifiers: Printf Ordering. - (line 57) -* format specifiers, printf statement: Control Letters. (line 6) -* format specifiers, strftime() function (gawk): Time Functions. - (line 89) -* format time string: Time Functions. (line 48) -* formats, numeric output: OFMT. (line 6) -* formatting output: Printf. (line 6) -* formatting strings: String Functions. (line 384) -* forward slash (/) to enclose regular expressions: Regexp. (line 10) -* forward slash (/), / operator: Precedence. (line 54) -* forward slash (/), /= operator: Assignment Ops. (line 129) -* forward slash (/), /= operator <1>: Precedence. (line 94) -* forward slash (/), /= operator, vs. /=.../ regexp constant: Assignment Ops. - (line 149) -* forward slash (/), patterns and: Expression Patterns. (line 24) -* FPAT variable: Splitting By Content. - (line 25) -* FPAT variable <1>: User-modified. (line 43) -* frame debugger command: Execution Stack. (line 27) -* Free Documentation License (FDL): GNU Free Documentation License. - (line 8) -* Free Software Foundation (FSF): Manual History. (line 6) -* Free Software Foundation (FSF) <1>: Getting. (line 10) -* Free Software Foundation (FSF) <2>: Glossary. (line 372) -* Free Software Foundation (FSF) <3>: Glossary. (line 405) -* FreeBSD: Glossary. (line 748) -* FS variable: Field Separators. (line 15) -* FS variable <1>: User-modified. (line 50) -* FS variable, --field-separator option and: Options. (line 21) -* FS variable, as null string: Single Character Fields. - (line 20) -* FS variable, as TAB character: Options. (line 266) -* FS variable, changing value of: Field Separators. (line 34) -* FS variable, running awk programs and: Cut Program. (line 63) -* FS variable, setting from command line: Command Line Field Separator. - (line 6) -* FS, containing ^: Regexp Field Splitting. - (line 59) -* FS, in multiline records: Multiple Line. (line 41) -* FSF (Free Software Foundation): Manual History. (line 6) -* FSF (Free Software Foundation) <1>: Getting. (line 10) -* FSF (Free Software Foundation) <2>: Glossary. (line 372) -* FSF (Free Software Foundation) <3>: Glossary. (line 405) -* fts() extension function: Extension Sample File Functions. - (line 60) -* FUNCTAB array: Auto-set. (line 134) -* function calls: Function Calls. (line 6) -* function calls, indirect: Indirect Calls. (line 6) -* function calls, indirect, @-notation for: Indirect Calls. (line 47) -* function definition example: Function Example. (line 6) -* function pointers: Indirect Calls. (line 6) -* functions, arrays as parameters to: Pass By Value/Reference. - (line 44) -* functions, built-in: Function Calls. (line 10) -* functions, built-in <1>: Functions. (line 6) -* functions, built-in, evaluation order: Calling Built-in. (line 30) -* functions, defining: Definition Syntax. (line 10) -* functions, library: Library Functions. (line 6) -* functions, library, assertions: Assert Function. (line 6) -* functions, library, associative arrays and: Library Names. (line 58) -* functions, library, C library: Getopt Function. (line 6) -* functions, library, character values as numbers: Ordinal Functions. - (line 6) -* functions, library, Cliff random numbers: Cliff Random Function. - (line 6) -* functions, library, command-line options: Getopt Function. (line 6) -* functions, library, example program for using: Igawk Program. - (line 6) -* functions, library, group database, reading: Group Functions. - (line 6) -* functions, library, managing data files: Data File Management. - (line 6) -* functions, library, managing time: Getlocaltime Function. - (line 6) -* functions, library, merging arrays into strings: Join Function. - (line 6) -* functions, library, rounding numbers: Round Function. (line 6) -* functions, library, user database, reading: Passwd Functions. - (line 6) -* functions, names of: Definition Syntax. (line 24) -* functions, recursive: Definition Syntax. (line 89) -* functions, string-translation: I18N Functions. (line 6) -* functions, undefined: Pass By Value/Reference. - (line 68) -* functions, user-defined: User-defined. (line 6) -* functions, user-defined, calling: Function Caveats. (line 6) -* functions, user-defined, counts, in a profile: Profiling. (line 137) -* functions, user-defined, library of: Library Functions. (line 6) -* functions, user-defined, next/nextfile statements and: Next Statement. - (line 44) -* functions, user-defined, next/nextfile statements and <1>: Nextfile Statement. - (line 47) -* G-d: Acknowledgments. (line 94) -* G., Daniel Richard: Acknowledgments. (line 60) -* G., Daniel Richard <1>: Maintainers. (line 14) -* Garfinkle, Scott: Contributors. (line 35) -* gawk program, dynamic profiling: Profiling. (line 177) -* gawk version: Auto-set. (line 221) -* gawk, ARGIND variable in: Other Arguments. (line 15) -* gawk, awk and: Preface. (line 21) -* gawk, awk and <1>: This Manual. (line 14) -* gawk, bitwise operations in: Bitwise Functions. (line 40) -* gawk, break statement in: Break Statement. (line 51) -* gawk, character classes and: Bracket Expressions. (line 108) -* gawk, coding style in: Adding Code. (line 37) -* gawk, command-line options, and regular expressions: GNU Regexp Operators. - (line 73) -* gawk, configuring: Configuration Philosophy. - (line 6) -* gawk, configuring, options: Additional Configuration Options. - (line 6) -* gawk, continue statement in: Continue Statement. (line 44) -* gawk, distribution: Distribution contents. - (line 6) -* gawk, ERRNO variable in: Getline. (line 19) -* gawk, ERRNO variable in <1>: Close Files And Pipes. - (line 140) -* gawk, ERRNO variable in <2>: BEGINFILE/ENDFILE. (line 26) -* gawk, ERRNO variable in <3>: Auto-set. (line 87) -* gawk, ERRNO variable in <4>: TCP/IP Networking. (line 54) -* gawk, escape sequences: Escape Sequences. (line 121) -* gawk, extensions, disabling: Options. (line 257) -* gawk, features, adding: Adding Code. (line 6) -* gawk, features, advanced: Advanced Features. (line 6) -* gawk, field separators and: User-modified. (line 71) -* gawk, FIELDWIDTHS variable in: Constant Size. (line 22) -* gawk, FIELDWIDTHS variable in <1>: User-modified. (line 37) -* gawk, file names in: Special Files. (line 6) -* gawk, format-control characters: Control Letters. (line 18) -* gawk, format-control characters <1>: Control Letters. (line 93) -* gawk, FPAT variable in: Splitting By Content. - (line 25) -* gawk, FPAT variable in <1>: User-modified. (line 43) -* gawk, FUNCTAB array in: Auto-set. (line 134) -* gawk, function arguments and: Calling Built-in. (line 16) -* gawk, hexadecimal numbers and: Nondecimal-numbers. (line 41) -* gawk, IGNORECASE variable in: Case-sensitivity. (line 26) -* gawk, IGNORECASE variable in <1>: User-modified. (line 76) -* gawk, IGNORECASE variable in <2>: Array Intro. (line 100) -* gawk, IGNORECASE variable in <3>: String Functions. (line 58) -* gawk, IGNORECASE variable in <4>: Array Sorting Functions. - (line 83) -* gawk, implementation issues: Notes. (line 6) -* gawk, implementation issues, debugging: Compatibility Mode. (line 6) -* gawk, implementation issues, downward compatibility: Compatibility Mode. - (line 6) -* gawk, implementation issues, limits: Getline Notes. (line 14) -* gawk, implementation issues, pipes: Redirection. (line 129) -* gawk, installing: Installation. (line 6) -* gawk, internationalization and, See internationalization: Internationalization. - (line 13) -* gawk, interpreter, adding code to: Using Internal File Ops. - (line 6) -* gawk, interval expressions and: Regexp Operators. (line 139) -* gawk, line continuation in: Conditional Exp. (line 34) -* gawk, LINT variable in: User-modified. (line 87) -* gawk, list of contributors to: Contributors. (line 6) -* gawk, MS-Windows version of: PC Using. (line 9) -* gawk, newlines in: Statements/Lines. (line 12) -* gawk, octal numbers and: Nondecimal-numbers. (line 41) -* gawk, predefined variables and: Built-in Variables. (line 14) -* gawk, PROCINFO array in: Auto-set. (line 148) -* gawk, PROCINFO array in <1>: Time Functions. (line 47) -* gawk, PROCINFO array in <2>: Two-way I/O. (line 114) -* gawk, regexp constants and: Using Constant Regexps. - (line 28) -* gawk, regular expressions, case sensitivity: Case-sensitivity. - (line 26) -* gawk, regular expressions, operators: GNU Regexp Operators. - (line 6) -* gawk, regular expressions, precedence: Regexp Operators. (line 161) -* gawk, RT variable in: awk split records. (line 124) -* gawk, RT variable in <1>: Multiple Line. (line 130) -* gawk, RT variable in <2>: Auto-set. (line 295) -* gawk, See Also awk: Preface. (line 34) -* gawk, source code, obtaining: Getting. (line 6) -* gawk, splitting fields and: Constant Size. (line 86) -* gawk, string-translation functions: I18N Functions. (line 6) -* gawk, SYMTAB array in: Auto-set. (line 299) -* gawk, TEXTDOMAIN variable in: User-modified. (line 152) -* gawk, timestamps: Time Functions. (line 6) -* gawk, uses for: Preface. (line 34) -* gawk, versions of, information about, printing: Options. (line 304) -* gawk, VMS version of: VMS Installation. (line 6) -* gawk, word-boundary operator: GNU Regexp Operators. - (line 66) -* gawkextlib: gawkextlib. (line 6) -* gawkextlib project: gawkextlib. (line 6) -* gawklibpath_append shell function: Shell Startup Files. (line 29) -* gawklibpath_default shell function: Shell Startup Files. (line 22) -* gawklibpath_prepend shell function: Shell Startup Files. (line 25) -* gawkpath_append shell function: Shell Startup Files. (line 19) -* gawkpath_default shell function: Shell Startup Files. (line 12) -* gawkpath_prepend shell function: Shell Startup Files. (line 15) -* General Public License (GPL): Glossary. (line 396) -* General Public License, See GPL: Manual History. (line 11) -* generate time values: Time Functions. (line 25) -* gensub: Using Constant Regexps. - (line 43) -* gensub <1>: String Functions. (line 89) -* gensub() function (gawk), escape processing: Gory Details. (line 6) -* getaddrinfo() function (C library): TCP/IP Networking. (line 39) -* getgrent() function (C library): Group Functions. (line 6) -* getgrent() function (C library) <1>: Group Functions. (line 202) -* getgrent() user-defined function: Group Functions. (line 6) -* getgrent() user-defined function <1>: Group Functions. (line 205) -* getgrgid() function (C library): Group Functions. (line 184) -* getgrgid() user-defined function: Group Functions. (line 187) -* getgrnam() function (C library): Group Functions. (line 173) -* getgrnam() user-defined function: Group Functions. (line 178) -* getgruser() function (C library): Group Functions. (line 193) -* getgruser() function, user-defined: Group Functions. (line 196) -* getline command: Reading Files. (line 20) -* getline command, coprocesses, using from: Getline/Coprocess. - (line 6) -* getline command, coprocesses, using from <1>: Close Files And Pipes. - (line 6) -* getline command, deadlock and: Two-way I/O. (line 53) -* getline command, explicit input with: Getline. (line 6) -* getline command, FILENAME variable and: Getline Notes. (line 19) -* getline command, return values: Getline. (line 19) -* getline command, variants: Getline Summary. (line 6) -* getline command, _gr_init() user-defined function: Group Functions. - (line 83) -* getline command, _pw_init() function: Passwd Functions. (line 154) -* getline from a file: Getline/File. (line 6) -* getline into a variable: Getline/Variable. (line 6) -* getline statement, BEGINFILE/ENDFILE patterns and: BEGINFILE/ENDFILE. - (line 53) -* getlocaltime() user-defined function: Getlocaltime Function. - (line 16) -* getopt() function (C library): Getopt Function. (line 15) -* getopt() user-defined function: Getopt Function. (line 108) -* getopt() user-defined function <1>: Getopt Function. (line 134) -* getpwent() function (C library): Passwd Functions. (line 16) -* getpwent() function (C library) <1>: Passwd Functions. (line 196) -* getpwent() user-defined function: Passwd Functions. (line 16) -* getpwent() user-defined function <1>: Passwd Functions. (line 200) -* getpwnam() function (C library): Passwd Functions. (line 175) -* getpwnam() user-defined function: Passwd Functions. (line 180) -* getpwuid() function (C library): Passwd Functions. (line 186) -* getpwuid() user-defined function: Passwd Functions. (line 190) -* gettext library: Explaining gettext. (line 6) -* gettext library, locale categories: Explaining gettext. (line 81) -* gettext() function (C library): Explaining gettext. (line 63) -* gettimeofday() extension function: Extension Sample Time. - (line 12) -* git utility: gawkextlib. (line 31) -* git utility <1>: Other Versions. (line 29) -* git utility <2>: Accessing The Source. - (line 10) -* git utility <3>: Adding Code. (line 112) -* Git, use of for gawk source code: Derived Files. (line 6) -* GNITS mailing list: Acknowledgments. (line 52) -* GNU awk, See gawk: Preface. (line 51) -* GNU Free Documentation License: GNU Free Documentation License. - (line 8) -* GNU General Public License: Glossary. (line 396) -* GNU Lesser General Public License: Glossary. (line 491) -* GNU long options: Command Line. (line 13) -* GNU long options <1>: Options. (line 6) -* GNU long options, printing list of: Options. (line 154) -* GNU Project: Manual History. (line 11) -* GNU Project <1>: Glossary. (line 405) -* GNU/Linux: Manual History. (line 28) -* GNU/Linux <1>: I18N Example. (line 57) -* GNU/Linux <2>: Glossary. (line 748) -* Gordon, Assaf: Contributors. (line 106) -* GPL (General Public License): Manual History. (line 11) -* GPL (General Public License) <1>: Glossary. (line 396) -* GPL (General Public License), printing: Options. (line 89) -* grcat program: Group Functions. (line 16) -* Grigera, Juan: Contributors. (line 58) -* group database, reading: Group Functions. (line 6) -* group file: Group Functions. (line 6) -* group ID of gawk user: Auto-set. (line 170) -* groups, information about: Group Functions. (line 6) -* gsub: Using Constant Regexps. - (line 43) -* gsub <1>: String Functions. (line 139) -* gsub() function, arguments of: String Functions. (line 463) -* gsub() function, escape processing: Gory Details. (line 6) -* h debugger command (alias for help): Miscellaneous Debugger Commands. - (line 69) -* Hankerson, Darrel: Acknowledgments. (line 60) -* Hankerson, Darrel <1>: Contributors. (line 61) -* Haque, John: Contributors. (line 109) -* Hartholz, Elaine: Acknowledgments. (line 38) -* Hartholz, Marshall: Acknowledgments. (line 38) -* Hasegawa, Isamu: Contributors. (line 95) -* help debugger command: Miscellaneous Debugger Commands. - (line 69) -* hexadecimal numbers: Nondecimal-numbers. (line 6) -* hexadecimal values, enabling interpretation of: Options. (line 209) -* history expansion, in debugger: Readline Support. (line 6) -* histsort.awk program: History Sorting. (line 25) -* Hughes, Phil: Acknowledgments. (line 43) -* HUP signal, for dynamic profiling: Profiling. (line 209) -* hyphen (-), - operator: Precedence. (line 51) -* hyphen (-), - operator <1>: Precedence. (line 57) -* hyphen (-), -- operator: Increment Ops. (line 48) -* hyphen (-), -- operator <1>: Precedence. (line 45) -* hyphen (-), -= operator: Assignment Ops. (line 129) -* hyphen (-), -= operator <1>: Precedence. (line 94) -* hyphen (-), filenames beginning with: Options. (line 60) -* hyphen (-), in bracket expressions: Bracket Expressions. (line 25) -* i debugger command (alias for info): Debugger Info. (line 13) -* id utility: Id Program. (line 6) -* id.awk program: Id Program. (line 31) -* if statement: If Statement. (line 6) -* if statement, actions, changing: Ranges. (line 25) -* if statement, use of regexps in: Regexp Usage. (line 19) -* igawk.sh program: Igawk Program. (line 124) -* ignore breakpoint: Breakpoint Control. (line 87) -* ignore debugger command: Breakpoint Control. (line 87) -* IGNORECASE variable: User-modified. (line 76) -* IGNORECASE variable, and array indices: Array Intro. (line 100) -* IGNORECASE variable, and array sorting functions: Array Sorting Functions. - (line 83) -* IGNORECASE variable, in example programs: Library Functions. - (line 53) -* IGNORECASE variable, with ~ and !~ operators: Case-sensitivity. - (line 26) -* Illumos: Other Versions. (line 109) -* Illumos, POSIX-compliant awk: Other Versions. (line 109) -* implementation issues, gawk: Notes. (line 6) -* implementation issues, gawk, debugging: Compatibility Mode. (line 6) -* implementation issues, gawk, limits: Getline Notes. (line 14) -* implementation issues, gawk, limits <1>: Redirection. (line 129) -* in operator: Comparison Operators. - (line 11) -* in operator <1>: Precedence. (line 82) -* in operator <2>: For Statement. (line 75) -* in operator, index existence in multidimensional arrays: Multidimensional. - (line 41) -* in operator, order of array access: Scanning an Array. (line 48) -* in operator, testing if array element exists: Reference to Elements. - (line 38) -* in operator, use in loops: Scanning an Array. (line 17) -* including files, @include directive: Include Files. (line 8) -* increment operators: Increment Ops. (line 6) -* index: String Functions. (line 155) -* indexing arrays: Array Intro. (line 48) -* indirect function calls: Indirect Calls. (line 6) -* indirect function calls, @-notation: Indirect Calls. (line 47) -* infinite precision: Arbitrary Precision Arithmetic. - (line 6) -* info debugger command: Debugger Info. (line 13) -* initialization, automatic: More Complex. (line 39) -* inplace extension: Extension Sample Inplace. - (line 6) -* input files: Reading Files. (line 6) -* input files, closing: Close Files And Pipes. - (line 6) -* input files, counting elements in: Wc Program. (line 6) -* input files, examples: Sample Data Files. (line 6) -* input files, reading: Reading Files. (line 6) -* input files, running awk without: Read Terminal. (line 6) -* input files, running awk without <1>: Read Terminal. (line 16) -* input files, variable assignments and: Other Arguments. (line 26) -* input pipeline: Getline/Pipe. (line 10) -* input record, length of: String Functions. (line 177) -* input redirection: Getline/File. (line 6) -* input, data, nondecimal: Nondecimal Data. (line 6) -* input, explicit: Getline. (line 6) -* input, files, See input files: Multiple Line. (line 6) -* input, multiline records: Multiple Line. (line 6) -* input, splitting into records: Records. (line 6) -* input, standard: Read Terminal. (line 6) -* input, standard <1>: Special FD. (line 6) -* input/output functions: I/O Functions. (line 6) -* input/output, binary: User-modified. (line 15) -* input/output, from BEGIN and END: I/O And BEGIN/END. (line 6) -* input/output, two-way: Two-way I/O. (line 27) -* insomnia, cure for: Alarm Program. (line 6) -* installation, VMS: VMS Installation. (line 6) -* installing gawk: Installation. (line 6) -* instruction tracing, in debugger: Debugger Info. (line 90) -* int: Numeric Functions. (line 24) -* INT signal (MS-Windows): Profiling. (line 212) -* intdiv: Numeric Functions. (line 29) -* intdiv <1>: Numeric Functions. (line 29) -* integer array indices: Numeric Array Subscripts. - (line 31) -* integers, arbitrary precision: Arbitrary Precision Integers. - (line 6) -* integers, unsigned: Computer Arithmetic. (line 41) -* interacting with other programs: I/O Functions. (line 107) -* internationalization: I18N Functions. (line 6) -* internationalization <1>: I18N and L10N. (line 6) -* internationalization, localization: User-modified. (line 152) -* internationalization, localization <1>: Internationalization. - (line 13) -* internationalization, localization, character classes: Bracket Expressions. - (line 108) -* internationalization, localization, gawk and: Internationalization. - (line 13) -* internationalization, localization, locale categories: Explaining gettext. - (line 81) -* internationalization, localization, marked strings: Programmer i18n. - (line 13) -* internationalization, localization, portability and: I18N Portability. - (line 6) -* internationalizing a program: Explaining gettext. (line 6) -* interpreted programs: Basic High Level. (line 13) -* interpreted programs <1>: Glossary. (line 445) -* interval expressions, regexp operator: Regexp Operators. (line 116) -* inventory-shipped file: Sample Data Files. (line 32) -* invoke shell command: I/O Functions. (line 107) -* isarray: Type Functions. (line 11) -* ISO: Glossary. (line 456) -* ISO 8859-1: Glossary. (line 196) -* ISO Latin-1: Glossary. (line 196) -* Jacobs, Andrew: Passwd Functions. (line 90) -* Jaegermann, Michal: Acknowledgments. (line 60) -* Jaegermann, Michal <1>: Contributors. (line 46) -* Java implementation of awk: Other Versions. (line 117) -* Java programming language: Glossary. (line 468) -* jawk: Other Versions. (line 117) -* Jedi knights: Undocumented. (line 6) -* Johansen, Chris: Signature Program. (line 25) -* join() user-defined function: Join Function. (line 18) -* Kahrs, Ju"rgen: Acknowledgments. (line 60) -* Kahrs, Ju"rgen <1>: Contributors. (line 71) -* Kasal, Stepan: Acknowledgments. (line 60) -* Kenobi, Obi-Wan: Undocumented. (line 6) -* Kernighan, Brian: History. (line 17) -* Kernighan, Brian <1>: Conventions. (line 38) -* Kernighan, Brian <2>: Acknowledgments. (line 79) -* Kernighan, Brian <3>: Getline/Pipe. (line 6) -* Kernighan, Brian <4>: Concatenation. (line 6) -* Kernighan, Brian <5>: Library Functions. (line 12) -* Kernighan, Brian <6>: BTL. (line 6) -* Kernighan, Brian <7>: Contributors. (line 12) -* Kernighan, Brian <8>: Other Versions. (line 13) -* Kernighan, Brian <9>: Basic Data Typing. (line 54) -* Kernighan, Brian <10>: Glossary. (line 206) -* kill command, dynamic profiling: Profiling. (line 186) -* Knights, jedi: Undocumented. (line 6) -* Kwok, Conrad: Contributors. (line 35) -* l debugger command (alias for list): Miscellaneous Debugger Commands. - (line 75) -* labels.awk program: Labels Program. (line 51) -* Langston, Peter: Advanced Features. (line 6) -* LANGUAGE environment variable: Explaining gettext. (line 120) -* languages, data-driven: Basic High Level. (line 74) -* LC_ALL locale category: Explaining gettext. (line 117) -* LC_COLLATE locale category: Explaining gettext. (line 94) -* LC_CTYPE locale category: Explaining gettext. (line 98) -* LC_MESSAGES locale category: Explaining gettext. (line 88) -* LC_MESSAGES locale category, bindtextdomain() function (gawk): Programmer i18n. - (line 101) -* LC_MONETARY locale category: Explaining gettext. (line 104) -* LC_NUMERIC locale category: Explaining gettext. (line 108) -* LC_TIME locale category: Explaining gettext. (line 112) -* left angle bracket (<), < operator: Comparison Operators. - (line 11) -* left angle bracket (<), < operator <1>: Precedence. (line 64) -* left angle bracket (<), < operator (I/O): Getline/File. (line 6) -* left angle bracket (<), <= operator: Comparison Operators. - (line 11) -* left angle bracket (<), <= operator <1>: Precedence. (line 64) -* left shift: Bitwise Functions. (line 47) -* left shift, bitwise: Bitwise Functions. (line 32) -* leftmost longest match: Multiple Line. (line 26) -* length: String Functions. (line 170) -* length of input record: String Functions. (line 177) -* length of string: String Functions. (line 170) -* Lesser General Public License (LGPL): Glossary. (line 491) -* LGPL (Lesser General Public License): Glossary. (line 491) -* libmawk: Other Versions. (line 125) -* libraries of awk functions: Library Functions. (line 6) -* libraries of awk functions, assertions: Assert Function. (line 6) -* libraries of awk functions, associative arrays and: Library Names. - (line 58) -* libraries of awk functions, character values as numbers: Ordinal Functions. - (line 6) -* libraries of awk functions, command-line options: Getopt Function. - (line 6) -* libraries of awk functions, example program for using: Igawk Program. - (line 6) -* libraries of awk functions, group database, reading: Group Functions. - (line 6) -* libraries of awk functions, managing, data files: Data File Management. - (line 6) -* libraries of awk functions, managing, time: Getlocaltime Function. - (line 6) -* libraries of awk functions, merging arrays into strings: Join Function. - (line 6) -* libraries of awk functions, rounding numbers: Round Function. - (line 6) -* libraries of awk functions, user database, reading: Passwd Functions. - (line 6) -* line breaks: Statements/Lines. (line 6) -* line continuations: Boolean Ops. (line 64) -* line continuations, gawk: Conditional Exp. (line 34) -* line continuations, in print statement: Print Examples. (line 75) -* line continuations, with C shell: More Complex. (line 31) -* lines, blank, printing: Print. (line 22) -* lines, counting: Wc Program. (line 6) -* lines, duplicate, removing: History Sorting. (line 6) -* lines, matching ranges of: Ranges. (line 6) -* lines, skipping between markers: Ranges. (line 43) -* lint checking: User-modified. (line 87) -* lint checking, array elements: Delete. (line 34) -* lint checking, array subscripts: Uninitialized Subscripts. - (line 43) -* lint checking, empty programs: Command Line. (line 16) -* lint checking, issuing warnings: Options. (line 184) -* lint checking, POSIXLY_CORRECT environment variable: Options. - (line 343) -* lint checking, undefined functions: Pass By Value/Reference. - (line 85) -* LINT variable: User-modified. (line 87) -* Linux: Manual History. (line 28) -* Linux <1>: I18N Example. (line 57) -* Linux <2>: Glossary. (line 748) -* list all global variables, in debugger: Debugger Info. (line 48) -* list debugger command: Miscellaneous Debugger Commands. - (line 75) -* list function definitions, in debugger: Debugger Info. (line 30) -* loading extensions, @load directive: Loading Shared Libraries. - (line 8) -* loading, extensions: Options. (line 172) -* local variables, in a function: Variable Scope. (line 6) -* locale categories: Explaining gettext. (line 81) -* locale decimal point character: Options. (line 269) -* locale, definition of: Locales. (line 6) -* localization: I18N and L10N. (line 6) -* localization, See internationalization, localization: I18N and L10N. - (line 6) -* log: Numeric Functions. (line 44) -* log files, timestamps in: Time Functions. (line 6) -* logarithm: Numeric Functions. (line 44) -* logical false/true: Truth Values. (line 6) -* logical operators, See Boolean expressions: Boolean Ops. (line 6) -* login information: Passwd Functions. (line 16) -* long options: Command Line. (line 13) -* loops: While Statement. (line 6) -* loops, break statement and: Break Statement. (line 6) -* loops, continue statements and: For Statement. (line 64) -* loops, count for header, in a profile: Profiling. (line 131) -* loops, do-while: Do Statement. (line 6) -* loops, exiting: Break Statement. (line 6) -* loops, for, array scanning: Scanning an Array. (line 6) -* loops, for, iterative: For Statement. (line 6) -* loops, See Also while statement: While Statement. (line 6) -* loops, while: While Statement. (line 6) -* ls utility: More Complex. (line 15) -* lshift: Bitwise Functions. (line 47) -* lvalues/rvalues: Assignment Ops. (line 31) -* mail-list file: Sample Data Files. (line 6) -* mailing labels, printing: Labels Program. (line 6) -* mailing list, GNITS: Acknowledgments. (line 52) -* Malmberg, John: Acknowledgments. (line 60) -* Malmberg, John <1>: Maintainers. (line 14) -* Malmberg, John E.: Contributors. (line 138) -* mark parity: Ordinal Functions. (line 45) -* marked string extraction (internationalization): String Extraction. - (line 6) -* marked strings, extracting: String Extraction. (line 6) -* Marx, Groucho: Increment Ops. (line 60) -* match: String Functions. (line 210) -* match regexp in string: String Functions. (line 210) -* match() function, RSTART/RLENGTH variables: String Functions. - (line 227) -* matching, expressions, See comparison expressions: Typing and Comparison. - (line 9) -* matching, leftmost longest: Multiple Line. (line 26) -* matching, null strings: String Functions. (line 537) -* mawk utility: Escape Sequences. (line 121) -* mawk utility <1>: Getline/Pipe. (line 62) -* mawk utility <2>: Concatenation. (line 36) -* mawk utility <3>: Nextfile Statement. (line 47) -* mawk utility <4>: Other Versions. (line 48) -* maximum precision supported by MPFR library: Auto-set. (line 235) -* McIlroy, Doug: Glossary. (line 257) -* McPhee, Patrick: Contributors. (line 101) -* message object files: Explaining gettext. (line 42) -* message object files, converting from portable object files: I18N Example. - (line 66) -* message object files, specifying directory of: Explaining gettext. - (line 54) -* message object files, specifying directory of <1>: Programmer i18n. - (line 48) -* messages from extensions: Printing Messages. (line 6) -* metacharacters in regular expressions: Regexp Operators. (line 6) -* metacharacters, escape sequences for: Escape Sequences. (line 140) -* minimum precision required by MPFR library: Auto-set. (line 238) -* mktime: Time Functions. (line 25) -* modifiers, in format specifiers: Format Modifiers. (line 6) -* monetary information, localization: Explaining gettext. (line 104) -* Moore, Duncan: Getline Notes. (line 40) -* msgfmt utility: I18N Example. (line 66) -* multiple precision: Arbitrary Precision Arithmetic. - (line 6) -* multiple-line records: Multiple Line. (line 6) -* n debugger command (alias for next): Debugger Execution Control. - (line 43) -* names, arrays/variables: Library Names. (line 6) -* names, functions: Definition Syntax. (line 24) -* names, functions <1>: Library Names. (line 6) -* namespace issues: Library Names. (line 6) -* namespace issues, functions: Definition Syntax. (line 24) -* NetBSD: Glossary. (line 748) -* networks, programming: TCP/IP Networking. (line 6) -* networks, support for: Special Network. (line 6) -* newlines: Statements/Lines. (line 6) -* newlines <1>: Options. (line 263) -* newlines <2>: Boolean Ops. (line 69) -* newlines, as record separators: awk split records. (line 12) -* newlines, in dynamic regexps: Computed Regexps. (line 60) -* newlines, in regexp constants: Computed Regexps. (line 70) -* newlines, printing: Print Examples. (line 11) -* newlines, separating statements in actions: Action Overview. - (line 19) -* newlines, separating statements in actions <1>: Statements. (line 10) -* next debugger command: Debugger Execution Control. - (line 43) -* next file statement: Feature History. (line 168) -* next statement: Boolean Ops. (line 95) -* next statement <1>: Next Statement. (line 6) -* next statement, BEGIN/END patterns and: I/O And BEGIN/END. (line 36) -* next statement, BEGINFILE/ENDFILE patterns and: BEGINFILE/ENDFILE. - (line 49) -* next statement, user-defined functions and: Next Statement. (line 44) -* nextfile statement: Nextfile Statement. (line 6) -* nextfile statement, BEGIN/END patterns and: I/O And BEGIN/END. - (line 36) -* nextfile statement, BEGINFILE/ENDFILE patterns and: BEGINFILE/ENDFILE. - (line 26) -* nextfile statement, user-defined functions and: Nextfile Statement. - (line 47) -* nexti debugger command: Debugger Execution Control. - (line 49) -* NF variable: Fields. (line 33) -* NF variable <1>: Auto-set. (line 123) -* NF variable, decrementing: Changing Fields. (line 107) -* ni debugger command (alias for nexti): Debugger Execution Control. - (line 49) -* noassign.awk program: Ignoring Assigns. (line 15) -* non-existent array elements: Reference to Elements. - (line 23) -* not Boolean-logic operator: Boolean Ops. (line 6) -* NR variable: Records. (line 6) -* NR variable <1>: Auto-set. (line 143) -* NR variable, changing: Auto-set. (line 357) -* null strings: awk split records. (line 114) -* null strings <1>: Regexp Field Splitting. - (line 43) -* null strings <2>: Truth Values. (line 6) -* null strings <3>: Basic Data Typing. (line 26) -* null strings in gawk arguments, quoting and: Quoting. (line 82) -* null strings, and deleting array elements: Delete. (line 27) -* null strings, as array subscripts: Uninitialized Subscripts. - (line 43) -* null strings, converting numbers to strings: Strings And Numbers. - (line 21) -* null strings, matching: String Functions. (line 537) -* number as string of bits: Bitwise Functions. (line 111) -* number of array elements: String Functions. (line 200) -* number sign (#), #! (executable scripts): Executable Scripts. - (line 6) -* number sign (#), commenting: Comments. (line 6) -* numbers, as array subscripts: Numeric Array Subscripts. - (line 6) -* numbers, as values of characters: Ordinal Functions. (line 6) -* numbers, Cliff random: Cliff Random Function. - (line 6) -* numbers, converting: Strings And Numbers. (line 6) -* numbers, converting <1>: Bitwise Functions. (line 111) -* numbers, converting, to strings: User-modified. (line 30) -* numbers, converting, to strings <1>: User-modified. (line 104) -* numbers, hexadecimal: Nondecimal-numbers. (line 6) -* numbers, octal: Nondecimal-numbers. (line 6) -* numbers, rounding: Round Function. (line 6) -* numeric constants: Scalar Constants. (line 6) -* numeric functions: Numeric Functions. (line 6) -* numeric, output format: OFMT. (line 6) -* numeric, strings: Variable Typing. (line 6) -* o debugger command (alias for option): Debugger Info. (line 57) -* obsolete features: Obsolete. (line 6) -* octal numbers: Nondecimal-numbers. (line 6) -* octal values, enabling interpretation of: Options. (line 209) -* OFMT variable: OFMT. (line 15) -* OFMT variable <1>: Strings And Numbers. (line 56) -* OFMT variable <2>: User-modified. (line 104) -* OFMT variable, POSIX awk and: OFMT. (line 27) -* OFS variable: Changing Fields. (line 64) -* OFS variable <1>: Output Separators. (line 6) -* OFS variable <2>: User-modified. (line 113) -* OpenBSD: Glossary. (line 748) -* OpenSolaris: Other Versions. (line 100) -* operating systems, BSD-based: Manual History. (line 28) -* operating systems, PC, gawk on: PC Using. (line 6) -* operating systems, PC, gawk on, installing: PC Installation. - (line 6) -* operating systems, porting gawk to: New Ports. (line 6) -* operating systems, See Also GNU/Linux, PC operating systems, Unix: Installation. - (line 6) -* operations, bitwise: Bitwise Functions. (line 6) -* operators, arithmetic: Arithmetic Ops. (line 6) -* operators, assignment: Assignment Ops. (line 6) -* operators, assignment <1>: Assignment Ops. (line 31) -* operators, assignment, evaluation order: Assignment Ops. (line 110) -* operators, Boolean, See Boolean expressions: Boolean Ops. (line 6) -* operators, decrement/increment: Increment Ops. (line 6) -* operators, GNU-specific: GNU Regexp Operators. - (line 6) -* operators, input/output: Getline/File. (line 6) -* operators, input/output <1>: Getline/Pipe. (line 10) -* operators, input/output <2>: Getline/Coprocess. (line 6) -* operators, input/output <3>: Redirection. (line 22) -* operators, input/output <4>: Redirection. (line 96) -* operators, input/output <5>: Precedence. (line 64) -* operators, input/output <6>: Precedence. (line 64) -* operators, input/output <7>: Precedence. (line 64) -* operators, logical, See Boolean expressions: Boolean Ops. (line 6) -* operators, precedence: Increment Ops. (line 60) -* operators, precedence <1>: Precedence. (line 6) -* operators, relational, See operators, comparison: Typing and Comparison. - (line 9) -* operators, short-circuit: Boolean Ops. (line 59) -* operators, string: Concatenation. (line 9) -* operators, string-matching: Regexp Usage. (line 19) -* operators, string-matching, for buffers: GNU Regexp Operators. - (line 51) -* operators, word-boundary (gawk): GNU Regexp Operators. - (line 66) -* option debugger command: Debugger Info. (line 57) -* options, command-line: Options. (line 6) -* options, command-line, end of: Options. (line 55) -* options, command-line, invoking awk: Command Line. (line 6) -* options, command-line, processing: Getopt Function. (line 6) -* options, deprecated: Obsolete. (line 6) -* options, long: Command Line. (line 13) -* options, long <1>: Options. (line 6) -* options, printing list of: Options. (line 154) -* or: Bitwise Functions. (line 50) -* OR bitwise operation: Bitwise Functions. (line 6) -* or Boolean-logic operator: Boolean Ops. (line 6) -* ord() extension function: Extension Sample Ord. - (line 12) -* ord() user-defined function: Ordinal Functions. (line 16) -* order of evaluation, concatenation: Concatenation. (line 41) -* ORS variable: Output Separators. (line 20) -* ORS variable <1>: User-modified. (line 119) -* output field separator, See OFS variable: Changing Fields. (line 64) -* output record separator, See ORS variable: Output Separators. - (line 20) -* output redirection: Redirection. (line 6) -* output wrapper: Output Wrappers. (line 6) -* output, buffering: I/O Functions. (line 32) -* output, buffering <1>: I/O Functions. (line 166) -* output, duplicating into files: Tee Program. (line 6) -* output, files, closing: Close Files And Pipes. - (line 6) -* output, format specifier, OFMT: OFMT. (line 15) -* output, formatted: Printf. (line 6) -* output, pipes: Redirection. (line 57) -* output, printing, See printing: Printing. (line 6) -* output, records: Output Separators. (line 20) -* output, standard: Special FD. (line 6) -* p debugger command (alias for print): Viewing And Changing Data. - (line 35) -* Papadopoulos, Panos: Contributors. (line 129) -* parent process ID of gawk process: Auto-set. (line 210) -* parentheses (), in a profile: Profiling. (line 146) -* parentheses (), regexp operator: Regexp Operators. (line 81) -* password file: Passwd Functions. (line 16) -* patsplit: String Functions. (line 296) -* patterns: Patterns and Actions. - (line 6) -* patterns, comparison expressions as: Expression Patterns. (line 14) -* patterns, counts, in a profile: Profiling. (line 118) -* patterns, default: Very Simple. (line 35) -* patterns, empty: Empty. (line 6) -* patterns, expressions as: Regexp Patterns. (line 6) -* patterns, ranges in: Ranges. (line 6) -* patterns, regexp constants as: Expression Patterns. (line 34) -* patterns, types of: Pattern Overview. (line 15) -* pawk (profiling version of Brian Kernighan's awk): Other Versions. - (line 82) -* pawk, awk-like facilities for Python: Other Versions. (line 129) -* PC operating systems, gawk on: PC Using. (line 6) -* PC operating systems, gawk on, installing: PC Installation. (line 6) -* percent sign (%), % operator: Precedence. (line 54) -* percent sign (%), %= operator: Assignment Ops. (line 129) -* percent sign (%), %= operator <1>: Precedence. (line 94) -* period (.), regexp operator: Regexp Operators. (line 44) -* Perl: Future Extensions. (line 6) -* Peters, Arno: Contributors. (line 86) -* Peterson, Hal: Contributors. (line 40) -* pipe, closing: Close Files And Pipes. - (line 6) -* pipe, input: Getline/Pipe. (line 10) -* pipe, output: Redirection. (line 57) -* Pitts, Dave: Acknowledgments. (line 60) -* Pitts, Dave <1>: Maintainers. (line 14) -* Plauger, P.J.: Library Functions. (line 12) -* plug-in: Extension Intro. (line 6) -* plus sign (+), + operator: Precedence. (line 51) -* plus sign (+), + operator <1>: Precedence. (line 57) -* plus sign (+), ++ operator: Increment Ops. (line 11) -* plus sign (+), ++ operator <1>: Increment Ops. (line 40) -* plus sign (+), ++ operator <2>: Precedence. (line 45) -* plus sign (+), += operator: Assignment Ops. (line 81) -* plus sign (+), += operator <1>: Precedence. (line 94) -* plus sign (+), regexp operator: Regexp Operators. (line 105) -* pointers to functions: Indirect Calls. (line 6) -* portability: Escape Sequences. (line 103) -* portability, #! (executable scripts): Executable Scripts. (line 33) -* portability, ** operator and: Arithmetic Ops. (line 81) -* portability, **= operator and: Assignment Ops. (line 144) -* portability, ARGV variable: Executable Scripts. (line 59) -* portability, backslash continuation and: Statements/Lines. (line 30) -* portability, backslash in escape sequences: Escape Sequences. - (line 108) -* portability, close() function and: Close Files And Pipes. - (line 81) -* portability, data files as single record: gawk split records. - (line 65) -* portability, deleting array elements: Delete. (line 56) -* portability, example programs: Library Functions. (line 42) -* portability, functions, defining: Definition Syntax. (line 114) -* portability, gawk: New Ports. (line 6) -* portability, gettext library and: Explaining gettext. (line 11) -* portability, internationalization and: I18N Portability. (line 6) -* portability, length() function: String Functions. (line 179) -* portability, new awk vs. old awk: Strings And Numbers. (line 56) -* portability, next statement in user-defined functions: Pass By Value/Reference. - (line 88) -* portability, NF variable, decrementing: Changing Fields. (line 115) -* portability, operators: Increment Ops. (line 60) -* portability, operators, not in POSIX awk: Precedence. (line 97) -* portability, POSIXLY_CORRECT environment variable: Options. (line 363) -* portability, substr() function: String Functions. (line 513) -* portable object files: Explaining gettext. (line 37) -* portable object files <1>: Translator i18n. (line 6) -* portable object files, converting to message object files: I18N Example. - (line 66) -* portable object files, generating: Options. (line 147) -* portable object template files: Explaining gettext. (line 31) -* porting gawk: New Ports. (line 6) -* positional specifiers, printf statement: Format Modifiers. (line 13) -* positional specifiers, printf statement <1>: Printf Ordering. - (line 6) -* positional specifiers, printf statement, mixing with regular formats: Printf Ordering. - (line 57) -* POSIX awk: This Manual. (line 14) -* POSIX awk <1>: Assignment Ops. (line 138) -* POSIX awk, ** operator and: Precedence. (line 97) -* POSIX awk, **= operator and: Assignment Ops. (line 144) -* POSIX awk, < operator and: Getline/File. (line 26) -* POSIX awk, arithmetic operators and: Arithmetic Ops. (line 30) -* POSIX awk, backslashes in string constants: Escape Sequences. - (line 108) -* POSIX awk, BEGIN/END patterns: I/O And BEGIN/END. (line 15) -* POSIX awk, bracket expressions and: Bracket Expressions. (line 34) -* POSIX awk, bracket expressions and, character classes: Bracket Expressions. - (line 40) -* POSIX awk, bracket expressions and, character classes <1>: Bracket Expressions. - (line 108) -* POSIX awk, break statement and: Break Statement. (line 51) -* POSIX awk, changes in awk versions: POSIX. (line 6) -* POSIX awk, continue statement and: Continue Statement. (line 44) -* POSIX awk, CONVFMT variable and: User-modified. (line 30) -* POSIX awk, date utility and: Time Functions. (line 253) -* POSIX awk, field separators and: Full Line Fields. (line 16) -* POSIX awk, function keyword in: Definition Syntax. (line 99) -* POSIX awk, functions and, gsub()/sub(): Gory Details. (line 90) -* POSIX awk, functions and, length(): String Functions. (line 179) -* POSIX awk, GNU long options and: Options. (line 15) -* POSIX awk, interval expressions in: Regexp Operators. (line 135) -* POSIX awk, next/nextfile statements and: Next Statement. (line 44) -* POSIX awk, numeric strings and: Variable Typing. (line 6) -* POSIX awk, OFMT variable and: OFMT. (line 27) -* POSIX awk, OFMT variable and <1>: Strings And Numbers. (line 56) -* POSIX awk, period (.), using: Regexp Operators. (line 51) -* POSIX awk, printf format strings and: Format Modifiers. (line 157) -* POSIX awk, regular expressions and: Regexp Operators. (line 161) -* POSIX awk, timestamps and: Time Functions. (line 6) -* POSIX awk, | I/O operator and: Getline/Pipe. (line 56) -* POSIX mode: Options. (line 257) -* POSIX mode <1>: Options. (line 343) -* POSIX, awk and: Preface. (line 21) -* POSIX, gawk extensions not included in: POSIX/GNU. (line 6) -* POSIX, programs, implementing in awk: Clones. (line 6) -* POSIXLY_CORRECT environment variable: Options. (line 343) -* PREC variable: User-modified. (line 124) -* precedence: Increment Ops. (line 60) -* precedence <1>: Precedence. (line 6) -* precedence, regexp operators: Regexp Operators. (line 156) -* predefined variables: Built-in Variables. (line 6) -* predefined variables, -v option, setting with: Options. (line 41) -* predefined variables, conveying information: Auto-set. (line 6) -* predefined variables, user-modifiable: User-modified. (line 6) -* print debugger command: Viewing And Changing Data. - (line 35) -* print statement: Printing. (line 16) -* print statement, BEGIN/END patterns and: I/O And BEGIN/END. (line 15) -* print statement, commas, omitting: Print Examples. (line 30) -* print statement, I/O operators in: Precedence. (line 70) -* print statement, line continuations and: Print Examples. (line 75) -* print statement, OFMT variable and: User-modified. (line 113) -* print statement, See Also redirection, of output: Redirection. - (line 17) -* print statement, sprintf() function and: Round Function. (line 6) -* print variables, in debugger: Viewing And Changing Data. - (line 35) -* printf debugger command: Viewing And Changing Data. - (line 53) -* printf statement: Printing. (line 16) -* printf statement <1>: Printf. (line 6) -* printf statement, columns, aligning: Print Examples. (line 69) -* printf statement, format-control characters: Control Letters. - (line 6) -* printf statement, I/O operators in: Precedence. (line 70) -* printf statement, modifiers: Format Modifiers. (line 6) -* printf statement, positional specifiers: Format Modifiers. (line 13) -* printf statement, positional specifiers <1>: Printf Ordering. - (line 6) -* printf statement, positional specifiers, mixing with regular formats: Printf Ordering. - (line 57) -* printf statement, See Also redirection, of output: Redirection. - (line 17) -* printf statement, sprintf() function and: Round Function. (line 6) -* printf statement, syntax of: Basic Printf. (line 6) -* printing: Printing. (line 6) -* printing messages from extensions: Printing Messages. (line 6) -* printing, list of options: Options. (line 154) -* printing, mailing labels: Labels Program. (line 6) -* printing, unduplicated lines of text: Uniq Program. (line 6) -* printing, user information: Id Program. (line 6) -* private variables: Library Names. (line 11) -* process group ID of gawk process: Auto-set. (line 204) -* process ID of gawk process: Auto-set. (line 207) -* processes, two-way communications with: Two-way I/O. (line 6) -* processing data: Basic High Level. (line 6) -* PROCINFO array: Auto-set. (line 148) -* PROCINFO array <1>: Time Functions. (line 47) -* PROCINFO array <2>: Passwd Functions. (line 6) -* PROCINFO array, and communications via ptys: Two-way I/O. (line 114) -* PROCINFO array, and group membership: Group Functions. (line 6) -* PROCINFO array, and user and group ID numbers: Id Program. (line 15) -* PROCINFO array, testing the field splitting: Passwd Functions. - (line 154) -* PROCINFO, values of sorted_in: Controlling Scanning. - (line 26) -* profiling awk programs: Profiling. (line 6) -* profiling awk programs, dynamically: Profiling. (line 177) -* program identifiers: Auto-set. (line 173) -* program, definition of: Getting Started. (line 21) -* programming conventions, --non-decimal-data option: Nondecimal Data. - (line 35) -* programming conventions, ARGC/ARGV variables: Auto-set. (line 35) -* programming conventions, exit statement: Exit Statement. (line 38) -* programming conventions, function parameters: Return Statement. - (line 44) -* programming conventions, functions, calling: Calling Built-in. - (line 10) -* programming conventions, functions, writing: Definition Syntax. - (line 71) -* programming conventions, gawk extensions: Internal File Ops. - (line 45) -* programming conventions, private variable names: Library Names. - (line 23) -* programming language, recipe for: History. (line 6) -* programming languages, Ada: Glossary. (line 11) -* programming languages, data-driven vs. procedural: Getting Started. - (line 12) -* programming languages, Java: Glossary. (line 468) -* programming, basic steps: Basic High Level. (line 18) -* programming, concepts: Basic Concepts. (line 6) -* programming, concepts <1>: Basic Concepts. (line 6) -* pwcat program: Passwd Functions. (line 23) -* q debugger command (alias for quit): Miscellaneous Debugger Commands. - (line 102) -* QSE awk: Other Versions. (line 135) -* Quanstrom, Erik: Alarm Program. (line 8) -* question mark (?), ?: operator: Precedence. (line 91) -* question mark (?), regexp operator: Regexp Operators. (line 111) -* question mark (?), regexp operator <1>: GNU Regexp Operators. - (line 62) -* QuikTrim Awk: Other Versions. (line 139) -* quit debugger command: Miscellaneous Debugger Commands. - (line 102) -* QUIT signal (MS-Windows): Profiling. (line 212) -* quoting in gawk command lines: Long. (line 26) -* quoting in gawk command lines, tricks for: Quoting. (line 91) -* quoting, for small awk programs: Comments. (line 27) -* r debugger command (alias for run): Debugger Execution Control. - (line 62) -* Rakitzis, Byron: History Sorting. (line 25) -* Ramey, Chet: Acknowledgments. (line 60) -* Ramey, Chet <1>: General Data Types. (line 6) -* rand: Numeric Functions. (line 49) -* random numbers, Cliff: Cliff Random Function. - (line 6) -* random numbers, rand()/srand() functions: Numeric Functions. - (line 49) -* random numbers, seed of: Numeric Functions. (line 79) -* range expressions (regexps): Bracket Expressions. (line 6) -* range patterns: Ranges. (line 6) -* range patterns, line continuation and: Ranges. (line 64) -* Rankin, Pat: Acknowledgments. (line 60) -* Rankin, Pat <1>: Assignment Ops. (line 99) -* Rankin, Pat <2>: Contributors. (line 38) -* reada() extension function: Extension Sample Read write array. - (line 18) -* readable data files, checking: File Checking. (line 6) -* readable.awk program: File Checking. (line 11) -* readdir extension: Extension Sample Readdir. - (line 9) -* readfile() extension function: Extension Sample Readfile. - (line 12) -* readfile() user-defined function: Readfile Function. (line 30) -* reading input files: Reading Files. (line 6) -* recipe for a programming language: History. (line 6) -* record separators: awk split records. (line 6) -* record separators <1>: User-modified. (line 133) -* record separators, changing: awk split records. (line 85) -* record separators, regular expressions as: awk split records. - (line 124) -* record separators, with multiline records: Multiple Line. (line 10) -* records: Reading Files. (line 14) -* records <1>: Basic High Level. (line 62) -* records, multiline: Multiple Line. (line 6) -* records, printing: Print. (line 22) -* records, splitting input into: Records. (line 6) -* records, terminating: awk split records. (line 124) -* records, treating files as: gawk split records. (line 92) -* recursive functions: Definition Syntax. (line 89) -* redirect gawk output, in debugger: Debugger Info. (line 73) -* redirection of input: Getline/File. (line 6) -* redirection of output: Redirection. (line 6) -* redirection on VMS: VMS Running. (line 64) -* reference counting, sorting arrays: Array Sorting Functions. - (line 77) -* regexp: Regexp. (line 6) -* regexp constants: Regexp Usage. (line 57) -* regexp constants <1>: Regexp Constants. (line 6) -* regexp constants <2>: Comparison Operators. - (line 103) -* regexp constants, /=.../, /= operator and: Assignment Ops. (line 149) -* regexp constants, as patterns: Expression Patterns. (line 34) -* regexp constants, in gawk: Using Constant Regexps. - (line 28) -* regexp constants, slashes vs. quotes: Computed Regexps. (line 30) -* regexp constants, vs. string constants: Computed Regexps. (line 40) -* register extension: Registration Functions. - (line 6) -* regular expressions: Regexp. (line 6) -* regular expressions as field separators: Field Separators. (line 50) -* regular expressions, anchors in: Regexp Operators. (line 22) -* regular expressions, as field separators: Regexp Field Splitting. - (line 6) -* regular expressions, as patterns: Regexp Usage. (line 6) -* regular expressions, as patterns <1>: Regexp Patterns. (line 6) -* regular expressions, as record separators: awk split records. - (line 124) -* regular expressions, case sensitivity: Case-sensitivity. (line 6) -* regular expressions, case sensitivity <1>: User-modified. (line 76) -* regular expressions, computed: Computed Regexps. (line 6) -* regular expressions, constants, See regexp constants: Regexp Usage. - (line 57) -* regular expressions, dynamic: Computed Regexps. (line 6) -* regular expressions, dynamic, with embedded newlines: Computed Regexps. - (line 60) -* regular expressions, gawk, command-line options: GNU Regexp Operators. - (line 73) -* regular expressions, interval expressions and: Options. (line 278) -* regular expressions, leftmost longest match: Leftmost Longest. - (line 6) -* regular expressions, operators: Regexp Usage. (line 19) -* regular expressions, operators <1>: Regexp Operators. (line 6) -* regular expressions, operators, for buffers: GNU Regexp Operators. - (line 51) -* regular expressions, operators, for words: GNU Regexp Operators. - (line 6) -* regular expressions, operators, gawk: GNU Regexp Operators. - (line 6) -* regular expressions, operators, precedence of: Regexp Operators. - (line 156) -* regular expressions, searching for: Egrep Program. (line 6) -* relational operators, See comparison operators: Typing and Comparison. - (line 9) -* replace in string: String Functions. (line 409) -* retrying input: Retrying Input. (line 6) -* return debugger command: Debugger Execution Control. - (line 54) -* return statement, user-defined functions: Return Statement. (line 6) -* return value, close() function: Close Files And Pipes. - (line 132) -* rev() user-defined function: Function Example. (line 54) -* revoutput extension: Extension Sample Revout. - (line 11) -* revtwoway extension: Extension Sample Rev2way. - (line 12) -* rewind() user-defined function: Rewind Function. (line 15) -* right angle bracket (>), > operator: Comparison Operators. - (line 11) -* right angle bracket (>), > operator <1>: Precedence. (line 64) -* right angle bracket (>), > operator (I/O): Redirection. (line 22) -* right angle bracket (>), >= operator: Comparison Operators. - (line 11) -* right angle bracket (>), >= operator <1>: Precedence. (line 64) -* right angle bracket (>), >> operator (I/O): Redirection. (line 50) -* right angle bracket (>), >> operator (I/O) <1>: Precedence. (line 64) -* right shift: Bitwise Functions. (line 54) -* right shift, bitwise: Bitwise Functions. (line 32) -* Ritchie, Dennis: Basic Data Typing. (line 54) -* RLENGTH variable: Auto-set. (line 282) -* RLENGTH variable, match() function and: String Functions. (line 227) -* Robbins, Arnold: Command Line Field Separator. - (line 71) -* Robbins, Arnold <1>: Getline/Pipe. (line 40) -* Robbins, Arnold <2>: Passwd Functions. (line 90) -* Robbins, Arnold <3>: Alarm Program. (line 6) -* Robbins, Arnold <4>: General Data Types. (line 6) -* Robbins, Arnold <5>: Contributors. (line 145) -* Robbins, Arnold <6>: Maintainers. (line 14) -* Robbins, Arnold <7>: Future Extensions. (line 6) -* Robbins, Bill: Getline/Pipe. (line 40) -* Robbins, Harry: Acknowledgments. (line 94) -* Robbins, Jean: Acknowledgments. (line 94) -* Robbins, Miriam: Acknowledgments. (line 94) -* Robbins, Miriam <1>: Getline/Pipe. (line 40) -* Robbins, Miriam <2>: Passwd Functions. (line 90) -* Rommel, Kai Uwe: Contributors. (line 43) -* round to nearest integer: Numeric Functions. (line 24) -* round() user-defined function: Round Function. (line 16) -* rounding numbers: Round Function. (line 6) -* ROUNDMODE variable: User-modified. (line 128) -* RS variable: awk split records. (line 12) -* RS variable <1>: User-modified. (line 133) -* RS variable, multiline records and: Multiple Line. (line 17) -* rshift: Bitwise Functions. (line 54) -* RSTART variable: Auto-set. (line 288) -* RSTART variable, match() function and: String Functions. (line 227) -* RT variable: awk split records. (line 124) -* RT variable <1>: Multiple Line. (line 130) -* RT variable <2>: Auto-set. (line 295) -* Rubin, Paul: History. (line 30) -* Rubin, Paul <1>: Contributors. (line 16) -* rule, definition of: Getting Started. (line 21) -* run debugger command: Debugger Execution Control. - (line 62) -* rvalues/lvalues: Assignment Ops. (line 31) -* s debugger command (alias for step): Debugger Execution Control. - (line 68) -* sample debugging session: Sample Debugging Session. - (line 6) -* sandbox mode: Options. (line 290) -* save debugger options: Debugger Info. (line 85) -* scalar or array: Type Functions. (line 11) -* scalar values: Basic Data Typing. (line 13) -* scanning arrays: Scanning an Array. (line 6) -* scanning multidimensional arrays: Multiscanning. (line 11) -* Schorr, Andrew: Acknowledgments. (line 60) -* Schorr, Andrew <1>: Auto-set. (line 327) -* Schorr, Andrew <2>: Contributors. (line 134) -* Schreiber, Bert: Acknowledgments. (line 38) -* Schreiber, Rita: Acknowledgments. (line 38) -* search and replace in strings: String Functions. (line 89) -* search in string: String Functions. (line 155) -* search paths: Programs Exercises. (line 70) -* search paths <1>: PC Using. (line 9) -* search paths <2>: VMS Running. (line 57) -* search paths, for loadable extensions: AWKLIBPATH Variable. (line 6) -* search paths, for source files: AWKPATH Variable. (line 6) -* search paths, for source files <1>: Programs Exercises. (line 70) -* search paths, for source files <2>: PC Using. (line 9) -* search paths, for source files <3>: VMS Running. (line 57) -* searching, files for regular expressions: Egrep Program. (line 6) -* searching, for words: Dupword Program. (line 6) -* sed utility: Full Line Fields. (line 22) -* sed utility <1>: Simple Sed. (line 6) -* sed utility <2>: Glossary. (line 16) -* seeding random number generator: Numeric Functions. (line 79) -* semicolon (;), AWKPATH variable and: PC Using. (line 9) -* semicolon (;), separating statements in actions: Statements/Lines. - (line 90) -* semicolon (;), separating statements in actions <1>: Action Overview. - (line 19) -* semicolon (;), separating statements in actions <2>: Statements. - (line 10) -* separators, field: User-modified. (line 50) -* separators, field <1>: User-modified. (line 113) -* separators, field, FIELDWIDTHS variable and: User-modified. (line 37) -* separators, field, FPAT variable and: User-modified. (line 43) -* separators, for records: awk split records. (line 6) -* separators, for records <1>: awk split records. (line 85) -* separators, for records <2>: User-modified. (line 133) -* separators, for records, regular expressions as: awk split records. - (line 124) -* separators, for statements in actions: Action Overview. (line 19) -* separators, subscript: User-modified. (line 146) -* set breakpoint: Breakpoint Control. (line 11) -* set debugger command: Viewing And Changing Data. - (line 58) -* set directory of message catalogs: I18N Functions. (line 11) -* set watchpoint: Viewing And Changing Data. - (line 66) -* shadowing of variable values: Definition Syntax. (line 77) -* shell quoting, rules for: Quoting. (line 6) -* shells, piping commands into: Redirection. (line 136) -* shells, quoting: Using Shell Variables. - (line 12) -* shells, quoting, rules for: Quoting. (line 18) -* shells, scripts: One-shot. (line 22) -* shells, sea: Undocumented. (line 9) -* shells, variables: Using Shell Variables. - (line 6) -* shift, bitwise: Bitwise Functions. (line 32) -* short-circuit operators: Boolean Ops. (line 59) -* show all source files, in debugger: Debugger Info. (line 45) -* show breakpoints: Debugger Info. (line 21) -* show function arguments, in debugger: Debugger Info. (line 18) -* show local variables, in debugger: Debugger Info. (line 34) -* show name of current source file, in debugger: Debugger Info. - (line 37) -* show watchpoints: Debugger Info. (line 51) -* si debugger command (alias for stepi): Debugger Execution Control. - (line 75) -* side effects: Concatenation. (line 41) -* side effects <1>: Increment Ops. (line 11) -* side effects <2>: Increment Ops. (line 75) -* side effects, array indexing: Reference to Elements. - (line 43) -* side effects, asort() function: Array Sorting Functions. - (line 24) -* side effects, assignment expressions: Assignment Ops. (line 22) -* side effects, Boolean operators: Boolean Ops. (line 30) -* side effects, conditional expressions: Conditional Exp. (line 22) -* side effects, decrement/increment operators: Increment Ops. (line 11) -* side effects, FILENAME variable: Getline Notes. (line 19) -* side effects, function calls: Function Calls. (line 57) -* side effects, statements: Action Overview. (line 32) -* sidebar, A Constant's Base Does Not Affect Its Value: Nondecimal-numbers. - (line 63) -* sidebar, Backslash Before Regular Characters: Escape Sequences. - (line 106) -* sidebar, Changing FS Does Not Affect the Fields: Full Line Fields. - (line 14) -* sidebar, Changing NR and FNR: Auto-set. (line 355) -* sidebar, Controlling Output Buffering with system(): I/O Functions. - (line 164) -* sidebar, Escape Sequences for Metacharacters: Escape Sequences. - (line 138) -* sidebar, FS and IGNORECASE: Field Splitting Summary. - (line 37) -* sidebar, Interactive Versus Noninteractive Buffering: I/O Functions. - (line 74) -* sidebar, Matching the Null String: String Functions. (line 535) -* sidebar, Operator Evaluation Order: Increment Ops. (line 58) -* sidebar, Piping into sh: Redirection. (line 134) -* sidebar, Pre-POSIX awk Used OFMT for String Conversion: Strings And Numbers. - (line 54) -* sidebar, Recipe for a Programming Language: History. (line 6) -* sidebar, RS = "\0" Is Not Portable: gawk split records. (line 63) -* sidebar, So Why Does gawk Have BEGINFILE and ENDFILE?: Filetrans Function. - (line 83) -* sidebar, Syntactic Ambiguities Between /= and Regular Expressions: Assignment Ops. - (line 147) -* sidebar, Understanding #!: Executable Scripts. (line 31) -* sidebar, Understanding $0: Changing Fields. (line 134) -* sidebar, Using close()'s Return Value: Close Files And Pipes. - (line 130) -* sidebar, Using \n in Bracket Expressions of Dynamic Regexps: Computed Regexps. - (line 58) -* SIGHUP signal, for dynamic profiling: Profiling. (line 209) -* SIGINT signal (MS-Windows): Profiling. (line 212) -* signals, HUP/SIGHUP, for profiling: Profiling. (line 209) -* signals, INT/SIGINT (MS-Windows): Profiling. (line 212) -* signals, QUIT/SIGQUIT (MS-Windows): Profiling. (line 212) -* signals, USR1/SIGUSR1, for profiling: Profiling. (line 186) -* signature program: Signature Program. (line 6) -* SIGQUIT signal (MS-Windows): Profiling. (line 212) -* SIGUSR1 signal, for dynamic profiling: Profiling. (line 186) -* silent debugger command: Debugger Execution Control. - (line 10) -* sin: Numeric Functions. (line 90) -* sine: Numeric Functions. (line 90) -* single quote ('): One-shot. (line 15) -* single quote (') in gawk command lines: Long. (line 35) -* single quote ('), in shell commands: Quoting. (line 48) -* single quote ('), vs. apostrophe: Comments. (line 27) -* single quote ('), with double quotes: Quoting. (line 73) -* single-character fields: Single Character Fields. - (line 6) -* single-step execution, in the debugger: Debugger Execution Control. - (line 43) -* Skywalker, Luke: Undocumented. (line 6) -* sleep utility: Alarm Program. (line 109) -* sleep() extension function: Extension Sample Time. - (line 22) -* Solaris, POSIX-compliant awk: Other Versions. (line 100) -* sort array: String Functions. (line 42) -* sort array indices: String Functions. (line 42) -* sort function, arrays, sorting: Array Sorting Functions. - (line 6) -* sort utility: Word Sorting. (line 50) -* sort utility, coprocesses and: Two-way I/O. (line 66) -* sorting characters in different languages: Explaining gettext. - (line 94) -* source code, awka: Other Versions. (line 68) -* source code, Brian Kernighan's awk: Other Versions. (line 13) -* source code, BusyBox Awk: Other Versions. (line 92) -* source code, gawk: Gawk Distribution. (line 6) -* source code, Illumos awk: Other Versions. (line 109) -* source code, jawk: Other Versions. (line 117) -* source code, libmawk: Other Versions. (line 125) -* source code, mawk: Other Versions. (line 48) -* source code, mixing: Options. (line 117) -* source code, pawk: Other Versions. (line 82) -* source code, pawk (Python version): Other Versions. (line 129) -* source code, QSE awk: Other Versions. (line 135) -* source code, QuikTrim Awk: Other Versions. (line 139) -* source code, Solaris awk: Other Versions. (line 100) -* source files, search path for: Programs Exercises. (line 70) -* sparse arrays: Array Intro. (line 76) -* Spencer, Henry: Glossary. (line 16) -* split: String Functions. (line 315) -* split string into array: String Functions. (line 296) -* split utility: Split Program. (line 6) -* split() function, array elements, deleting: Delete. (line 61) -* split.awk program: Split Program. (line 30) -* sprintf: OFMT. (line 15) -* sprintf <1>: String Functions. (line 384) -* sprintf() function, OFMT variable and: User-modified. (line 113) -* sprintf() function, print/printf statements and: Round Function. - (line 6) -* sqrt: Numeric Functions. (line 93) -* square brackets ([]), regexp operator: Regexp Operators. (line 56) -* square root: Numeric Functions. (line 93) -* srand: Numeric Functions. (line 97) -* stack frame: Debugging Terms. (line 10) -* Stallman, Richard: Manual History. (line 6) -* Stallman, Richard <1>: Acknowledgments. (line 18) -* Stallman, Richard <2>: Contributors. (line 24) -* Stallman, Richard <3>: Glossary. (line 372) -* standard error: Special FD. (line 6) -* standard input: Read Terminal. (line 6) -* standard input <1>: Special FD. (line 6) -* standard output: Special FD. (line 6) -* starting the debugger: Debugger Invocation. (line 6) -* stat() extension function: Extension Sample File Functions. - (line 18) -* statements, compound, control statements and: Statements. (line 10) -* statements, control, in actions: Statements. (line 6) -* statements, multiple: Statements/Lines. (line 90) -* step debugger command: Debugger Execution Control. - (line 68) -* stepi debugger command: Debugger Execution Control. - (line 75) -* stop automatic display, in debugger: Viewing And Changing Data. - (line 79) -* stream editors: Full Line Fields. (line 22) -* stream editors <1>: Simple Sed. (line 6) -* strftime: Time Functions. (line 48) -* string constants: Scalar Constants. (line 15) -* string constants, vs. regexp constants: Computed Regexps. (line 40) -* string extraction (internationalization): String Extraction. - (line 6) -* string length: String Functions. (line 170) -* string operators: Concatenation. (line 9) -* string, regular expression match: String Functions. (line 210) -* string-manipulation functions: String Functions. (line 6) -* string-matching operators: Regexp Usage. (line 19) -* string-translation functions: I18N Functions. (line 6) -* strings splitting, example: String Functions. (line 334) -* strings, converting: Strings And Numbers. (line 6) -* strings, converting <1>: Bitwise Functions. (line 111) -* strings, converting letter case: String Functions. (line 523) -* strings, converting, numbers to: User-modified. (line 30) -* strings, converting, numbers to <1>: User-modified. (line 104) -* strings, empty, See null strings: awk split records. (line 114) -* strings, extracting: String Extraction. (line 6) -* strings, for localization: Programmer i18n. (line 13) -* strings, length limitations: Scalar Constants. (line 20) -* strings, merging arrays into: Join Function. (line 6) -* strings, null: Regexp Field Splitting. - (line 43) -* strings, numeric: Variable Typing. (line 6) -* strtonum: String Functions. (line 391) -* strtonum() function (gawk), --non-decimal-data option and: Nondecimal Data. - (line 35) -* sub: Using Constant Regexps. - (line 43) -* sub <1>: String Functions. (line 409) -* sub() function, arguments of: String Functions. (line 463) -* sub() function, escape processing: Gory Details. (line 6) -* subscript separators: User-modified. (line 146) -* subscripts in arrays, multidimensional: Multidimensional. (line 10) -* subscripts in arrays, multidimensional, scanning: Multiscanning. - (line 11) -* subscripts in arrays, numbers as: Numeric Array Subscripts. - (line 6) -* subscripts in arrays, uninitialized variables as: Uninitialized Subscripts. - (line 6) -* SUBSEP variable: User-modified. (line 146) -* SUBSEP variable, and multidimensional arrays: Multidimensional. - (line 16) -* substitute in string: String Functions. (line 89) -* substr: String Functions. (line 482) -* substring: String Functions. (line 482) -* Sumner, Andrew: Other Versions. (line 68) -* supplementary groups of gawk process: Auto-set. (line 251) -* switch statement: Switch Statement. (line 6) -* SYMTAB array: Auto-set. (line 299) -* syntactic ambiguity: /= operator vs. /=.../ regexp constant: Assignment Ops. - (line 149) -* system: I/O Functions. (line 107) -* systime: Time Functions. (line 66) -* t debugger command (alias for tbreak): Breakpoint Control. (line 90) -* tbreak debugger command: Breakpoint Control. (line 90) -* Tcl: Library Names. (line 58) -* TCP/IP: TCP/IP Networking. (line 6) -* TCP/IP, support for: Special Network. (line 6) -* tee utility: Tee Program. (line 6) -* tee.awk program: Tee Program. (line 26) -* temporary breakpoint: Breakpoint Control. (line 90) -* terminating records: awk split records. (line 124) -* testbits.awk program: Bitwise Functions. (line 72) -* testext extension: Extension Sample API Tests. - (line 6) -* Texinfo: Conventions. (line 6) -* Texinfo <1>: Library Functions. (line 33) -* Texinfo <2>: Dupword Program. (line 17) -* Texinfo <3>: Extract Program. (line 12) -* Texinfo <4>: Distribution contents. - (line 77) -* Texinfo <5>: Adding Code. (line 100) -* Texinfo, chapter beginnings in files: Regexp Operators. (line 22) -* Texinfo, extracting programs from source files: Extract Program. - (line 6) -* text, printing: Print. (line 22) -* text, printing, unduplicated lines of: Uniq Program. (line 6) -* TEXTDOMAIN variable: User-modified. (line 152) -* TEXTDOMAIN variable <1>: Programmer i18n. (line 8) -* TEXTDOMAIN variable, BEGIN pattern and: Programmer i18n. (line 60) -* TEXTDOMAIN variable, portability and: I18N Portability. (line 20) -* textdomain() function (C library): Explaining gettext. (line 28) -* tilde (~), ~ operator: Regexp Usage. (line 19) -* tilde (~), ~ operator <1>: Computed Regexps. (line 6) -* tilde (~), ~ operator <2>: Case-sensitivity. (line 26) -* tilde (~), ~ operator <3>: Regexp Constants. (line 6) -* tilde (~), ~ operator <4>: Comparison Operators. - (line 11) -* tilde (~), ~ operator <5>: Comparison Operators. - (line 98) -* tilde (~), ~ operator <6>: Precedence. (line 79) -* tilde (~), ~ operator <7>: Expression Patterns. (line 24) -* time functions: Time Functions. (line 6) -* time, alarm clock example program: Alarm Program. (line 11) -* time, localization and: Explaining gettext. (line 112) -* time, managing: Getlocaltime Function. - (line 6) -* time, retrieving: Time Functions. (line 17) -* timeout, reading input: Read Timeout. (line 6) -* timestamps: Time Functions. (line 6) -* timestamps <1>: Time Functions. (line 66) -* timestamps, converting dates to: Time Functions. (line 76) -* timestamps, formatted: Getlocaltime Function. - (line 6) -* tolower: String Functions. (line 524) -* toupper: String Functions. (line 530) -* tr utility: Translate Program. (line 6) -* trace debugger command: Miscellaneous Debugger Commands. - (line 110) -* traceback, display in debugger: Execution Stack. (line 13) -* translate string: I18N Functions. (line 21) -* translate.awk program: Translate Program. (line 55) -* treating files, as single records: gawk split records. (line 92) -* troubleshooting, --non-decimal-data option: Options. (line 209) -* troubleshooting, == operator: Comparison Operators. - (line 37) -* troubleshooting, awk uses FS not IFS: Field Separators. (line 29) -* troubleshooting, backslash before nonspecial character: Escape Sequences. - (line 108) -* troubleshooting, division: Arithmetic Ops. (line 44) -* troubleshooting, fatal errors, field widths, specifying: Constant Size. - (line 22) -* troubleshooting, fatal errors, printf format strings: Format Modifiers. - (line 157) -* troubleshooting, fflush() function: I/O Functions. (line 63) -* troubleshooting, function call syntax: Function Calls. (line 30) -* troubleshooting, gawk: Compatibility Mode. (line 6) -* troubleshooting, gawk, bug reports: Bugs. (line 9) -* troubleshooting, gawk, fatal errors, function arguments: Calling Built-in. - (line 16) -* troubleshooting, getline function: File Checking. (line 25) -* troubleshooting, gsub()/sub() functions: String Functions. (line 473) -* troubleshooting, match() function: String Functions. (line 291) -* troubleshooting, print statement, omitting commas: Print Examples. - (line 30) -* troubleshooting, printing: Redirection. (line 112) -* troubleshooting, quotes with file names: Special FD. (line 62) -* troubleshooting, readable data files: File Checking. (line 6) -* troubleshooting, regexp constants vs. string constants: Computed Regexps. - (line 40) -* troubleshooting, string concatenation: Concatenation. (line 27) -* troubleshooting, substr() function: String Functions. (line 500) -* troubleshooting, system() function: I/O Functions. (line 129) -* troubleshooting, typographical errors, global variables: Options. - (line 99) -* true, logical: Truth Values. (line 6) -* Trueman, David: History. (line 30) -* Trueman, David <1>: Acknowledgments. (line 47) -* Trueman, David <2>: Contributors. (line 31) -* trunc-mod operation: Arithmetic Ops. (line 66) -* truth values: Truth Values. (line 6) -* type conversion: Strings And Numbers. (line 21) -* type, of variable: Type Functions. (line 14) -* typeof: Type Functions. (line 14) -* u debugger command (alias for until): Debugger Execution Control. - (line 82) -* unassigned array elements: Reference to Elements. - (line 18) -* undefined functions: Pass By Value/Reference. - (line 68) -* underscore (_), C macro: Explaining gettext. (line 71) -* underscore (_), in names of private variables: Library Names. - (line 29) -* underscore (_), translatable string: Programmer i18n. (line 69) -* undisplay debugger command: Viewing And Changing Data. - (line 79) -* undocumented features: Undocumented. (line 6) -* Unicode: Ordinal Functions. (line 45) -* Unicode <1>: Ranges and Locales. (line 61) -* Unicode <2>: Glossary. (line 196) -* uninitialized variables, as array subscripts: Uninitialized Subscripts. - (line 6) -* uniq utility: Uniq Program. (line 6) -* uniq.awk program: Uniq Program. (line 65) -* Unix: Glossary. (line 748) -* Unix awk, backslashes in escape sequences: Escape Sequences. - (line 121) -* Unix awk, close() function and: Close Files And Pipes. - (line 132) -* Unix awk, password files, field separators and: Command Line Field Separator. - (line 62) -* Unix, awk scripts and: Executable Scripts. (line 6) -* unsigned integers: Computer Arithmetic. (line 41) -* until debugger command: Debugger Execution Control. - (line 82) -* unwatch debugger command: Viewing And Changing Data. - (line 83) -* up debugger command: Execution Stack. (line 36) -* user database, reading: Passwd Functions. (line 6) -* user-defined functions: User-defined. (line 6) -* user-defined, functions, counts, in a profile: Profiling. (line 137) -* user-defined, variables: Variables. (line 6) -* user-modifiable variables: User-modified. (line 6) -* users, information about, printing: Id Program. (line 6) -* users, information about, retrieving: Passwd Functions. (line 16) -* USR1 signal, for dynamic profiling: Profiling. (line 186) -* values, numeric: Basic Data Typing. (line 13) -* values, string: Basic Data Typing. (line 13) -* variable assignments and input files: Other Arguments. (line 26) -* variable type: Type Functions. (line 14) -* variable typing: Typing and Comparison. - (line 9) -* variables: Other Features. (line 6) -* variables <1>: Basic Data Typing. (line 6) -* variables, assigning on command line: Assignment Options. (line 6) -* variables, built-in: Using Variables. (line 23) -* variables, flag: Boolean Ops. (line 69) -* variables, getline command into, using: Getline/Variable. (line 6) -* variables, getline command into, using <1>: Getline/Variable/File. - (line 6) -* variables, getline command into, using <2>: Getline/Variable/Pipe. - (line 6) -* variables, getline command into, using <3>: Getline/Variable/Coprocess. - (line 6) -* variables, global, for library functions: Library Names. (line 11) -* variables, global, printing list of: Options. (line 94) -* variables, initializing: Using Variables. (line 23) -* variables, local to a function: Variable Scope. (line 6) -* variables, predefined: Built-in Variables. (line 6) -* variables, predefined -v option, setting with: Options. (line 41) -* variables, predefined conveying information: Auto-set. (line 6) -* variables, private: Library Names. (line 11) -* variables, setting: Options. (line 32) -* variables, shadowing: Definition Syntax. (line 77) -* variables, types of: Assignment Ops. (line 39) -* variables, types of, comparison expressions and: Typing and Comparison. - (line 9) -* variables, uninitialized, as array subscripts: Uninitialized Subscripts. - (line 6) -* variables, user-defined: Variables. (line 6) -* version of gawk: Auto-set. (line 221) -* version of gawk extension API: Auto-set. (line 246) -* version of GNU MP library: Auto-set. (line 229) -* version of GNU MPFR library: Auto-set. (line 231) -* vertical bar (|): Regexp Operators. (line 70) -* vertical bar (|), | operator (I/O): Getline/Pipe. (line 10) -* vertical bar (|), | operator (I/O) <1>: Precedence. (line 64) -* vertical bar (|), |& operator (I/O): Getline/Coprocess. (line 6) -* vertical bar (|), |& operator (I/O) <1>: Precedence. (line 64) -* vertical bar (|), |& operator (I/O) <2>: Two-way I/O. (line 27) -* vertical bar (|), || operator: Boolean Ops. (line 59) -* vertical bar (|), || operator <1>: Precedence. (line 88) -* Vinschen, Corinna: Acknowledgments. (line 60) -* w debugger command (alias for watch): Viewing And Changing Data. - (line 66) -* w utility: Constant Size. (line 22) -* wait() extension function: Extension Sample Fork. - (line 22) -* waitpid() extension function: Extension Sample Fork. - (line 18) -* walk_array() user-defined function: Walking Arrays. (line 14) -* Wall, Larry: Array Intro. (line 6) -* Wall, Larry <1>: Future Extensions. (line 6) -* Wallin, Anders: Contributors. (line 104) -* warnings, issuing: Options. (line 184) -* watch debugger command: Viewing And Changing Data. - (line 66) -* watchpoint: Debugging Terms. (line 42) -* wc utility: Wc Program. (line 6) -* wc.awk program: Wc Program. (line 46) -* Weinberger, Peter: History. (line 17) -* Weinberger, Peter <1>: Contributors. (line 12) -* where debugger command: Execution Stack. (line 13) -* where debugger command (alias for backtrace): Execution Stack. - (line 13) -* while statement: While Statement. (line 6) -* while statement, use of regexps in: Regexp Usage. (line 19) -* whitespace, as field separators: Default Field Splitting. - (line 6) -* whitespace, functions, calling: Calling Built-in. (line 10) -* whitespace, newlines as: Options. (line 263) -* Williams, Kent: Contributors. (line 35) -* Woehlke, Matthew: Contributors. (line 80) -* Woods, John: Contributors. (line 28) -* word boundaries, matching: GNU Regexp Operators. - (line 41) -* word, regexp definition of: GNU Regexp Operators. - (line 6) -* word-boundary operator (gawk): GNU Regexp Operators. - (line 66) -* wordfreq.awk program: Word Sorting. (line 56) -* words, counting: Wc Program. (line 6) -* words, duplicate, searching for: Dupword Program. (line 6) -* words, usage counts, generating: Word Sorting. (line 6) -* writea() extension function: Extension Sample Read write array. - (line 12) -* xgettext utility: String Extraction. (line 13) -* xor: Bitwise Functions. (line 57) -* XOR bitwise operation: Bitwise Functions. (line 6) -* Yawitz, Efraim: Contributors. (line 132) -* Zaretskii, Eli: Acknowledgments. (line 60) -* Zaretskii, Eli <1>: Contributors. (line 56) -* Zaretskii, Eli <2>: Maintainers. (line 14) -* zerofile.awk program: Empty Files. (line 20) -* Zoulas, Christos: Contributors. (line 67) - - - -Tag Table: -Node: Top1200 -Node: Foreword342530 -Node: Foreword446972 -Node: Preface48504 -Ref: Preface-Footnote-151363 -Ref: Preface-Footnote-251470 -Ref: Preface-Footnote-351704 -Node: History51846 -Node: Names54198 -Ref: Names-Footnote-155292 -Node: This Manual55439 -Ref: This Manual-Footnote-161924 -Node: Conventions62024 -Node: Manual History64378 -Ref: Manual History-Footnote-167373 -Ref: Manual History-Footnote-267414 -Node: How To Contribute67488 -Node: Acknowledgments68617 -Node: Getting Started73503 -Node: Running gawk75942 -Node: One-shot77132 -Node: Read Terminal78395 -Node: Long80388 -Node: Executable Scripts81901 -Ref: Executable Scripts-Footnote-184696 -Node: Comments84799 -Node: Quoting87283 -Node: DOS Quoting92800 -Node: Sample Data Files93475 -Node: Very Simple96070 -Node: Two Rules100972 -Node: More Complex102857 -Node: Statements/Lines105723 -Ref: Statements/Lines-Footnote-1110182 -Node: Other Features110447 -Node: When111383 -Ref: When-Footnote-1113137 -Node: Intro Summary113202 -Node: Invoking Gawk114086 -Node: Command Line115600 -Node: Options116398 -Ref: Options-Footnote-1132497 -Ref: Options-Footnote-2132727 -Node: Other Arguments132752 -Node: Naming Standard Input135699 -Node: Environment Variables136792 -Node: AWKPATH Variable137350 -Ref: AWKPATH Variable-Footnote-1140761 -Ref: AWKPATH Variable-Footnote-2140795 -Node: AWKLIBPATH Variable141056 -Node: Other Environment Variables142313 -Node: Exit Status146134 -Node: Include Files146811 -Node: Loading Shared Libraries150406 -Node: Obsolete151834 -Node: Undocumented152526 -Node: Invoking Summary152823 -Node: Regexp154483 -Node: Regexp Usage156002 -Node: Escape Sequences158039 -Node: Regexp Operators164271 -Ref: Regexp Operators-Footnote-1171687 -Ref: Regexp Operators-Footnote-2171834 -Node: Bracket Expressions171932 -Ref: table-char-classes174408 -Node: Leftmost Longest177545 -Node: Computed Regexps178848 -Node: GNU Regexp Operators182275 -Node: Case-sensitivity185954 -Ref: Case-sensitivity-Footnote-1188850 -Ref: Case-sensitivity-Footnote-2189085 -Node: Strong Regexp Constants189193 -Node: Regexp Summary189982 -Node: Reading Files191457 -Node: Records193620 -Node: awk split records194353 -Node: gawk split records199284 -Ref: gawk split records-Footnote-1203824 -Node: Fields203861 -Node: Nonconstant Fields206602 -Ref: Nonconstant Fields-Footnote-1208838 -Node: Changing Fields209042 -Node: Field Separators214970 -Node: Default Field Splitting217668 -Node: Regexp Field Splitting218786 -Node: Single Character Fields222139 -Node: Command Line Field Separator223199 -Node: Full Line Fields226417 -Ref: Full Line Fields-Footnote-1227939 -Ref: Full Line Fields-Footnote-2227985 -Node: Field Splitting Summary228086 -Node: Constant Size230160 -Node: Splitting By Content234738 -Ref: Splitting By Content-Footnote-1238709 -Node: Multiple Line238872 -Ref: Multiple Line-Footnote-1244754 -Node: Getline244933 -Node: Plain Getline247400 -Node: Getline/Variable250039 -Node: Getline/File251188 -Node: Getline/Variable/File252574 -Ref: Getline/Variable/File-Footnote-1254177 -Node: Getline/Pipe254265 -Node: Getline/Variable/Pipe256970 -Node: Getline/Coprocess258103 -Node: Getline/Variable/Coprocess259368 -Node: Getline Notes260108 -Node: Getline Summary262903 -Ref: table-getline-variants263325 -Node: Read Timeout264073 -Ref: Read Timeout-Footnote-1267979 -Node: Retrying Input268037 -Node: Command-line directories269236 -Node: Input Summary270142 -Node: Input Exercises273314 -Node: Printing274042 -Node: Print275876 -Node: Print Examples277333 -Node: Output Separators280113 -Node: OFMT282130 -Node: Printf283486 -Node: Basic Printf284271 -Node: Control Letters285845 -Node: Format Modifiers289833 -Node: Printf Examples295848 -Node: Redirection298334 -Node: Special FD305175 -Ref: Special FD-Footnote-1308343 -Node: Special Files308417 -Node: Other Inherited Files309034 -Node: Special Network310035 -Node: Special Caveats310895 -Node: Close Files And Pipes311844 -Ref: table-close-pipe-return-values318751 -Ref: Close Files And Pipes-Footnote-1319534 -Ref: Close Files And Pipes-Footnote-2319682 -Node: Nonfatal319834 -Node: Output Summary322159 -Node: Output Exercises323381 -Node: Expressions324060 -Node: Values325248 -Node: Constants325926 -Node: Scalar Constants326617 -Ref: Scalar Constants-Footnote-1327481 -Node: Nondecimal-numbers327731 -Node: Regexp Constants330744 -Node: Using Constant Regexps331270 -Node: Variables334433 -Node: Using Variables335090 -Node: Assignment Options337000 -Node: Conversion338873 -Node: Strings And Numbers339397 -Ref: Strings And Numbers-Footnote-1342460 -Node: Locale influences conversions342569 -Ref: table-locale-affects345327 -Node: All Operators345945 -Node: Arithmetic Ops346574 -Node: Concatenation349080 -Ref: Concatenation-Footnote-1351927 -Node: Assignment Ops352034 -Ref: table-assign-ops357025 -Node: Increment Ops358338 -Node: Truth Values and Conditions361798 -Node: Truth Values362872 -Node: Typing and Comparison363920 -Node: Variable Typing364740 -Node: Comparison Operators368364 -Ref: table-relational-ops368783 -Node: POSIX String Comparison372278 -Ref: POSIX String Comparison-Footnote-1373973 -Ref: POSIX String Comparison-Footnote-2374112 -Node: Boolean Ops374196 -Ref: Boolean Ops-Footnote-1378678 -Node: Conditional Exp378770 -Node: Function Calls380506 -Node: Precedence384383 -Node: Locales388042 -Node: Expressions Summary389674 -Node: Patterns and Actions392247 -Node: Pattern Overview393367 -Node: Regexp Patterns395044 -Node: Expression Patterns395586 -Node: Ranges399367 -Node: BEGIN/END402475 -Node: Using BEGIN/END403236 -Ref: Using BEGIN/END-Footnote-1405972 -Node: I/O And BEGIN/END406078 -Node: BEGINFILE/ENDFILE408392 -Node: Empty411299 -Node: Using Shell Variables411616 -Node: Action Overview413890 -Node: Statements416215 -Node: If Statement418063 -Node: While Statement419558 -Node: Do Statement421586 -Node: For Statement422734 -Node: Switch Statement425892 -Node: Break Statement428278 -Node: Continue Statement430370 -Node: Next Statement432197 -Node: Nextfile Statement434580 -Node: Exit Statement437232 -Node: Built-in Variables439635 -Node: User-modified440768 -Node: Auto-set448354 -Ref: Auto-set-Footnote-1463007 -Ref: Auto-set-Footnote-2463213 -Node: ARGC and ARGV463269 -Node: Pattern Action Summary467482 -Node: Arrays469912 -Node: Array Basics471241 -Node: Array Intro472085 -Ref: figure-array-elements474060 -Ref: Array Intro-Footnote-1476764 -Node: Reference to Elements476892 -Node: Assigning Elements479356 -Node: Array Example479847 -Node: Scanning an Array481606 -Node: Controlling Scanning484628 -Ref: Controlling Scanning-Footnote-1490027 -Node: Numeric Array Subscripts490343 -Node: Uninitialized Subscripts492527 -Node: Delete494146 -Ref: Delete-Footnote-1496898 -Node: Multidimensional496955 -Node: Multiscanning500050 -Node: Arrays of Arrays501641 -Node: Arrays Summary506408 -Node: Functions508501 -Node: Built-in509539 -Node: Calling Built-in510620 -Node: Numeric Functions512616 -Ref: Numeric Functions-Footnote-1517449 -Ref: Numeric Functions-Footnote-2517806 -Ref: Numeric Functions-Footnote-3517854 -Node: String Functions518126 -Ref: String Functions-Footnote-1541630 -Ref: String Functions-Footnote-2541758 -Ref: String Functions-Footnote-3542006 -Node: Gory Details542093 -Ref: table-sub-escapes543884 -Ref: table-sub-proposed545403 -Ref: table-posix-sub546766 -Ref: table-gensub-escapes548307 -Ref: Gory Details-Footnote-1549130 -Node: I/O Functions549284 -Ref: table-system-return-values555866 -Ref: I/O Functions-Footnote-1557846 -Ref: I/O Functions-Footnote-2557994 -Node: Time Functions558114 -Ref: Time Functions-Footnote-1568636 -Ref: Time Functions-Footnote-2568704 -Ref: Time Functions-Footnote-3568862 -Ref: Time Functions-Footnote-4568973 -Ref: Time Functions-Footnote-5569085 -Ref: Time Functions-Footnote-6569312 -Node: Bitwise Functions569578 -Ref: table-bitwise-ops570172 -Ref: Bitwise Functions-Footnote-1574510 -Node: Type Functions574683 -Node: I18N Functions577215 -Node: User-defined578866 -Node: Definition Syntax579671 -Ref: Definition Syntax-Footnote-1585358 -Node: Function Example585429 -Ref: Function Example-Footnote-1588351 -Node: Function Caveats588373 -Node: Calling A Function588891 -Node: Variable Scope589849 -Node: Pass By Value/Reference592843 -Node: Return Statement596342 -Node: Dynamic Typing599321 -Node: Indirect Calls600251 -Ref: Indirect Calls-Footnote-1610502 -Node: Functions Summary610630 -Node: Library Functions613335 -Ref: Library Functions-Footnote-1616942 -Ref: Library Functions-Footnote-2617085 -Node: Library Names617256 -Ref: Library Names-Footnote-1620716 -Ref: Library Names-Footnote-2620939 -Node: General Functions621025 -Node: Strtonum Function622128 -Node: Assert Function625150 -Node: Round Function628476 -Node: Cliff Random Function630017 -Node: Ordinal Functions631033 -Ref: Ordinal Functions-Footnote-1634096 -Ref: Ordinal Functions-Footnote-2634348 -Node: Join Function634558 -Ref: Join Function-Footnote-1636328 -Node: Getlocaltime Function636528 -Node: Readfile Function640270 -Node: Shell Quoting642242 -Node: Data File Management643643 -Node: Filetrans Function644275 -Node: Rewind Function648371 -Node: File Checking650277 -Ref: File Checking-Footnote-1651611 -Node: Empty Files651812 -Node: Ignoring Assigns653791 -Node: Getopt Function655341 -Ref: Getopt Function-Footnote-1666810 -Node: Passwd Functions667010 -Ref: Passwd Functions-Footnote-1675849 -Node: Group Functions675937 -Ref: Group Functions-Footnote-1683835 -Node: Walking Arrays684042 -Node: Library Functions Summary687050 -Node: Library Exercises688456 -Node: Sample Programs688921 -Node: Running Examples689691 -Node: Clones690419 -Node: Cut Program691643 -Node: Egrep Program701572 -Ref: Egrep Program-Footnote-1709084 -Node: Id Program709194 -Node: Split Program712874 -Ref: Split Program-Footnote-1716333 -Node: Tee Program716462 -Node: Uniq Program719252 -Node: Wc Program726678 -Ref: Wc Program-Footnote-1730933 -Node: Miscellaneous Programs731027 -Node: Dupword Program732240 -Node: Alarm Program734270 -Node: Translate Program739125 -Ref: Translate Program-Footnote-1743690 -Node: Labels Program743960 -Ref: Labels Program-Footnote-1747311 -Node: Word Sorting747395 -Node: History Sorting751467 -Node: Extract Program753302 -Node: Simple Sed760831 -Node: Igawk Program763905 -Ref: Igawk Program-Footnote-1778236 -Ref: Igawk Program-Footnote-2778438 -Ref: Igawk Program-Footnote-3778560 -Node: Anagram Program778675 -Node: Signature Program781737 -Node: Programs Summary782984 -Node: Programs Exercises784198 -Ref: Programs Exercises-Footnote-1788327 -Node: Advanced Features788418 -Node: Nondecimal Data790408 -Node: Array Sorting791999 -Node: Controlling Array Traversal792699 -Ref: Controlling Array Traversal-Footnote-1801066 -Node: Array Sorting Functions801184 -Ref: Array Sorting Functions-Footnote-1806275 -Node: Two-way I/O806471 -Ref: Two-way I/O-Footnote-1813021 -Ref: Two-way I/O-Footnote-2813208 -Node: TCP/IP Networking813290 -Node: Profiling816408 -Ref: Profiling-Footnote-1824901 -Node: Advanced Features Summary825224 -Node: Internationalization827068 -Node: I18N and L10N828548 -Node: Explaining gettext829235 -Ref: Explaining gettext-Footnote-1835127 -Ref: Explaining gettext-Footnote-2835312 -Node: Programmer i18n835477 -Ref: Programmer i18n-Footnote-1840332 -Node: Translator i18n840381 -Node: String Extraction841175 -Ref: String Extraction-Footnote-1842307 -Node: Printf Ordering842393 -Ref: Printf Ordering-Footnote-1845179 -Node: I18N Portability845243 -Ref: I18N Portability-Footnote-1847699 -Node: I18N Example847762 -Ref: I18N Example-Footnote-1850568 -Node: Gawk I18N850641 -Node: I18N Summary851286 -Node: Debugger852627 -Node: Debugging853649 -Node: Debugging Concepts854090 -Node: Debugging Terms855899 -Node: Awk Debugging858474 -Node: Sample Debugging Session859380 -Node: Debugger Invocation859914 -Node: Finding The Bug861300 -Node: List of Debugger Commands867778 -Node: Breakpoint Control869111 -Node: Debugger Execution Control872805 -Node: Viewing And Changing Data876167 -Node: Execution Stack879541 -Node: Debugger Info881178 -Node: Miscellaneous Debugger Commands885249 -Node: Readline Support890337 -Node: Limitations891233 -Ref: Limitations-Footnote-1895464 -Node: Debugging Summary895515 -Node: Arbitrary Precision Arithmetic896794 -Node: Computer Arithmetic898210 -Ref: table-numeric-ranges901801 -Ref: Computer Arithmetic-Footnote-1902523 -Node: Math Definitions902580 -Ref: table-ieee-formats905894 -Ref: Math Definitions-Footnote-1906497 -Node: MPFR features906602 -Node: FP Math Caution908319 -Ref: FP Math Caution-Footnote-1909391 -Node: Inexactness of computations909760 -Node: Inexact representation910720 -Node: Comparing FP Values912080 -Node: Errors accumulate913162 -Node: Getting Accuracy914595 -Node: Try To Round917305 -Node: Setting precision918204 -Ref: table-predefined-precision-strings918901 -Node: Setting the rounding mode920731 -Ref: table-gawk-rounding-modes921105 -Ref: Setting the rounding mode-Footnote-1924513 -Node: Arbitrary Precision Integers924692 -Ref: Arbitrary Precision Integers-Footnote-1929609 -Node: POSIX Floating Point Problems929758 -Ref: POSIX Floating Point Problems-Footnote-1933640 -Node: Floating point summary933678 -Node: Dynamic Extensions935868 -Node: Extension Intro937421 -Node: Plugin License938687 -Node: Extension Mechanism Outline939484 -Ref: figure-load-extension939923 -Ref: figure-register-new-function941488 -Ref: figure-call-new-function942580 -Node: Extension API Description944642 -Node: Extension API Functions Introduction946174 -Node: General Data Types951033 -Ref: General Data Types-Footnote-1956988 -Node: Memory Allocation Functions957287 -Ref: Memory Allocation Functions-Footnote-1960132 -Node: Constructor Functions960231 -Node: Registration Functions961976 -Node: Extension Functions962661 -Node: Exit Callback Functions965284 -Node: Extension Version String966534 -Node: Input Parsers967197 -Node: Output Wrappers977079 -Node: Two-way processors981591 -Node: Printing Messages983856 -Ref: Printing Messages-Footnote-1985027 -Node: Updating ERRNO985180 -Node: Requesting Values985919 -Ref: table-value-types-returned986656 -Node: Accessing Parameters987539 -Node: Symbol Table Access988774 -Node: Symbol table by name989286 -Node: Symbol table by cookie991307 -Ref: Symbol table by cookie-Footnote-1995459 -Node: Cached values995523 -Ref: Cached values-Footnote-1999030 -Node: Array Manipulation999121 -Ref: Array Manipulation-Footnote-11000212 -Node: Array Data Types1000249 -Ref: Array Data Types-Footnote-11002907 -Node: Array Functions1002999 -Node: Flattening Arrays1006857 -Node: Creating Arrays1013765 -Node: Redirection API1018534 -Node: Extension API Variables1021365 -Node: Extension Versioning1021998 -Ref: gawk-api-version1022435 -Node: Extension API Informational Variables1024191 -Node: Extension API Boilerplate1025255 -Node: Finding Extensions1029069 -Node: Extension Example1029628 -Node: Internal File Description1030426 -Node: Internal File Ops1034506 -Ref: Internal File Ops-Footnote-11046268 -Node: Using Internal File Ops1046408 -Ref: Using Internal File Ops-Footnote-11048791 -Node: Extension Samples1049065 -Node: Extension Sample File Functions1050594 -Node: Extension Sample Fnmatch1058243 -Node: Extension Sample Fork1059730 -Node: Extension Sample Inplace1060948 -Node: Extension Sample Ord1064158 -Node: Extension Sample Readdir1064994 -Ref: table-readdir-file-types1065883 -Node: Extension Sample Revout1066688 -Node: Extension Sample Rev2way1067277 -Node: Extension Sample Read write array1068017 -Node: Extension Sample Readfile1069959 -Node: Extension Sample Time1071054 -Node: Extension Sample API Tests1072402 -Node: gawkextlib1072894 -Node: Extension summary1075341 -Node: Extension Exercises1079043 -Node: Language History1080541 -Node: V7/SVR3.11082197 -Node: SVR41084349 -Node: POSIX1085783 -Node: BTL1087162 -Node: POSIX/GNU1087891 -Node: Feature History1093753 -Node: Common Extensions1108123 -Node: Ranges and Locales1109406 -Ref: Ranges and Locales-Footnote-11114022 -Ref: Ranges and Locales-Footnote-21114049 -Ref: Ranges and Locales-Footnote-31114284 -Node: Contributors1114505 -Node: History summary1120065 -Node: Installation1121445 -Node: Gawk Distribution1122389 -Node: Getting1122873 -Node: Extracting1123834 -Node: Distribution contents1125472 -Node: Unix Installation1131557 -Node: Quick Installation1132239 -Node: Shell Startup Files1134653 -Node: Additional Configuration Options1135731 -Node: Configuration Philosophy1137536 -Node: Non-Unix Installation1139905 -Node: PC Installation1140365 -Node: PC Binary Installation1141203 -Node: PC Compiling1141638 -Node: PC Using1142755 -Node: Cygwin1145800 -Node: MSYS1146570 -Node: VMS Installation1147071 -Node: VMS Compilation1147862 -Ref: VMS Compilation-Footnote-11149091 -Node: VMS Dynamic Extensions1149149 -Node: VMS Installation Details1150834 -Node: VMS Running1153087 -Node: VMS GNV1157366 -Node: VMS Old Gawk1158101 -Node: Bugs1158572 -Node: Bug address1159235 -Node: Usenet1161632 -Node: Maintainers1162407 -Node: Other Versions1163783 -Node: Installation summary1170367 -Node: Notes1171402 -Node: Compatibility Mode1172267 -Node: Additions1173049 -Node: Accessing The Source1173974 -Node: Adding Code1175409 -Node: New Ports1181628 -Node: Derived Files1186116 -Ref: Derived Files-Footnote-11191601 -Ref: Derived Files-Footnote-21191636 -Ref: Derived Files-Footnote-31192234 -Node: Future Extensions1192348 -Node: Implementation Limitations1193006 -Node: Extension Design1194189 -Node: Old Extension Problems1195343 -Ref: Old Extension Problems-Footnote-11196861 -Node: Extension New Mechanism Goals1196918 -Ref: Extension New Mechanism Goals-Footnote-11200282 -Node: Extension Other Design Decisions1200471 -Node: Extension Future Growth1202584 -Node: Old Extension Mechanism1203420 -Node: Notes summary1205183 -Node: Basic Concepts1206365 -Node: Basic High Level1207046 -Ref: figure-general-flow1207328 -Ref: figure-process-flow1208013 -Ref: Basic High Level-Footnote-11211314 -Node: Basic Data Typing1211499 -Node: Glossary1214827 -Node: Copying1246774 -Node: GNU Free Documentation License1284313 -Node: Index1309431 - -End Tag Table diff --git a/doc/gawk.texi b/doc/gawk.texi index adc5c917..3c31cef5 100644 --- a/doc/gawk.texi +++ b/doc/gawk.texi @@ -19379,12 +19379,12 @@ Return the value of @var{val}, shifted right by @var{count} bits. Return the bitwise XOR of the arguments. There must be at least two. @end table -For all of these functions, first the double-precision floating-point value is -converted to the widest C unsigned integer type, then the bitwise operation is -performed. If the result cannot be represented exactly as a C @code{double}, -leading nonzero bits are removed one by one until it can be represented -exactly. The result is then converted back into a C @code{double}. (If -you don't understand this paragraph, don't worry about it.) +@quotation CAUTION +Beginning with @command{gawk} @value{VERSION} 4.2, negative +operands are not allowed for any of these functions. A negative +operand produces a fatal error. See the sidebar +``Beware The Smoke and Mirrors!'' for more information as to why. +@end quotation Here is a user-defined function (@pxref{User-defined}) that illustrates the use of these functions: @@ -19489,6 +19489,128 @@ decimal and octal values for the same numbers and then demonstrates the results of the @code{compl()}, @code{lshift()}, and @code{rshift()} functions. +@cindex sidebar, Beware The Smoke and Mirrors! +@ifdocbook +@docbook +<sidebar><title>Beware The Smoke and Mirrors!</title> +@end docbook + + +It other languages, bitwise operations are performed on integer values, +not floating-point values. As a general statement, such operations work +best when performed on unsigned integers. + +@command{gawk} attempts to treat the arguments to the bitwise functions +as unsigned integers. For this reason, negative arguments produce a +fatal error. + +In normal operation, for all of these functions, first the +double-precision floating-point value is converted to the widest C +unsigned integer type, then the bitwise operation is performed. If the +result cannot be represented exactly as a C @code{double}, leading +nonzero bits are removed one by one until it can be represented exactly. +The result is then converted back into a C @code{double}.@footnote{If you don't +understand this paragraph, the upshot is that @command{gawk} can only +store a particular range of integer values; numbers outside that range +are reduced to fit within the range.} + +However, when using arbitrary precision arithmetic with the @option{-M} +option (@pxref{Arbitrary Precision Arithmetic}), the results may differ. +This is particularly noticable with the @code{compl()} function: + +@example +$ @kbd{gawk 'BEGIN @{ print compl(42) @}'} +@print{} 9007199254740949 +$ @kbd{gawk -M 'BEGIN @{ print compl(42) @}'} +@print{} -43 +@end example + +What's going on becomes clear when printing the results +in hexadecimal: + +@example +$ @kbd{gawk 'BEGIN @{ printf "%#x\n", compl(42) @}'} +@print{} 0x1fffffffffffd5 +$ @kbd{gawk -M 'BEGIN @{ printf "%#x\n", compl(42) @}'} +@print{} 0xffffffffffffffd5 +@end example + +When using the @option{-M} option, under the hood, @command{gawk} uses +GNU MP arbitrary precision integers which have at least 64 bits of precision. +When not using @option{-M}, @command{gawk} stores integral values in +regular double-precision floating point, which only maintain 53 bits of +precision. Furthermore, the GNU MP library treats (or least seems to treat) +the leading bit as a sign bit; thus the result with @option{-M} in this case is +a negative number. + +In short, using @command{gawk} for any but the simplest kind of bitwise +operations is probably a bad idea; caveat emptor! + + +@docbook +</sidebar> +@end docbook +@end ifdocbook + +@ifnotdocbook +@cartouche +@center @b{Beware The Smoke and Mirrors!} + + + +It other languages, bitwise operations are performed on integer values, +not floating-point values. As a general statement, such operations work +best when performed on unsigned integers. + +@command{gawk} attempts to treat the arguments to the bitwise functions +as unsigned integers. For this reason, negative arguments produce a +fatal error. + +In normal operation, for all of these functions, first the +double-precision floating-point value is converted to the widest C +unsigned integer type, then the bitwise operation is performed. If the +result cannot be represented exactly as a C @code{double}, leading +nonzero bits are removed one by one until it can be represented exactly. +The result is then converted back into a C @code{double}.@footnote{If you don't +understand this paragraph, the upshot is that @command{gawk} can only +store a particular range of integer values; numbers outside that range +are reduced to fit within the range.} + +However, when using arbitrary precision arithmetic with the @option{-M} +option (@pxref{Arbitrary Precision Arithmetic}), the results may differ. +This is particularly noticable with the @code{compl()} function: + +@example +$ @kbd{gawk 'BEGIN @{ print compl(42) @}'} +@print{} 9007199254740949 +$ @kbd{gawk -M 'BEGIN @{ print compl(42) @}'} +@print{} -43 +@end example + +What's going on becomes clear when printing the results +in hexadecimal: + +@example +$ @kbd{gawk 'BEGIN @{ printf "%#x\n", compl(42) @}'} +@print{} 0x1fffffffffffd5 +$ @kbd{gawk -M 'BEGIN @{ printf "%#x\n", compl(42) @}'} +@print{} 0xffffffffffffffd5 +@end example + +When using the @option{-M} option, under the hood, @command{gawk} uses +GNU MP arbitrary precision integers which have at least 64 bits of precision. +When not using @option{-M}, @command{gawk} stores integral values in +regular double-precision floating point, which only maintain 53 bits of +precision. Furthermore, the GNU MP library treats (or least seems to treat) +the leading bit as a sign bit; thus the result with @option{-M} in this case is +a negative number. + +In short, using @command{gawk} for any but the simplest kind of bitwise +operations is probably a bad idea; caveat emptor! + +@end cartouche +@end ifnotdocbook + @node Type Functions @subsection Getting Type Information diff --git a/doc/gawkinet.info b/doc/gawkinet.info deleted file mode 100644 index d5a7abf8..00000000 --- a/doc/gawkinet.info +++ /dev/null @@ -1,4406 +0,0 @@ -This is gawkinet.info, produced by makeinfo version 6.1 from -gawkinet.texi. - -This is Edition 1.4 of 'TCP/IP Internetworking with 'gawk'', for the -4.1.4 (or later) version of the GNU implementation of AWK. - - - Copyright (C) 2000, 2001, 2002, 2004, 2009, 2010, 2016 Free Software -Foundation, Inc. - - - Permission is granted to copy, distribute and/or modify this document -under the terms of the GNU Free Documentation License, Version 1.3 or -any later version published by the Free Software Foundation; with the -Invariant Sections being "GNU General Public License", the Front-Cover -texts being (a) (see below), and with the Back-Cover Texts being (b) -(see below). A copy of the license is included in the section entitled -"GNU Free Documentation License". - - a. "A GNU Manual" - - b. "You have the freedom to copy and modify this GNU manual. Buying - copies from the FSF supports it in developing GNU and promoting - software freedom." -INFO-DIR-SECTION Network applications -START-INFO-DIR-ENTRY -* Gawkinet: (gawkinet). TCP/IP Internetworking With 'gawk'. -END-INFO-DIR-ENTRY - - This file documents the networking features in GNU 'awk'. - - This is Edition 1.4 of 'TCP/IP Internetworking with 'gawk'', for the -4.1.4 (or later) version of the GNU implementation of AWK. - - - Copyright (C) 2000, 2001, 2002, 2004, 2009, 2010, 2016 Free Software -Foundation, Inc. - - - Permission is granted to copy, distribute and/or modify this document -under the terms of the GNU Free Documentation License, Version 1.3 or -any later version published by the Free Software Foundation; with the -Invariant Sections being "GNU General Public License", the Front-Cover -texts being (a) (see below), and with the Back-Cover Texts being (b) -(see below). A copy of the license is included in the section entitled -"GNU Free Documentation License". - - a. "A GNU Manual" - - b. "You have the freedom to copy and modify this GNU manual. Buying - copies from the FSF supports it in developing GNU and promoting - software freedom." - - -File: gawkinet.info, Node: Top, Next: Preface, Prev: (dir), Up: (dir) - -General Introduction -******************** - -This file documents the networking features in GNU Awk ('gawk') version -4.0 and later. - - This is Edition 1.4 of 'TCP/IP Internetworking with 'gawk'', for the -4.1.4 (or later) version of the GNU implementation of AWK. - - - Copyright (C) 2000, 2001, 2002, 2004, 2009, 2010, 2016 Free Software -Foundation, Inc. - - - Permission is granted to copy, distribute and/or modify this document -under the terms of the GNU Free Documentation License, Version 1.3 or -any later version published by the Free Software Foundation; with the -Invariant Sections being "GNU General Public License", the Front-Cover -texts being (a) (see below), and with the Back-Cover Texts being (b) -(see below). A copy of the license is included in the section entitled -"GNU Free Documentation License". - - a. "A GNU Manual" - - b. "You have the freedom to copy and modify this GNU manual. Buying - copies from the FSF supports it in developing GNU and promoting - software freedom." - -* Menu: - -* Preface:: About this document. -* Introduction:: About networking. -* Using Networking:: Some examples. -* Some Applications and Techniques:: More extended examples. -* Links:: Where to find the stuff mentioned in this - document. -* GNU Free Documentation License:: The license for this document. -* Index:: The index. - -* Stream Communications:: Sending data streams. -* Datagram Communications:: Sending self-contained messages. -* The TCP/IP Protocols:: How these models work in the Internet. -* Basic Protocols:: The basic protocols. -* Ports:: The idea behind ports. -* Making Connections:: Making TCP/IP connections. -* Gawk Special Files:: How to do 'gawk' networking. -* Special File Fields:: The fields in the special file name. -* Comparing Protocols:: Differences between the protocols. -* File /inet/tcp:: The TCP special file. -* File /inet/udp:: The UDP special file. -* TCP Connecting:: Making a TCP connection. -* Troubleshooting:: Troubleshooting TCP/IP connections. -* Interacting:: Interacting with a service. -* Setting Up:: Setting up a service. -* Email:: Reading email. -* Web page:: Reading a Web page. -* Primitive Service:: A primitive Web service. -* Interacting Service:: A Web service with interaction. -* CGI Lib:: A simple CGI library. -* Simple Server:: A simple Web server. -* Caveats:: Network programming caveats. -* Challenges:: Where to go from here. -* PANIC:: An Emergency Web Server. -* GETURL:: Retrieving Web Pages. -* REMCONF:: Remote Configuration Of Embedded Systems. -* URLCHK:: Look For Changed Web Pages. -* WEBGRAB:: Extract Links From A Page. -* STATIST:: Graphing A Statistical Distribution. -* MAZE:: Walking Through A Maze In Virtual Reality. -* MOBAGWHO:: A Simple Mobile Agent. -* STOXPRED:: Stock Market Prediction As A Service. -* PROTBASE:: Searching Through A Protein Database. - - -File: gawkinet.info, Node: Preface, Next: Introduction, Prev: Top, Up: Top - -Preface -******* - -In May of 1997, Ju"rgen Kahrs felt the need for network access from -'awk', and, with a little help from me, set about adding features to do -this for 'gawk'. At that time, he wrote the bulk of this Info file. - - The code and documentation were added to the 'gawk' 3.1 development -tree, and languished somewhat until I could finally get down to some -serious work on that version of 'gawk'. This finally happened in the -middle of 2000. - - Meantime, Ju"rgen wrote an article about the Internet special files -and '|&' operator for 'Linux Journal', and made a networking patch for -the production versions of 'gawk' available from his home page. In -August of 2000 (for 'gawk' 3.0.6), this patch also made it to the main -GNU 'ftp' distribution site. - - For release with 'gawk', I edited Ju"rgen's prose for English grammar -and style, as he is not a native English speaker. I also rearranged the -material somewhat for what I felt was a better order of presentation, -and (re)wrote some of the introductory material. - - The majority of this document and the code are his work, and the high -quality and interesting ideas speak for themselves. It is my hope that -these features will be of significant value to the 'awk' community. - - -Arnold Robbins -Nof Ayalon, ISRAEL -March, 2001 - - -File: gawkinet.info, Node: Introduction, Next: Using Networking, Prev: Preface, Up: Top - -1 Networking Concepts -********************* - -This major node provides a (necessarily) brief introduction to computer -networking concepts. For many applications of 'gawk' to TCP/IP -networking, we hope that this is enough. For more advanced tasks, you -will need deeper background, and it may be necessary to switch to -lower-level programming in C or C++. - - There are two real-life models for the way computers send messages to -each other over a network. While the analogies are not perfect, they -are close enough to convey the major concepts. These two models are the -phone system (reliable byte-stream communications), and the postal -system (best-effort datagrams). - -* Menu: - -* Stream Communications:: Sending data streams. -* Datagram Communications:: Sending self-contained messages. -* The TCP/IP Protocols:: How these models work in the Internet. -* Making Connections:: Making TCP/IP connections. - - -File: gawkinet.info, Node: Stream Communications, Next: Datagram Communications, Prev: Introduction, Up: Introduction - -1.1 Reliable Byte-streams (Phone Calls) -======================================= - -When you make a phone call, the following steps occur: - - 1. You dial a number. - - 2. The phone system connects to the called party, telling them there - is an incoming call. (Their phone rings.) - - 3. The other party answers the call, or, in the case of a computer - network, refuses to answer the call. - - 4. Assuming the other party answers, the connection between you is now - a "duplex" (two-way), "reliable" (no data lost), sequenced (data - comes out in the order sent) data stream. - - 5. You and your friend may now talk freely, with the phone system - moving the data (your voices) from one end to the other. From your - point of view, you have a direct end-to-end connection with the - person on the other end. - - The same steps occur in a duplex reliable computer networking -connection. There is considerably more overhead in setting up the -communications, but once it's done, data moves in both directions, -reliably, in sequence. - - -File: gawkinet.info, Node: Datagram Communications, Next: The TCP/IP Protocols, Prev: Stream Communications, Up: Introduction - -1.2 Best-effort Datagrams (Mailed Letters) -========================================== - -Suppose you mail three different documents to your office on the other -side of the country on two different days. Doing so entails the -following. - - 1. Each document travels in its own envelope. - - 2. Each envelope contains both the sender and the recipient address. - - 3. Each envelope may travel a different route to its destination. - - 4. The envelopes may arrive in a different order from the one in which - they were sent. - - 5. One or more may get lost in the mail. (Although, fortunately, this - does not occur very often.) - - 6. In a computer network, one or more "packets" may also arrive - multiple times. (This doesn't happen with the postal system!) - - The important characteristics of datagram communications, like those -of the postal system are thus: - - * Delivery is "best effort;" the data may never get there. - - * Each message is self-contained, including the source and - destination addresses. - - * Delivery is _not_ sequenced; packets may arrive out of order, - and/or multiple times. - - * Unlike the phone system, overhead is considerably lower. It is not - necessary to set up the call first. - - The price the user pays for the lower overhead of datagram -communications is exactly the lower reliability; it is often necessary -for user-level protocols that use datagram communications to add their -own reliability features on top of the basic communications. - - -File: gawkinet.info, Node: The TCP/IP Protocols, Next: Making Connections, Prev: Datagram Communications, Up: Introduction - -1.3 The Internet Protocols -========================== - -The Internet Protocol Suite (usually referred to as just TCP/IP)(1) -consists of a number of different protocols at different levels or -"layers." For our purposes, three protocols provide the fundamental -communications mechanisms. All other defined protocols are referred to -as user-level protocols (e.g., HTTP, used later in this Info file). - -* Menu: - -* Basic Protocols:: The basic protocols. -* Ports:: The idea behind ports. - - ---------- Footnotes ---------- - - (1) It should be noted that although the Internet seems to have -conquered the world, there are other networking protocol suites in -existence and in use. - - -File: gawkinet.info, Node: Basic Protocols, Next: Ports, Prev: The TCP/IP Protocols, Up: The TCP/IP Protocols - -1.3.1 The Basic Internet Protocols ----------------------------------- - -IP - The Internet Protocol. This protocol is almost never used directly - by applications. It provides the basic packet delivery and routing - infrastructure of the Internet. Much like the phone company's - switching centers or the Post Office's trucks, it is not of much - day-to-day interest to the regular user (or programmer). It - happens to be a best effort datagram protocol. In the early - twenty-first century, there are two versions of this protocol in - use: - - IPv4 - The original version of the Internet Protocol, with 32-bit - addresses, on which most of the current Internet is based. - - IPv6 - The "next generation" of the Internet Protocol, with 128-bit - addresses. This protocol is in wide use in certain parts of - the world, but has not yet replaced IPv4.(1) - - Versions of the other protocols that sit "atop" IP exist for both - IPv4 and IPv6. However, as the IPv6 versions are fundamentally the - same as the original IPv4 versions, we will not distinguish further - between them. - -UDP - The User Datagram Protocol. This is a best effort datagram - protocol. It provides a small amount of extra reliability over IP, - and adds the notion of "ports", described in *note TCP and UDP - Ports: Ports. - -TCP - The Transmission Control Protocol. This is a duplex, reliable, - sequenced byte-stream protocol, again layered on top of IP, and - also providing the notion of ports. This is the protocol that you - will most likely use when using 'gawk' for network programming. - - All other user-level protocols use either TCP or UDP to do their -basic communications. Examples are SMTP (Simple Mail Transfer -Protocol), FTP (File Transfer Protocol), and HTTP (HyperText Transfer -Protocol). - - ---------- Footnotes ---------- - - (1) There isn't an IPv5. - - -File: gawkinet.info, Node: Ports, Prev: Basic Protocols, Up: The TCP/IP Protocols - -1.3.2 TCP and UDP Ports ------------------------ - -In the postal system, the address on an envelope indicates a physical -location, such as a residence or office building. But there may be more -than one person at the location; thus you have to further quantify the -recipient by putting a person or company name on the envelope. - - In the phone system, one phone number may represent an entire -company, in which case you need a person's extension number in order to -reach that individual directly. Or, when you call a home, you have to -say, "May I please speak to ..." before talking to the person directly. - - IP networking provides the concept of addressing. An IP address -represents a particular computer, but no more. In order to reach the -mail service on a system, or the FTP or WWW service on a system, you -must have some way to further specify which service you want. In the -Internet Protocol suite, this is done with "port numbers", which -represent the services, much like an extension number used with a phone -number. - - Port numbers are 16-bit integers. Unix and Unix-like systems reserve -ports below 1024 for "well known" services, such as SMTP, FTP, and HTTP. -Numbers 1024 and above may be used by any application, although there is -no promise made that a particular port number is always available. - - -File: gawkinet.info, Node: Making Connections, Prev: The TCP/IP Protocols, Up: Introduction - -1.4 Making TCP/IP Connections (And Some Terminology) -==================================================== - -Two terms come up repeatedly when discussing networking: "client" and -"server". For now, we'll discuss these terms at the "connection level", -when first establishing connections between two processes on different -systems over a network. (Once the connection is established, the higher -level, or "application level" protocols, such as HTTP or FTP, determine -who is the client and who is the server. Often, it turns out that the -client and server are the same in both roles.) - - The "server" is the system providing the service, such as the web -server or email server. It is the "host" (system) which is _connected -to_ in a transaction. For this to work though, the server must be -expecting connections. Much as there has to be someone at the office -building to answer the phone(1), the server process (usually) has to be -started first and be waiting for a connection. - - The "client" is the system requesting the service. It is the system -_initiating the connection_ in a transaction. (Just as when you pick up -the phone to call an office or store.) - - In the TCP/IP framework, each end of a connection is represented by a -pair of (ADDRESS, PORT) pairs. For the duration of the connection, the -ports in use at each end are unique, and cannot be used simultaneously -by other processes on the same system. (Only after closing a connection -can a new one be built up on the same port. This is contrary to the -usual behavior of fully developed web servers which have to avoid -situations in which they are not reachable. We have to pay this price -in order to enjoy the benefits of a simple communication paradigm in -'gawk'.) - - Furthermore, once the connection is established, communications are -"synchronous".(2) I.e., each end waits on the other to finish -transmitting, before replying. This is much like two people in a phone -conversation. While both could talk simultaneously, doing so usually -doesn't work too well. - - In the case of TCP, the synchronicity is enforced by the protocol -when sending data. Data writes "block" until the data have been -received on the other end. For both TCP and UDP, data reads block until -there is incoming data waiting to be read. This is summarized in the -following table, where an "X" indicates that the given action blocks. - -TCP X X -UDP X - - ---------- Footnotes ---------- - - (1) In the days before voice mail systems! - - (2) For the technically savvy, data reads block--if there's no -incoming data, the program is made to wait until there is, instead of -receiving a "there's no data" error return. - - -File: gawkinet.info, Node: Using Networking, Next: Some Applications and Techniques, Prev: Introduction, Up: Top - -2 Networking With 'gawk' -************************ - -The 'awk' programming language was originally developed as a -pattern-matching language for writing short programs to perform data -manipulation tasks. 'awk''s strength is the manipulation of textual -data that is stored in files. It was never meant to be used for -networking purposes. To exploit its features in a networking context, -it's necessary to use an access mode for network connections that -resembles the access of files as closely as possible. - - 'awk' is also meant to be a prototyping language. It is used to -demonstrate feasibility and to play with features and user interfaces. -This can be done with file-like handling of network connections. 'gawk' -trades the lack of many of the advanced features of the TCP/IP family of -protocols for the convenience of simple connection handling. The -advanced features are available when programming in C or Perl. In fact, -the network programming in this major node is very similar to what is -described in books such as 'Internet Programming with Python', 'Advanced -Perl Programming', or 'Web Client Programming with Perl'. - - However, you can do the programming here without first having to -learn object-oriented ideology; underlying languages such as Tcl/Tk, -Perl, Python; or all of the libraries necessary to extend these -languages before they are ready for the Internet. - - This major node demonstrates how to use the TCP protocol. The UDP -protocol is much less important for most users. - -* Menu: - -* Gawk Special Files:: How to do 'gawk' networking. -* TCP Connecting:: Making a TCP connection. -* Troubleshooting:: Troubleshooting TCP/IP connections. -* Interacting:: Interacting with a service. -* Setting Up:: Setting up a service. -* Email:: Reading email. -* Web page:: Reading a Web page. -* Primitive Service:: A primitive Web service. -* Interacting Service:: A Web service with interaction. -* Simple Server:: A simple Web server. -* Caveats:: Network programming caveats. -* Challenges:: Where to go from here. - - -File: gawkinet.info, Node: Gawk Special Files, Next: TCP Connecting, Prev: Using Networking, Up: Using Networking - -2.1 'gawk''s Networking Mechanisms -================================== - -The '|&' operator for use in communicating with a "coprocess" is -described in *note Two-way Communications With Another Process: -(gawk)Two-way I/O. It shows how to do two-way I/O to a separate process, -sending it data with 'print' or 'printf' and reading data with -'getline'. If you haven't read it already, you should detour there to -do so. - - 'gawk' transparently extends the two-way I/O mechanism to simple -networking through the use of special file names. When a "coprocess" -that matches the special files we are about to describe is started, -'gawk' creates the appropriate network connection, and then two-way I/O -proceeds as usual. - - At the C, C++, and Perl level, networking is accomplished via -"sockets", an Application Programming Interface (API) originally -developed at the University of California at Berkeley that is now used -almost universally for TCP/IP networking. Socket level programming, -while fairly straightforward, requires paying attention to a number of -details, as well as using binary data. It is not well-suited for use -from a high-level language like 'awk'. The special files provided in -'gawk' hide the details from the programmer, making things much simpler -and easier to use. - - The special file name for network access is made up of several -fields, all of which are mandatory: - - /NET-TYPE/PROTOCOL/LOCALPORT/HOSTNAME/REMOTEPORT - - The NET-TYPE field lets you specify IPv4 versus IPv6, or lets you -allow the system to choose. - -* Menu: - -* Special File Fields:: The fields in the special file name. -* Comparing Protocols:: Differences between the protocols. - - -File: gawkinet.info, Node: Special File Fields, Next: Comparing Protocols, Prev: Gawk Special Files, Up: Gawk Special Files - -2.1.1 The Fields of the Special File Name ------------------------------------------ - -This node explains the meaning of all the other fields, as well as the -range of values and the defaults. All of the fields are mandatory. To -let the system pick a value, or if the field doesn't apply to the -protocol, specify it as '0': - -NET-TYPE - This is one of 'inet4' for IPv4, 'inet6' for IPv6, or 'inet' to use - the system default (which is likely to be IPv4). For the rest of - this document, we will use the generic '/inet' in our descriptions - of how 'gawk''s networking works. - -PROTOCOL - Determines which member of the TCP/IP family of protocols is - selected to transport the data across the network. There are two - possible values (always written in lowercase): 'tcp' and 'udp'. - The exact meaning of each is explained later in this node. - -LOCALPORT - Determines which port on the local machine is used to communicate - across the network. Application-level clients usually use '0' to - indicate they do not care which local port is used--instead they - specify a remote port to connect to. It is vital for - application-level servers to use a number different from '0' here - because their service has to be available at a specific publicly - known port number. It is possible to use a name from - '/etc/services' here. - -HOSTNAME - Determines which remote host is to be at the other end of the - connection. Application-level servers must fill this field with a - '0' to indicate their being open for all other hosts to connect to - them and enforce connection level server behavior this way. It is - not possible for an application-level server to restrict its - availability to one remote host by entering a host name here. - Application-level clients must enter a name different from '0'. - The name can be either symbolic (e.g., 'jpl-devvax.jpl.nasa.gov') - or numeric (e.g., '128.149.1.143'). - -REMOTEPORT - Determines which port on the remote machine is used to communicate - across the network. For '/inet/tcp' and '/inet/udp', - application-level clients _must_ use a number other than '0' to - indicate to which port on the remote machine they want to connect. - Application-level servers must not fill this field with a '0'. - Instead they specify a local port to which clients connect. It is - possible to use a name from '/etc/services' here. - - Experts in network programming will notice that the usual -client/server asymmetry found at the level of the socket API is not -visible here. This is for the sake of simplicity of the high-level -concept. If this asymmetry is necessary for your application, use -another language. For 'gawk', it is more important to enable users to -write a client program with a minimum of code. What happens when first -accessing a network connection is seen in the following pseudocode: - - if ((name of remote host given) && (other side accepts connection)) { - rendez-vous successful; transmit with getline or print - } else { - if ((other side did not accept) && (localport == 0)) - exit unsuccessful - if (TCP) { - set up a server accepting connections - this means waiting for the client on the other side to connect - } else - ready - } - - The exact behavior of this algorithm depends on the values of the -fields of the special file name. When in doubt, *note Table 2.1: -table-inet-components. gives you the combinations of values and their -meaning. If this table is too complicated, focus on the three lines -printed in *bold*. All the examples in *note Networking With 'gawk': -Using Networking, use only the patterns printed in bold letters. - -PROTOCOL LOCAL HOST NAME REMOTE RESULTING CONNECTION-LEVEL - PORT PORT BEHAVIOR ------------------------------------------------------------------------------- -*tcp* *0* *x* *x* *Dedicated client, fails if - immediately connecting to a - server on the other side - fails* -udp 0 x x Dedicated client -*tcp, *x* *x* *x* *Client, switches to -udp* dedicated server if - necessary* -*tcp, *x* *0* *0* *Dedicated server* -udp* -tcp, udp x x 0 Invalid -tcp, udp 0 0 x Invalid -tcp, udp x 0 x Invalid -tcp, udp 0 0 0 Invalid -tcp, udp 0 x 0 Invalid - -Table 2.1: /inet Special File Components - - In general, TCP is the preferred mechanism to use. It is the -simplest protocol to understand and to use. Use UDP only if -circumstances demand low-overhead. - - -File: gawkinet.info, Node: Comparing Protocols, Prev: Special File Fields, Up: Gawk Special Files - -2.1.2 Comparing Protocols -------------------------- - -This node develops a pair of programs (sender and receiver) that do -nothing but send a timestamp from one machine to another. The sender -and the receiver are implemented with each of the two protocols -available and demonstrate the differences between them. - -* Menu: - -* File /inet/tcp:: The TCP special file. -* File /inet/udp:: The UDP special file. - - -File: gawkinet.info, Node: File /inet/tcp, Next: File /inet/udp, Prev: Comparing Protocols, Up: Comparing Protocols - -2.1.2.1 '/inet/tcp' -................... - -Once again, always use TCP. (Use UDP when low overhead is a necessity, -and use RAW for network experimentation.) The first example is the -sender program: - - # Server - BEGIN { - print strftime() |& "/inet/tcp/8888/0/0" - close("/inet/tcp/8888/0/0") - } - - The receiver is very simple: - - # Client - BEGIN { - "/inet/tcp/0/localhost/8888" |& getline - print $0 - close("/inet/tcp/0/localhost/8888") - } - - TCP guarantees that the bytes arrive at the receiving end in exactly -the same order that they were sent. No byte is lost (except for broken -connections), doubled, or out of order. Some overhead is necessary to -accomplish this, but this is the price to pay for a reliable service. -It does matter which side starts first. The sender/server has to be -started first, and it waits for the receiver to read a line. - - -File: gawkinet.info, Node: File /inet/udp, Prev: File /inet/tcp, Up: Comparing Protocols - -2.1.2.2 '/inet/udp' -................... - -The server and client programs that use UDP are almost identical to -their TCP counterparts; only the PROTOCOL has changed. As before, it -does matter which side starts first. The receiving side blocks and -waits for the sender. In this case, the receiver/client has to be -started first: - - # Server - BEGIN { - print strftime() |& "/inet/udp/8888/0/0" - close("/inet/udp/8888/0/0") - } - - The receiver is almost identical to the TCP receiver: - - # Client - BEGIN { - print "hi!" |& "/inet/udp/0/localhost/8888" - "/inet/udp/0/localhost/8888" |& getline - print $0 - close("/inet/udp/0/localhost/8888") - } - - In the case of UDP, the initial 'print' command is the one that -actually sends data so that there is a connection. UDP and "connection" -sounds strange to anyone who has learned that UDP is a connectionless -protocol. Here, "connection" means that the 'connect()' system call has -completed its work and completed the "association" between a certain -socket and an IP address. Thus there are subtle differences between -'connect()' for TCP and UDP; see the man page for details.(1) - - UDP cannot guarantee that the datagrams at the receiving end will -arrive in exactly the same order they were sent. Some datagrams could -be lost, some doubled, and some out of order. But no overhead is -necessary to accomplish this. This unreliable behavior is good enough -for tasks such as data acquisition, logging, and even stateless services -like the original versions of NFS. - - ---------- Footnotes ---------- - - (1) This subtlety is just one of many details that are hidden in the -socket API, invisible and intractable for the 'gawk' user. The -developers are currently considering how to rework the network -facilities to make them easier to understand and use. - - -File: gawkinet.info, Node: TCP Connecting, Next: Troubleshooting, Prev: Gawk Special Files, Up: Using Networking - -2.2 Establishing a TCP Connection -================================= - -Let's observe a network connection at work. Type in the following -program and watch the output. Within a second, it connects via TCP -('/inet/tcp') to the machine it is running on ('localhost') and asks the -service 'daytime' on the machine what time it is: - - BEGIN { - "/inet/tcp/0/localhost/daytime" |& getline - print $0 - close("/inet/tcp/0/localhost/daytime") - } - - Even experienced 'awk' users will find the second line strange in two -respects: - - * A special file is used as a shell command that pipes its output - into 'getline'. One would rather expect to see the special file - being read like any other file ('getline < - "/inet/tcp/0/localhost/daytime")'. - - * The operator '|&' has not been part of any 'awk' implementation - (until now). It is actually the only extension of the 'awk' - language needed (apart from the special files) to introduce network - access. - - The '|&' operator was introduced in 'gawk' 3.1 in order to overcome -the crucial restriction that access to files and pipes in 'awk' is -always unidirectional. It was formerly impossible to use both access -modes on the same file or pipe. Instead of changing the whole concept -of file access, the '|&' operator behaves exactly like the usual pipe -operator except for two additions: - - * Normal shell commands connected to their 'gawk' program with a '|&' - pipe can be accessed bidirectionally. The '|&' turns out to be a - quite general, useful, and natural extension of 'awk'. - - * Pipes that consist of a special file name for network connections - are not executed as shell commands. Instead, they can be read and - written to, just like a full-duplex network connection. - - In the earlier example, the '|&' operator tells 'getline' to read a -line from the special file '/inet/tcp/0/localhost/daytime'. We could -also have printed a line into the special file. But instead we just -read a line with the time, printed it, and closed the connection. -(While we could just let 'gawk' close the connection by finishing the -program, in this Info file we are pedantic and always explicitly close -the connections.) - - -File: gawkinet.info, Node: Troubleshooting, Next: Interacting, Prev: TCP Connecting, Up: Using Networking - -2.3 Troubleshooting Connection Problems -======================================= - -It may well be that for some reason the program shown in the previous -example does not run on your machine. When looking at possible reasons -for this, you will learn much about typical problems that arise in -network programming. First of all, your implementation of 'gawk' may -not support network access because it is a pre-3.1 version or you do not -have a network interface in your machine. Perhaps your machine uses -some other protocol, such as DECnet or Novell's IPX. For the rest of -this major node, we will assume you work on a Unix machine that supports -TCP/IP. If the previous example program does not run on your machine, it -may help to replace the name 'localhost' with the name of your machine -or its IP address. If it does, you could replace 'localhost' with the -name of another machine in your vicinity--this way, the program connects -to another machine. Now you should see the date and time being printed -by the program, otherwise your machine may not support the 'daytime' -service. Try changing the service to 'chargen' or 'ftp'. This way, the -program connects to other services that should give you some response. -If you are curious, you should have a look at your '/etc/services' file. -It could look like this: - - # /etc/services: - # - # Network services, Internet style - # - # Name Number/Protocol Alternate name # Comments - - echo 7/tcp - echo 7/udp - discard 9/tcp sink null - discard 9/udp sink null - daytime 13/tcp - daytime 13/udp - chargen 19/tcp ttytst source - chargen 19/udp ttytst source - ftp 21/tcp - telnet 23/tcp - smtp 25/tcp mail - finger 79/tcp - www 80/tcp http # WorldWideWeb HTTP - www 80/udp # HyperText Transfer Protocol - pop-2 109/tcp postoffice # POP version 2 - pop-2 109/udp - pop-3 110/tcp # POP version 3 - pop-3 110/udp - nntp 119/tcp readnews untp # USENET News - irc 194/tcp # Internet Relay Chat - irc 194/udp - ... - - Here, you find a list of services that traditional Unix machines -usually support. If your GNU/Linux machine does not do so, it may be -that these services are switched off in some startup script. Systems -running some flavor of Microsoft Windows usually do _not_ support these -services. Nevertheless, it _is_ possible to do networking with 'gawk' -on Microsoft Windows.(1) The first column of the file gives the name of -the service, and the second column gives a unique number and the -protocol that one can use to connect to this service. The rest of the -line is treated as a comment. You see that some services ('echo') -support TCP as well as UDP. - - ---------- Footnotes ---------- - - (1) Microsoft preferred to ignore the TCP/IP family of protocols -until 1995. Then came the rise of the Netscape browser as a landmark -"killer application." Microsoft added TCP/IP support and their own -browser to Microsoft Windows 95 at the last minute. They even -back-ported their TCP/IP implementation to Microsoft Windows for -Workgroups 3.11, but it was a rather rudimentary and half-hearted -implementation. Nevertheless, the equivalent of '/etc/services' resides -under 'C:\WINNT\system32\drivers\etc\services' on Microsoft Windows 2000 -and Microsoft Windows XP. - - -File: gawkinet.info, Node: Interacting, Next: Setting Up, Prev: Troubleshooting, Up: Using Networking - -2.4 Interacting with a Network Service -====================================== - -The next program makes use of the possibility to really interact with a -network service by printing something into the special file. It asks -the so-called 'finger' service if a user of the machine is logged in. -When testing this program, try to change 'localhost' to some other -machine name in your local network: - - BEGIN { - NetService = "/inet/tcp/0/localhost/finger" - print "NAME" |& NetService - while ((NetService |& getline) > 0) - print $0 - close(NetService) - } - - After telling the service on the machine which user to look for, the -program repeatedly reads lines that come as a reply. When no more lines -are coming (because the service has closed the connection), the program -also closes the connection. Try replacing '"NAME"' with your login name -(or the name of someone else logged in). For a list of all users -currently logged in, replace NAME with an empty string ('""'). - - The final 'close()' command could be safely deleted from the above -script, because the operating system closes any open connection by -default when a script reaches the end of execution. In order to avoid -portability problems, it is best to always close connections explicitly. -With the Linux kernel, for example, proper closing results in flushing -of buffers. Letting the close happen by default may result in -discarding buffers. - - When looking at '/etc/services' you may have noticed that the -'daytime' service is also available with 'udp'. In the earlier example, -change 'tcp' to 'udp', and change 'finger' to 'daytime'. After starting -the modified program, you see the expected day and time message. The -program then hangs, because it waits for more lines coming from the -service. However, they never come. This behavior is a consequence of -the differences between TCP and UDP. When using UDP, neither party is -automatically informed about the other closing the connection. -Continuing to experiment this way reveals many other subtle differences -between TCP and UDP. To avoid such trouble, one should always remember -the advice Douglas E. Comer and David Stevens give in Volume III of -their series 'Internetworking With TCP' (page 14): - - When designing client-server applications, beginners are strongly - advised to use TCP because it provides reliable, - connection-oriented communication. Programs only use UDP if the - application protocol handles reliability, the application requires - hardware broadcast or multicast, or the application cannot tolerate - virtual circuit overhead. - - -File: gawkinet.info, Node: Setting Up, Next: Email, Prev: Interacting, Up: Using Networking - -2.5 Setting Up a Service -======================== - -The preceding programs behaved as clients that connect to a server -somewhere on the Internet and request a particular service. Now we set -up such a service to mimic the behavior of the 'daytime' service. Such -a server does not know in advance who is going to connect to it over the -network. Therefore, we cannot insert a name for the host to connect to -in our special file name. - - Start the following program in one window. Notice that the service -does not have the name 'daytime', but the number '8888'. From looking -at '/etc/services', you know that names like 'daytime' are just -mnemonics for predetermined 16-bit integers. Only the system -administrator ('root') could enter our new service into '/etc/services' -with an appropriate name. Also notice that the service name has to be -entered into a different field of the special file name because we are -setting up a server, not a client: - - BEGIN { - print strftime() |& "/inet/tcp/8888/0/0" - close("/inet/tcp/8888/0/0") - } - - Now open another window on the same machine. Copy the client program -given as the first example (*note Establishing a TCP Connection: TCP -Connecting.) to a new file and edit it, changing the name 'daytime' to -'8888'. Then start the modified client. You should get a reply like -this: - - Sat Sep 27 19:08:16 CEST 1997 - -Both programs explicitly close the connection. - - Now we will intentionally make a mistake to see what happens when the -name '8888' (the so-called port) is already used by another service. -Start the server program in both windows. The first one works, but the -second one complains that it could not open the connection. Each port -on a single machine can only be used by one server program at a time. -Now terminate the server program and change the name '8888' to 'echo'. -After restarting it, the server program does not run any more, and you -know why: there is already an 'echo' service running on your machine. -But even if this isn't true, you would not get your own 'echo' server -running on a Unix machine, because the ports with numbers smaller than -1024 ('echo' is at port 7) are reserved for 'root'. On machines running -some flavor of Microsoft Windows, there is no restriction that reserves -ports 1 to 1024 for a privileged user; hence, you can start an 'echo' -server there. - - Turning this short server program into something really useful is -simple. Imagine a server that first reads a file name from the client -through the network connection, then does something with the file and -sends a result back to the client. The server-side processing could be: - - BEGIN { - NetService = "/inet/tcp/8888/0/0" - NetService |& getline - CatPipe = ("cat " $1) # sets $0 and the fields - while ((CatPipe | getline) > 0) - print $0 |& NetService - close(NetService) - } - -and we would have a remote copying facility. Such a server reads the -name of a file from any client that connects to it and transmits the -contents of the named file across the net. The server-side processing -could also be the execution of a command that is transmitted across the -network. From this example, you can see how simple it is to open up a -security hole on your machine. If you allow clients to connect to your -machine and execute arbitrary commands, anyone would be free to do 'rm --rf *'. - - -File: gawkinet.info, Node: Email, Next: Web page, Prev: Setting Up, Up: Using Networking - -2.6 Reading Email -================= - -The distribution of email is usually done by dedicated email servers -that communicate with your machine using special protocols. To receive -email, we will use the Post Office Protocol (POP). Sending can be done -with the much older Simple Mail Transfer Protocol (SMTP). - - When you type in the following program, replace the EMAILHOST by the -name of your local email server. Ask your administrator if the server -has a POP service, and then use its name or number in the program below. -Now the program is ready to connect to your email server, but it will -not succeed in retrieving your mail because it does not yet know your -login name or password. Replace them in the program and it shows you -the first email the server has in store: - - BEGIN { - POPService = "/inet/tcp/0/EMAILHOST/pop3" - RS = ORS = "\r\n" - print "user NAME" |& POPService - POPService |& getline - print "pass PASSWORD" |& POPService - POPService |& getline - print "retr 1" |& POPService - POPService |& getline - if ($1 != "+OK") exit - print "quit" |& POPService - RS = "\r\n\\.\r\n" - POPService |& getline - print $0 - close(POPService) - } - - The record separators 'RS' and 'ORS' are redefined because the -protocol (POP) requires CR-LF to separate lines. After identifying -yourself to the email service, the command 'retr 1' instructs the -service to send the first of all your email messages in line. If the -service replies with something other than '+OK', the program exits; -maybe there is no email. Otherwise, the program first announces that it -intends to finish reading email, and then redefines 'RS' in order to -read the entire email as multiline input in one record. From the POP -RFC, we know that the body of the email always ends with a single line -containing a single dot. The program looks for this using 'RS = -"\r\n\\.\r\n"'. When it finds this sequence in the mail message, it -quits. You can invoke this program as often as you like; it does not -delete the message it reads, but instead leaves it on the server. - - -File: gawkinet.info, Node: Web page, Next: Primitive Service, Prev: Email, Up: Using Networking - -2.7 Reading a Web Page -====================== - -Retrieving a web page from a web server is as simple as retrieving email -from an email server. We only have to use a similar, but not identical, -protocol and a different port. The name of the protocol is HyperText -Transfer Protocol (HTTP) and the port number is usually 80. As in the -preceding node, ask your administrator about the name of your local web -server or proxy web server and its port number for HTTP requests. - - The following program employs a rather crude approach toward -retrieving a web page. It uses the prehistoric syntax of HTTP 0.9, -which almost all web servers still support. The most noticeable thing -about it is that the program directs the request to the local proxy -server whose name you insert in the special file name (which in turn -calls 'www.yahoo.com'): - - BEGIN { - RS = ORS = "\r\n" - HttpService = "/inet/tcp/0/PROXY/80" - print "GET http://www.yahoo.com" |& HttpService - while ((HttpService |& getline) > 0) - print $0 - close(HttpService) - } - - Again, lines are separated by a redefined 'RS' and 'ORS'. The 'GET' -request that we send to the server is the only kind of HTTP request that -existed when the web was created in the early 1990s. HTTP calls this -'GET' request a "method," which tells the service to transmit a web page -(here the home page of the Yahoo! search engine). Version 1.0 added -the request methods 'HEAD' and 'POST'. The current version of HTTP is -1.1,(1) and knows the additional request methods 'OPTIONS', 'PUT', -'DELETE', and 'TRACE'. You can fill in any valid web address, and the -program prints the HTML code of that page to your screen. - - Notice the similarity between the responses of the POP and HTTP -services. First, you get a header that is terminated by an empty line, -and then you get the body of the page in HTML. The lines of the headers -also have the same form as in POP. There is the name of a parameter, -then a colon, and finally the value of that parameter. - - Images ('.png' or '.gif' files) can also be retrieved this way, but -then you get binary data that should be redirected into a file. Another -application is calling a CGI (Common Gateway Interface) script on some -server. CGI scripts are used when the contents of a web page are not -constant, but generated instantly at the moment you send a request for -the page. For example, to get a detailed report about the current -quotes of Motorola stock shares, call a CGI script at Yahoo! with the -following: - - get = "GET http://quote.yahoo.com/q?s=MOT&d=t" - print get |& HttpService - - You can also request weather reports this way. - - ---------- Footnotes ---------- - - (1) Version 1.0 of HTTP was defined in RFC 1945. HTTP 1.1 was -initially specified in RFC 2068. In June 1999, RFC 2068 was made -obsolete by RFC 2616, an update without any substantial changes. - - -File: gawkinet.info, Node: Primitive Service, Next: Interacting Service, Prev: Web page, Up: Using Networking - -2.8 A Primitive Web Service -=========================== - -Now we know enough about HTTP to set up a primitive web service that -just says '"Hello, world"' when someone connects to it with a browser. -Compared to the situation in the preceding node, our program changes the -role. It tries to behave just like the server we have observed. Since -we are setting up a server here, we have to insert the port number in -the 'localport' field of the special file name. The other two fields -(HOSTNAME and REMOTEPORT) have to contain a '0' because we do not know -in advance which host will connect to our service. - - In the early 1990s, all a server had to do was send an HTML document -and close the connection. Here, we adhere to the modern syntax of HTTP. -The steps are as follows: - - 1. Send a status line telling the web browser that everything is okay. - - 2. Send a line to tell the browser how many bytes follow in the body - of the message. This was not necessary earlier because both - parties knew that the document ended when the connection closed. - Nowadays it is possible to stay connected after the transmission of - one web page. This is to avoid the network traffic necessary for - repeatedly establishing TCP connections for requesting several - images. Thus, there is the need to tell the receiving party how - many bytes will be sent. The header is terminated as usual with an - empty line. - - 3. Send the '"Hello, world"' body in HTML. The useless 'while' loop - swallows the request of the browser. We could actually omit the - loop, and on most machines the program would still work. First, - start the following program: - - BEGIN { - RS = ORS = "\r\n" - HttpService = "/inet/tcp/8080/0/0" - Hello = "<HTML><HEAD>" \ - "<TITLE>A Famous Greeting</TITLE></HEAD>" \ - "<BODY><H1>Hello, world</H1></BODY></HTML>" - Len = length(Hello) + length(ORS) - print "HTTP/1.0 200 OK" |& HttpService - print "Content-Length: " Len ORS |& HttpService - print Hello |& HttpService - while ((HttpService |& getline) > 0) - continue; - close(HttpService) - } - - Now, on the same machine, start your favorite browser and let it -point to <http://localhost:8080> (the browser needs to know on which -port our server is listening for requests). If this does not work, the -browser probably tries to connect to a proxy server that does not know -your machine. If so, change the browser's configuration so that the -browser does not try to use a proxy to connect to your machine. - - -File: gawkinet.info, Node: Interacting Service, Next: Simple Server, Prev: Primitive Service, Up: Using Networking - -2.9 A Web Service with Interaction -================================== - -This node shows how to set up a simple web server. The subnode is a -library file that we will use with all the examples in *note Some -Applications and Techniques::. - -* Menu: - -* CGI Lib:: A simple CGI library. - - Setting up a web service that allows user interaction is more -difficult and shows us the limits of network access in 'gawk'. In this -node, we develop a main program (a 'BEGIN' pattern and its action) that -will become the core of event-driven execution controlled by a graphical -user interface (GUI). Each HTTP event that the user triggers by some -action within the browser is received in this central procedure. -Parameters and menu choices are extracted from this request, and an -appropriate measure is taken according to the user's choice. For -example: - - BEGIN { - if (MyHost == "") { - "uname -n" | getline MyHost - close("uname -n") - } - if (MyPort == 0) MyPort = 8080 - HttpService = "/inet/tcp/" MyPort "/0/0" - MyPrefix = "http://" MyHost ":" MyPort - SetUpServer() - while ("awk" != "complex") { - # header lines are terminated this way - RS = ORS = "\r\n" - Status = 200 # this means OK - Reason = "OK" - Header = TopHeader - Document = TopDoc - Footer = TopFooter - if (GETARG["Method"] == "GET") { - HandleGET() - } else if (GETARG["Method"] == "HEAD") { - # not yet implemented - } else if (GETARG["Method"] != "") { - print "bad method", GETARG["Method"] - } - Prompt = Header Document Footer - print "HTTP/1.0", Status, Reason |& HttpService - print "Connection: Close" |& HttpService - print "Pragma: no-cache" |& HttpService - len = length(Prompt) + length(ORS) - print "Content-length:", len |& HttpService - print ORS Prompt |& HttpService - # ignore all the header lines - while ((HttpService |& getline) > 0) - ; - # stop talking to this client - close(HttpService) - # wait for new client request - HttpService |& getline - # do some logging - print systime(), strftime(), $0 - # read request parameters - CGI_setup($1, $2, $3) - } - } - - This web server presents menu choices in the form of HTML links. -Therefore, it has to tell the browser the name of the host it is -residing on. When starting the server, the user may supply the name of -the host from the command line with 'gawk -v MyHost="Rumpelstilzchen"'. -If the user does not do this, the server looks up the name of the host -it is running on for later use as a web address in HTML documents. The -same applies to the port number. These values are inserted later into -the HTML content of the web pages to refer to the home system. - - Each server that is built around this core has to initialize some -application-dependent variables (such as the default home page) in a -procedure 'SetUpServer()', which is called immediately before entering -the infinite loop of the server. For now, we will write an instance -that initiates a trivial interaction. With this home page, the client -user can click on two possible choices, and receive the current date -either in human-readable format or in seconds since 1970: - - function SetUpServer() { - TopHeader = "<HTML><HEAD>" - TopHeader = TopHeader \ - "<title>My name is GAWK, GNU AWK</title></HEAD>" - TopDoc = "<BODY><h2>\ - Do you prefer your date <A HREF=" MyPrefix \ - "/human>human</A> or \ - <A HREF=" MyPrefix "/POSIX>POSIXed</A>?</h2>" ORS ORS - TopFooter = "</BODY></HTML>" - } - - On the first run through the main loop, the default line terminators -are set and the default home page is copied to the actual home page. -Since this is the first run, 'GETARG["Method"]' is not initialized yet, -hence the case selection over the method does nothing. Now that the -home page is initialized, the server can start communicating to a client -browser. - - It does so by printing the HTTP header into the network connection -('print ... |& HttpService'). This command blocks execution of the -server script until a client connects. If this server script is -compared with the primitive one we wrote before, you will notice two -additional lines in the header. The first instructs the browser to -close the connection after each request. The second tells the browser -that it should never try to _remember_ earlier requests that had -identical web addresses (no caching). Otherwise, it could happen that -the browser retrieves the time of day in the previous example just once, -and later it takes the web page from the cache, always displaying the -same time of day although time advances each second. - - Having supplied the initial home page to the browser with a valid -document stored in the parameter 'Prompt', it closes the connection and -waits for the next request. When the request comes, a log line is -printed that allows us to see which request the server receives. The -final step in the loop is to call the function 'CGI_setup()', which -reads all the lines of the request (coming from the browser), processes -them, and stores the transmitted parameters in the array 'PARAM'. The -complete text of these application-independent functions can be found in -*note A Simple CGI Library: CGI Lib. For now, we use a simplified -version of 'CGI_setup()': - - function CGI_setup( method, uri, version, i) { - delete GETARG; delete MENU; delete PARAM - GETARG["Method"] = $1 - GETARG["URI"] = $2 - GETARG["Version"] = $3 - i = index($2, "?") - # is there a "?" indicating a CGI request? - if (i > 0) { - split(substr($2, 1, i-1), MENU, "[/:]") - split(substr($2, i+1), PARAM, "&") - for (i in PARAM) { - j = index(PARAM[i], "=") - GETARG[substr(PARAM[i], 1, j-1)] = \ - substr(PARAM[i], j+1) - } - } else { # there is no "?", no need for splitting PARAMs - split($2, MENU, "[/:]") - } - } - - At first, the function clears all variables used for global storage -of request parameters. The rest of the function serves the purpose of -filling the global parameters with the extracted new values. To -accomplish this, the name of the requested resource is split into parts -and stored for later evaluation. If the request contains a '?', then -the request has CGI variables seamlessly appended to the web address. -Everything in front of the '?' is split up into menu items, and -everything behind the '?' is a list of 'VARIABLE=VALUE' pairs (separated -by '&') that also need splitting. This way, CGI variables are isolated -and stored. This procedure lacks recognition of special characters that -are transmitted in coded form(1). Here, any optional request header and -body parts are ignored. We do not need header parameters and the -request body. However, when refining our approach or working with the -'POST' and 'PUT' methods, reading the header and body becomes -inevitable. Header parameters should then be stored in a global array -as well as the body. - - On each subsequent run through the main loop, one request from a -browser is received, evaluated, and answered according to the user's -choice. This can be done by letting the value of the HTTP method guide -the main loop into execution of the procedure 'HandleGET()', which -evaluates the user's choice. In this case, we have only one -hierarchical level of menus, but in the general case, menus are nested. -The menu choices at each level are separated by '/', just as in file -names. Notice how simple it is to construct menus of arbitrary depth: - - function HandleGET() { - if ( MENU[2] == "human") { - Footer = strftime() TopFooter - } else if (MENU[2] == "POSIX") { - Footer = systime() TopFooter - } - } - - The disadvantage of this approach is that our server is slow and can -handle only one request at a time. Its main advantage, however, is that -the server consists of just one 'gawk' program. No need for installing -an 'httpd', and no need for static separate HTML files, CGI scripts, or -'root' privileges. This is rapid prototyping. This program can be -started on the same host that runs your browser. Then let your browser -point to <http://localhost:8080>. - - It is also possible to include images into the HTML pages. Most -browsers support the not very well-known '.xbm' format, which may -contain only monochrome pictures but is an ASCII format. Binary images -are possible but not so easy to handle. Another way of including images -is to generate them with a tool such as GNUPlot, by calling the tool -with the 'system()' function or through a pipe. - - ---------- Footnotes ---------- - - (1) As defined in RFC 2068. - - -File: gawkinet.info, Node: CGI Lib, Prev: Interacting Service, Up: Interacting Service - -2.9.1 A Simple CGI Library --------------------------- - - HTTP is like being married: you have to be able to handle whatever - you're given, while being very careful what you send back. - Phil Smith III, - <http://www.netfunny.com/rhf/jokes/99/Mar/http.html> - - In *note A Web Service with Interaction: Interacting Service, we saw -the function 'CGI_setup()' as part of the web server "core logic" -framework. The code presented there handles almost everything necessary -for CGI requests. One thing it doesn't do is handle encoded characters -in the requests. For example, an '&' is encoded as a percent sign -followed by the hexadecimal value: '%26'. These encoded values should -be decoded. Following is a simple library to perform these tasks. This -code is used for all web server examples used throughout the rest of -this Info file. If you want to use it for your own web server, store -the source code into a file named 'inetlib.awk'. Then you can include -these functions into your code by placing the following statement into -your program (on the first line of your script): - - @include inetlib.awk - -But beware, this mechanism is only possible if you invoke your web -server script with 'igawk' instead of the usual 'awk' or 'gawk'. Here -is the code: - - # CGI Library and core of a web server - # Global arrays - # GETARG --- arguments to CGI GET command - # MENU --- menu items (path names) - # PARAM --- parameters of form x=y - - # Optional variable MyHost contains host address - # Optional variable MyPort contains port number - # Needs TopHeader, TopDoc, TopFooter - # Sets MyPrefix, HttpService, Status, Reason - - BEGIN { - if (MyHost == "") { - "uname -n" | getline MyHost - close("uname -n") - } - if (MyPort == 0) MyPort = 8080 - HttpService = "/inet/tcp/" MyPort "/0/0" - MyPrefix = "http://" MyHost ":" MyPort - SetUpServer() - while ("awk" != "complex") { - # header lines are terminated this way - RS = ORS = "\r\n" - Status = 200 # this means OK - Reason = "OK" - Header = TopHeader - Document = TopDoc - Footer = TopFooter - if (GETARG["Method"] == "GET") { - HandleGET() - } else if (GETARG["Method"] == "HEAD") { - # not yet implemented - } else if (GETARG["Method"] != "") { - print "bad method", GETARG["Method"] - } - Prompt = Header Document Footer - print "HTTP/1.0", Status, Reason |& HttpService - print "Connection: Close" |& HttpService - print "Pragma: no-cache" |& HttpService - len = length(Prompt) + length(ORS) - print "Content-length:", len |& HttpService - print ORS Prompt |& HttpService - # ignore all the header lines - while ((HttpService |& getline) > 0) - continue - # stop talking to this client - close(HttpService) - # wait for new client request - HttpService |& getline - # do some logging - print systime(), strftime(), $0 - CGI_setup($1, $2, $3) - } - } - - function CGI_setup( method, uri, version, i) - { - delete GETARG - delete MENU - delete PARAM - GETARG["Method"] = method - GETARG["URI"] = uri - GETARG["Version"] = version - - i = index(uri, "?") - if (i > 0) { # is there a "?" indicating a CGI request? - split(substr(uri, 1, i-1), MENU, "[/:]") - split(substr(uri, i+1), PARAM, "&") - for (i in PARAM) { - PARAM[i] = _CGI_decode(PARAM[i]) - j = index(PARAM[i], "=") - GETARG[substr(PARAM[i], 1, j-1)] = \ - substr(PARAM[i], j+1) - } - } else { # there is no "?", no need for splitting PARAMs - split(uri, MENU, "[/:]") - } - for (i in MENU) # decode characters in path - if (i > 4) # but not those in host name - MENU[i] = _CGI_decode(MENU[i]) - } - - This isolates details in a single function, 'CGI_setup()'. Decoding -of encoded characters is pushed off to a helper function, -'_CGI_decode()'. The use of the leading underscore ('_') in the -function name is intended to indicate that it is an "internal" function, -although there is nothing to enforce this: - - function _CGI_decode(str, hexdigs, i, pre, code1, code2, - val, result) - { - hexdigs = "123456789abcdef" - - i = index(str, "%") - if (i == 0) # no work to do - return str - - do { - pre = substr(str, 1, i-1) # part before %xx - code1 = substr(str, i+1, 1) # first hex digit - code2 = substr(str, i+2, 1) # second hex digit - str = substr(str, i+3) # rest of string - - code1 = tolower(code1) - code2 = tolower(code2) - val = index(hexdigs, code1) * 16 \ - + index(hexdigs, code2) - - result = result pre sprintf("%c", val) - i = index(str, "%") - } while (i != 0) - if (length(str) > 0) - result = result str - return result - } - - This works by splitting the string apart around an encoded character. -The two digits are converted to lowercase characters and looked up in a -string of hex digits. Note that '0' is not in the string on purpose; -'index()' returns zero when it's not found, automatically giving the -correct value! Once the hexadecimal value is converted from characters -in a string into a numerical value, 'sprintf()' converts the value back -into a real character. The following is a simple test harness for the -above functions: - - BEGIN { - CGI_setup("GET", - "http://www.gnu.org/cgi-bin/foo?p1=stuff&p2=stuff%26junk" \ - "&percent=a %25 sign", - "1.0") - for (i in MENU) - printf "MENU[\"%s\"] = %s\n", i, MENU[i] - for (i in PARAM) - printf "PARAM[\"%s\"] = %s\n", i, PARAM[i] - for (i in GETARG) - printf "GETARG[\"%s\"] = %s\n", i, GETARG[i] - } - - And this is the result when we run it: - - $ gawk -f testserv.awk - -| MENU["4"] = www.gnu.org - -| MENU["5"] = cgi-bin - -| MENU["6"] = foo - -| MENU["1"] = http - -| MENU["2"] = - -| MENU["3"] = - -| PARAM["1"] = p1=stuff - -| PARAM["2"] = p2=stuff&junk - -| PARAM["3"] = percent=a % sign - -| GETARG["p1"] = stuff - -| GETARG["percent"] = a % sign - -| GETARG["p2"] = stuff&junk - -| GETARG["Method"] = GET - -| GETARG["Version"] = 1.0 - -| GETARG["URI"] = http://www.gnu.org/cgi-bin/foo?p1=stuff& - p2=stuff%26junk&percent=a %25 sign - - -File: gawkinet.info, Node: Simple Server, Next: Caveats, Prev: Interacting Service, Up: Using Networking - -2.10 A Simple Web Server -======================== - -In the preceding node, we built the core logic for event-driven GUIs. -In this node, we finally extend the core to a real application. No one -would actually write a commercial web server in 'gawk', but it is -instructive to see that it is feasible in principle. - - The application is ELIZA, the famous program by Joseph Weizenbaum -that mimics the behavior of a professional psychotherapist when talking -to you. Weizenbaum would certainly object to this description, but this -is part of the legend around ELIZA. Take the site-independent core logic -and append the following code: - - function SetUpServer() { - SetUpEliza() - TopHeader = \ - "<HTML><title>An HTTP-based System with GAWK</title>\ - <HEAD><META HTTP-EQUIV=\"Content-Type\"\ - CONTENT=\"text/html; charset=iso-8859-1\"></HEAD>\ - <BODY BGCOLOR=\"#ffffff\" TEXT=\"#000000\"\ - LINK=\"#0000ff\" VLINK=\"#0000ff\"\ - ALINK=\"#0000ff\"> <A NAME=\"top\">" - TopDoc = "\ - <h2>Please choose one of the following actions:</h2>\ - <UL>\ - <LI>\ - <A HREF=" MyPrefix "/AboutServer>About this server</A>\ - </LI><LI>\ - <A HREF=" MyPrefix "/AboutELIZA>About Eliza</A></LI>\ - <LI>\ - <A HREF=" MyPrefix \ - "/StartELIZA>Start talking to Eliza</A></LI></UL>" - TopFooter = "</BODY></HTML>" - } - - 'SetUpServer()' is similar to the previous example, except for -calling another function, 'SetUpEliza()'. This approach can be used to -implement other kinds of servers. The only changes needed to do so are -hidden in the functions 'SetUpServer()' and 'HandleGET()'. Perhaps it -might be necessary to implement other HTTP methods. The 'igawk' program -that comes with 'gawk' may be useful for this process. - - When extending this example to a complete application, the first -thing to do is to implement the function 'SetUpServer()' to initialize -the HTML pages and some variables. These initializations determine the -way your HTML pages look (colors, titles, menu items, etc.). - - The function 'HandleGET()' is a nested case selection that decides -which page the user wants to see next. Each nesting level refers to a -menu level of the GUI. Each case implements a certain action of the -menu. On the deepest level of case selection, the handler essentially -knows what the user wants and stores the answer into the variable that -holds the HTML page contents: - - function HandleGET() { - # A real HTTP server would treat some parts of the URI as a file name. - # We take parts of the URI as menu choices and go on accordingly. - if(MENU[2] == "AboutServer") { - Document = "This is not a CGI script.\ - This is an httpd, an HTML file, and a CGI script all \ - in one GAWK script. It needs no separate www-server, \ - no installation, and no root privileges.\ - <p>To run it, do this:</p><ul>\ - <li> start this script with \"gawk -f httpserver.awk\",</li>\ - <li> and on the same host let your www browser open location\ - \"http://localhost:8080\"</li>\ - </ul>\<p>\ Details of HTTP come from:</p><ul>\ - <li>Hethmon: Illustrated Guide to HTTP</p>\ - <li>RFC 2068</li></ul><p>JK 14.9.1997</p>" - } else if (MENU[2] == "AboutELIZA") { - Document = "This is an implementation of the famous ELIZA\ - program by Joseph Weizenbaum. It is written in GAWK and\ - uses an HTML GUI." - } else if (MENU[2] == "StartELIZA") { - gsub(/\+/, " ", GETARG["YouSay"]) - # Here we also have to substitute coded special characters - Document = "<form method=GET>" \ - "<h3>" ElizaSays(GETARG["YouSay"]) "</h3>\ - <p><input type=text name=YouSay value=\"\" size=60>\ - <br><input type=submit value=\"Tell her about it\"></p></form>" - } - } - - Now we are down to the heart of ELIZA, so you can see how it works. -Initially the user does not say anything; then ELIZA resets its money -counter and asks the user to tell what comes to mind open heartedly. -The subsequent answers are converted to uppercase characters and stored -for later comparison. ELIZA presents the bill when being confronted -with a sentence that contains the phrase "shut up." Otherwise, it looks -for keywords in the sentence, conjugates the rest of the sentence, -remembers the keyword for later use, and finally selects an answer from -the set of possible answers: - - function ElizaSays(YouSay) { - if (YouSay == "") { - cost = 0 - answer = "HI, IM ELIZA, TELL ME YOUR PROBLEM" - } else { - q = toupper(YouSay) - gsub("'", "", q) - if(q == qold) { - answer = "PLEASE DONT REPEAT YOURSELF !" - } else { - if (index(q, "SHUT UP") > 0) { - answer = "WELL, PLEASE PAY YOUR BILL. ITS EXACTLY ... $"\ - int(100*rand()+30+cost/100) - } else { - qold = q - w = "-" # no keyword recognized yet - for (i in k) { # search for keywords - if (index(q, i) > 0) { - w = i - break - } - } - if (w == "-") { # no keyword, take old subject - w = wold - subj = subjold - } else { # find subject - subj = substr(q, index(q, w) + length(w)+1) - wold = w - subjold = subj # remember keyword and subject - } - for (i in conj) - gsub(i, conj[i], q) # conjugation - # from all answers to this keyword, select one randomly - answer = r[indices[int(split(k[w], indices) * rand()) + 1]] - # insert subject into answer - gsub("_", subj, answer) - } - } - } - cost += length(answer) # for later payment : 1 cent per character - return answer - } - - In the long but simple function 'SetUpEliza()', you can see tables -for conjugation, keywords, and answers.(1) The associative array 'k' -contains indices into the array of answers 'r'. To choose an answer, -ELIZA just picks an index randomly: - - function SetUpEliza() { - srand() - wold = "-" - subjold = " " - - # table for conjugation - conj[" ARE " ] = " AM " - conj["WERE " ] = "WAS " - conj[" YOU " ] = " I " - conj["YOUR " ] = "MY " - conj[" IVE " ] =\ - conj[" I HAVE " ] = " YOU HAVE " - conj[" YOUVE " ] =\ - conj[" YOU HAVE "] = " I HAVE " - conj[" IM " ] =\ - conj[" I AM " ] = " YOU ARE " - conj[" YOURE " ] =\ - conj[" YOU ARE " ] = " I AM " - - # table of all answers - r[1] = "DONT YOU BELIEVE THAT I CAN _" - r[2] = "PERHAPS YOU WOULD LIKE TO BE ABLE TO _ ?" - ... - - # table for looking up answers that - # fit to a certain keyword - k["CAN YOU"] = "1 2 3" - k["CAN I"] = "4 5" - k["YOU ARE"] =\ - k["YOURE"] = "6 7 8 9" - ... - } - - Some interesting remarks and details (including the original source -code of ELIZA) are found on Mark Humphrys' home page. Yahoo! also has -a page with a collection of ELIZA-like programs. Many of them are -written in Java, some of them disclosing the Java source code, and a few -even explain how to modify the Java source code. - - ---------- Footnotes ---------- - - (1) The version shown here is abbreviated. The full version comes -with the 'gawk' distribution. - - -File: gawkinet.info, Node: Caveats, Next: Challenges, Prev: Simple Server, Up: Using Networking - -2.11 Network Programming Caveats -================================ - -By now it should be clear that debugging a networked application is more -complicated than debugging a single-process single-hosted application. -The behavior of a networked application sometimes looks noncausal -because it is not reproducible in a strong sense. Whether a network -application works or not sometimes depends on the following: - - * How crowded the underlying network is - - * If the party at the other end is running or not - - * The state of the party at the other end - - The most difficult problems for a beginner arise from the hidden -states of the underlying network. After closing a TCP connection, it's -often necessary to wait a short while before reopening the connection. -Even more difficult is the establishment of a connection that previously -ended with a "broken pipe." Those connections have to "time out" for a -minute or so before they can reopen. Check this with the command -'netstat -a', which provides a list of still "active" connections. - - -File: gawkinet.info, Node: Challenges, Prev: Caveats, Up: Using Networking - -2.12 Where To Go From Here -========================== - -Now, you have learned enough to build your own application. You could, -for example, take part in the Loebner Contest to win $100,000. The -Loebner Prize is the first formal instantiation of a Turing Test. Hugh -Loebner agreed with The Cambridge Center for Behavioral Studies to -underwrite a contest designed to implement the Turing Test. Dr. Loebner -pledged a Grand Prize of $100,000 for the first computer whose responses -were indistinguishable from a human's. Each year an annual prize of -$2000 and a bronze medal is awarded to the _most_ human computer. The -winner of the annual contest is the best entry relative to other entries -that year, irrespective of how good it is in an absolute sense. Here is -an example of a conversation with the winning program of 1997: - - (c)1997 Cambridge Center For Behavioral Studies all rights reserved [CONVERSE] - [Intelligent Research Ltd.] Start at: [1997/04/29 08:59:40] - PROGRAM[10:39:20]Hi, my name is Catherine, what's yours? - JUDGE02[10:39:36]My name is Nathan. - PROGRAM[10:39:37]Well, it's nice to meet you, Nathan. - PROGRAM[10:39:45]Did you see that story on CNN last night about the lesbian - PROGRAM[10:40:03]couple who came out at a White House party on Sunday? - JUDGE02[10:40:45]No. I'm sorry I missed that. How did the Prez take it? - PROGRAM[10:40:47]Ellen Degeneres was one of them - she was kissing her lover - PROGRAM[10:41:08]in front of Bill Clinton. Do you think he was very - PROGRAM[10:41:21]embarrassed? - JUDGE02[10:41:37]You tell me. I didn't see it. - PROGRAM[10:41:38]Are you still a Friend of Bill Clinton? - JUDGE02[10:42:22]Yes. I would like to talk about something else. Do you know anything about sculpture. - PROGRAM[10:42:24]Well, I suppose he's doing his best like most of us, but he - PROGRAM[10:42:35]does seem to attract an UNUSUAL amount of bad publicity, - PROGRAM[10:42:51]wouldnt you say--can it all be bad luck? - JUDGE02[10:43:20]I asked you if you knew anything about sculpture. - PROGRAM[10:43:21]OK, but what happens now--does it all drift on, with - PROGRAM[10:43:36]everyone waiting to see how much his friends have said about - PROGRAM[10:43:47]him under threat of lots and lots of jail-or will something - PROGRAM[10:44:01]dramatic actually happen? - JUDGE02[10:44:19]Do you know what sculpture is? - PROGRAM[10:44:20]Well, youre more a fan of his than I am I guess---though I - PROGRAM[10:44:34]cant SWEAR what Id have done in that locked hotel room, I - PROGRAM[10:44:51]must say. - JUDGE02[10:45:26]Have you ever been to the Salmagundi Club? - PROGRAM[10:45:29]Never. to go back to the original discussion Time to get - PROGRAM[10:45:43]off this one I think and onto something more down to earth! - JUDGE02[10:46:20]What is more down to earth than art? - PROGRAM[10:46:21]I don't know what -- to be honest. - - PROGRAM[10:46:30]I suppose it depends on where you're coming from, but as the - PROGRAM[10:46:46]song goes in My Fair Lady, "Why can't a woman be more like a - PROGRAM[10:47:03]man? " - JUDGE02[10:47:52]I liked that song but I prefer "Why can't children be more like we are" - JUDGE02[10:48:10]from another play the name of which I cannot remember. - PROGRAM[10:48:12]What, if anything, do you enjoy about being a man? - JUDGE02[10:49:01]I would enjoy all aspects of life no matter what my gender. - PROGRAM[10:49:02]Do you think of yourself as being attractive? - - This program insists on always speaking about the same story around -Bill Clinton. You see, even a program with a rather narrow mind can -behave so much like a human being that it can win this prize. It is -quite common to let these programs talk to each other via network -connections. But during the competition itself, the program and its -computer have to be present at the place the competition is held. We -all would love to see a 'gawk' program win in such an event. Maybe it -is up to you to accomplish this? - - Some other ideas for useful networked applications: - * Read the file 'doc/awkforai.txt' in the 'gawk' distribution. It - was written by Ronald P. Loui (at the time, Associate Professor of - Computer Science, at Washington University in St. Louis, - <loui@ai.wustl.edu>) and summarizes why he taught 'gawk' to - students of Artificial Intelligence. Here are some passages from - the text: - - The GAWK manual can be consumed in a single lab session and - the language can be mastered by the next morning by the - average student. GAWK's automatic initialization, implicit - coercion, I/O support and lack of pointers forgive many of the - mistakes that young programmers are likely to make. Those who - have seen C but not mastered it are happy to see that GAWK - retains some of the same sensibilities while adding what must - be regarded as spoonsful of syntactic sugar. - ... - There are further simple answers. Probably the best is the - fact that increasingly, undergraduate AI programming is - involving the Web. Oren Etzioni (University of Washington, - Seattle) has for a while been arguing that the "softbot" is - replacing the mechanical engineers' robot as the most - glamorous AI testbed. If the artifact whose behavior needs to - be controlled in an intelligent way is the software agent, - then a language that is well-suited to controlling the - software environment is the appropriate language. That would - imply a scripting language. If the robot is KAREL, then the - right language is "turn left; turn right." If the robot is - Netscape, then the right language is something that can - generate 'netscape -remote - 'openURL(http://cs.wustl.edu/~loui)'' with elan. - ... - AI programming requires high-level thinking. There have - always been a few gifted programmers who can write high-level - programs in assembly language. Most however need the ambient - abstraction to have a higher floor. - ... - Second, inference is merely the expansion of notation. No - matter whether the logic that underlies an AI program is - fuzzy, probabilistic, deontic, defeasible, or deductive, the - logic merely defines how strings can be transformed into other - strings. A language that provides the best support for string - processing in the end provides the best support for logic, for - the exploration of various logics, and for most forms of - symbolic processing that AI might choose to call "reasoning" - instead of "logic." The implication is that PROLOG, which - saves the AI programmer from having to write a unifier, saves - perhaps two dozen lines of GAWK code at the expense of - strongly biasing the logic and representational expressiveness - of any approach. - - Now that 'gawk' itself can connect to the Internet, it should be - obvious that it is suitable for writing intelligent web agents. - - * 'awk' is strong at pattern recognition and string processing. So, - it is well suited to the classic problem of language translation. - A first try could be a program that knows the 100 most frequent - English words and their counterparts in German or French. The - service could be implemented by regularly reading email with the - program above, replacing each word by its translation and sending - the translation back via SMTP. Users would send English email to - their translation service and get back a translated email message - in return. As soon as this works, more effort can be spent on a - real translation program. - - * Another dialogue-oriented application (on the verge of ridicule) is - the email "support service." Troubled customers write an email to - an automatic 'gawk' service that reads the email. It looks for - keywords in the mail and assembles a reply email accordingly. By - carefully investigating the email header, and repeating these - keywords through the reply email, it is rather simple to give the - customer a feeling that someone cares. Ideally, such a service - would search a database of previous cases for solutions. If none - exists, the database could, for example, consist of all the - newsgroups, mailing lists and FAQs on the Internet. - - -File: gawkinet.info, Node: Some Applications and Techniques, Next: Links, Prev: Using Networking, Up: Top - -3 Some Applications and Techniques -********************************** - -In this major node, we look at a number of self-contained scripts, with -an emphasis on concise networking. Along the way, we work towards -creating building blocks that encapsulate often needed functions of the -networking world, show new techniques that broaden the scope of problems -that can be solved with 'gawk', and explore leading edge technology that -may shape the future of networking. - - We often refer to the site-independent core of the server that we -built in *note A Simple Web Server: Simple Server. When building new -and nontrivial servers, we always copy this building block and append -new instances of the two functions 'SetUpServer()' and 'HandleGET()'. - - This makes a lot of sense, since this scheme of event-driven -execution provides 'gawk' with an interface to the most widely accepted -standard for GUIs: the web browser. Now, 'gawk' can rival even Tcl/Tk. - - Tcl and 'gawk' have much in common. Both are simple scripting -languages that allow us to quickly solve problems with short programs. -But Tcl has Tk on top of it, and 'gawk' had nothing comparable up to -now. While Tcl needs a large and ever-changing library (Tk, which was -bound to the X Window System until recently), 'gawk' needs just the -networking interface and some kind of browser on the client's side. -Besides better portability, the most important advantage of this -approach (embracing well-established standards such HTTP and HTML) is -that _we do not need to change the language_. We let others do the work -of fighting over protocols and standards. We can use HTML, JavaScript, -VRML, or whatever else comes along to do our work. - -* Menu: - -* PANIC:: An Emergency Web Server. -* GETURL:: Retrieving Web Pages. -* REMCONF:: Remote Configuration Of Embedded Systems. -* URLCHK:: Look For Changed Web Pages. -* WEBGRAB:: Extract Links From A Page. -* STATIST:: Graphing A Statistical Distribution. -* MAZE:: Walking Through A Maze In Virtual Reality. -* MOBAGWHO:: A Simple Mobile Agent. -* STOXPRED:: Stock Market Prediction As A Service. -* PROTBASE:: Searching Through A Protein Database. - - -File: gawkinet.info, Node: PANIC, Next: GETURL, Prev: Some Applications and Techniques, Up: Some Applications and Techniques - -3.1 PANIC: An Emergency Web Server -================================== - -At first glance, the '"Hello, world"' example in *note A Primitive Web -Service: Primitive Service, seems useless. By adding just a few lines, -we can turn it into something useful. - - The PANIC program tells everyone who connects that the local site is -not working. When a web server breaks down, it makes a difference if -customers get a strange "network unreachable" message, or a short -message telling them that the server has a problem. In such an -emergency, the hard disk and everything on it (including the regular web -service) may be unavailable. Rebooting the web server off a diskette -makes sense in this setting. - - To use the PANIC program as an emergency web server, all you need are -the 'gawk' executable and the program below on a diskette. By default, -it connects to port 8080. A different value may be supplied on the -command line: - - BEGIN { - RS = ORS = "\r\n" - if (MyPort == 0) MyPort = 8080 - HttpService = "/inet/tcp/" MyPort "/0/0" - Hello = "<HTML><HEAD><TITLE>Out Of Service</TITLE>" \ - "</HEAD><BODY><H1>" \ - "This site is temporarily out of service." \ - "</H1></BODY></HTML>" - Len = length(Hello) + length(ORS) - while ("awk" != "complex") { - print "HTTP/1.0 200 OK" |& HttpService - print "Content-Length: " Len ORS |& HttpService - print Hello |& HttpService - while ((HttpService |& getline) > 0) - continue; - close(HttpService) - } - } - - -File: gawkinet.info, Node: GETURL, Next: REMCONF, Prev: PANIC, Up: Some Applications and Techniques - -3.2 GETURL: Retrieving Web Pages -================================ - -GETURL is a versatile building block for shell scripts that need to -retrieve files from the Internet. It takes a web address as a -command-line parameter and tries to retrieve the contents of this -address. The contents are printed to standard output, while the header -is printed to '/dev/stderr'. A surrounding shell script could analyze -the contents and extract the text or the links. An ASCII browser could -be written around GETURL. But more interestingly, web robots are -straightforward to write on top of GETURL. On the Internet, you can find -several programs of the same name that do the same job. They are -usually much more complex internally and at least 10 times longer. - - At first, GETURL checks if it was called with exactly one web -address. Then, it checks if the user chose to use a special proxy -server whose name is handed over in a variable. By default, it is -assumed that the local machine serves as proxy. GETURL uses the 'GET' -method by default to access the web page. By handing over the name of a -different method (such as 'HEAD'), it is possible to choose a different -behavior. With the 'HEAD' method, the user does not receive the body of -the page content, but does receive the header: - - BEGIN { - if (ARGC != 2) { - print "GETURL - retrieve Web page via HTTP 1.0" - print "IN:\n the URL as a command-line parameter" - print "PARAM(S):\n -v Proxy=MyProxy" - print "OUT:\n the page content on stdout" - print " the page header on stderr" - print "JK 16.05.1997" - print "ADR 13.08.2000" - exit - } - URL = ARGV[1]; ARGV[1] = "" - if (Proxy == "") Proxy = "127.0.0.1" - if (ProxyPort == 0) ProxyPort = 80 - if (Method == "") Method = "GET" - HttpService = "/inet/tcp/0/" Proxy "/" ProxyPort - ORS = RS = "\r\n\r\n" - print Method " " URL " HTTP/1.0" |& HttpService - HttpService |& getline Header - print Header > "/dev/stderr" - while ((HttpService |& getline) > 0) - printf "%s", $0 - close(HttpService) - } - - This program can be changed as needed, but be careful with the last -lines. Make sure transmission of binary data is not corrupted by -additional line breaks. Even as it is now, the byte sequence -'"\r\n\r\n"' would disappear if it were contained in binary data. Don't -get caught in a trap when trying a quick fix on this one. - - -File: gawkinet.info, Node: REMCONF, Next: URLCHK, Prev: GETURL, Up: Some Applications and Techniques - -3.3 REMCONF: Remote Configuration of Embedded Systems -===================================================== - -Today, you often find powerful processors in embedded systems. -Dedicated network routers and controllers for all kinds of machinery are -examples of embedded systems. Processors like the Intel 80x86 or the -AMD Elan are able to run multitasking operating systems, such as XINU or -GNU/Linux in embedded PCs. These systems are small and usually do not -have a keyboard or a display. Therefore it is difficult to set up their -configuration. There are several widespread ways to set them up: - - * DIP switches - - * Read Only Memories such as EPROMs - - * Serial lines or some kind of keyboard - - * Network connections via 'telnet' or SNMP - - * HTTP connections with HTML GUIs - - In this node, we look at a solution that uses HTTP connections to -control variables of an embedded system that are stored in a file. -Since embedded systems have tight limits on resources like memory, it is -difficult to employ advanced techniques such as SNMP and HTTP servers. -'gawk' fits in quite nicely with its single executable which needs just -a short script to start working. The following program stores the -variables in a file, and a concurrent process in the embedded system may -read the file. The program uses the site-independent part of the simple -web server that we developed in *note A Web Service with Interaction: -Interacting Service. As mentioned there, all we have to do is to write -two new procedures 'SetUpServer()' and 'HandleGET()': - - function SetUpServer() { - TopHeader = "<HTML><title>Remote Configuration</title>" - TopDoc = "<BODY>\ - <h2>Please choose one of the following actions:</h2>\ - <UL>\ - <LI><A HREF=" MyPrefix "/AboutServer>About this server</A></LI>\ - <LI><A HREF=" MyPrefix "/ReadConfig>Read Configuration</A></LI>\ - <LI><A HREF=" MyPrefix "/CheckConfig>Check Configuration</A></LI>\ - <LI><A HREF=" MyPrefix "/ChangeConfig>Change Configuration</A></LI>\ - <LI><A HREF=" MyPrefix "/SaveConfig>Save Configuration</A></LI>\ - </UL>" - TopFooter = "</BODY></HTML>" - if (ConfigFile == "") ConfigFile = "config.asc" - } - - The function 'SetUpServer()' initializes the top level HTML texts as -usual. It also initializes the name of the file that contains the -configuration parameters and their values. In case the user supplies a -name from the command line, that name is used. The file is expected to -contain one parameter per line, with the name of the parameter in column -one and the value in column two. - - The function 'HandleGET()' reflects the structure of the menu tree as -usual. The first menu choice tells the user what this is all about. -The second choice reads the configuration file line by line and stores -the parameters and their values. Notice that the record separator for -this file is '"\n"', in contrast to the record separator for HTTP. The -third menu choice builds an HTML table to show the contents of the -configuration file just read. The fourth choice does the real work of -changing parameters, and the last one just saves the configuration into -a file: - - function HandleGET() { - if(MENU[2] == "AboutServer") { - Document = "This is a GUI for remote configuration of an\ - embedded system. It is is implemented as one GAWK script." - } else if (MENU[2] == "ReadConfig") { - RS = "\n" - while ((getline < ConfigFile) > 0) - config[$1] = $2; - close(ConfigFile) - RS = "\r\n" - Document = "Configuration has been read." - } else if (MENU[2] == "CheckConfig") { - Document = "<TABLE BORDER=1 CELLPADDING=5>" - for (i in config) - Document = Document "<TR><TD>" i "</TD>" \ - "<TD>" config[i] "</TD></TR>" - Document = Document "</TABLE>" - } else if (MENU[2] == "ChangeConfig") { - if ("Param" in GETARG) { # any parameter to set? - if (GETARG["Param"] in config) { # is parameter valid? - config[GETARG["Param"]] = GETARG["Value"] - Document = (GETARG["Param"] " = " GETARG["Value"] ".") - } else { - Document = "Parameter <b>" GETARG["Param"] "</b> is invalid." - } - } else { - Document = "<FORM method=GET><h4>Change one parameter</h4>\ - <TABLE BORDER CELLPADDING=5>\ - <TR><TD>Parameter</TD><TD>Value</TD></TR>\ - <TR><TD><input type=text name=Param value=\"\" size=20></TD>\ - <TD><input type=text name=Value value=\"\" size=40></TD>\ - </TR></TABLE><input type=submit value=\"Set\"></FORM>" - } - } else if (MENU[2] == "SaveConfig") { - for (i in config) - printf("%s %s\n", i, config[i]) > ConfigFile - close(ConfigFile) - Document = "Configuration has been saved." - } - } - - We could also view the configuration file as a database. From this -point of view, the previous program acts like a primitive database -server. Real SQL database systems also make a service available by -providing a TCP port that clients can connect to. But the application -level protocols they use are usually proprietary and also change from -time to time. This is also true for the protocol that MiniSQL uses. - - -File: gawkinet.info, Node: URLCHK, Next: WEBGRAB, Prev: REMCONF, Up: Some Applications and Techniques - -3.4 URLCHK: Look for Changed Web Pages -====================================== - -Most people who make heavy use of Internet resources have a large -bookmark file with pointers to interesting web sites. It is impossible -to regularly check by hand if any of these sites have changed. A -program is needed to automatically look at the headers of web pages and -tell which ones have changed. URLCHK does the comparison after using -GETURL with the 'HEAD' method to retrieve the header. - - Like GETURL, this program first checks that it is called with exactly -one command-line parameter. URLCHK also takes the same command-line -variables 'Proxy' and 'ProxyPort' as GETURL, because these variables are -handed over to GETURL for each URL that gets checked. The one and only -parameter is the name of a file that contains one line for each URL. In -the first column, we find the URL, and the second and third columns hold -the length of the URL's body when checked for the two last times. Now, -we follow this plan: - - 1. Read the URLs from the file and remember their most recent lengths - - 2. Delete the contents of the file - - 3. For each URL, check its new length and write it into the file - - 4. If the most recent and the new length differ, tell the user - - It may seem a bit peculiar to read the URLs from a file together with -their two most recent lengths, but this approach has several advantages. -You can call the program again and again with the same file. After -running the program, you can regenerate the changed URLs by extracting -those lines that differ in their second and third columns: - - BEGIN { - if (ARGC != 2) { - print "URLCHK - check if URLs have changed" - print "IN:\n the file with URLs as a command-line parameter" - print " file contains URL, old length, new length" - print "PARAMS:\n -v Proxy=MyProxy -v ProxyPort=8080" - print "OUT:\n same as file with URLs" - print "JK 02.03.1998" - exit - } - URLfile = ARGV[1]; ARGV[1] = "" - if (Proxy != "") Proxy = " -v Proxy=" Proxy - if (ProxyPort != "") ProxyPort = " -v ProxyPort=" ProxyPort - while ((getline < URLfile) > 0) - Length[$1] = $3 + 0 - close(URLfile) # now, URLfile is read in and can be updated - GetHeader = "gawk " Proxy ProxyPort " -v Method=\"HEAD\" -f geturl.awk " - for (i in Length) { - GetThisHeader = GetHeader i " 2>&1" - while ((GetThisHeader | getline) > 0) - if (toupper($0) ~ /CONTENT-LENGTH/) NewLength = $2 + 0 - close(GetThisHeader) - print i, Length[i], NewLength > URLfile - if (Length[i] != NewLength) # report only changed URLs - print i, Length[i], NewLength - } - close(URLfile) - } - - Another thing that may look strange is the way GETURL is called. -Before calling GETURL, we have to check if the proxy variables need to -be passed on. If so, we prepare strings that will become part of the -command line later. In 'GetHeader()', we store these strings together -with the longest part of the command line. Later, in the loop over the -URLs, 'GetHeader()' is appended with the URL and a redirection operator -to form the command that reads the URL's header over the Internet. -GETURL always produces the headers over '/dev/stderr'. That is the -reason why we need the redirection operator to have the header piped in. - - This program is not perfect because it assumes that changing URLs -results in changed lengths, which is not necessarily true. A more -advanced approach is to look at some other header line that holds time -information. But, as always when things get a bit more complicated, -this is left as an exercise to the reader. - - -File: gawkinet.info, Node: WEBGRAB, Next: STATIST, Prev: URLCHK, Up: Some Applications and Techniques - -3.5 WEBGRAB: Extract Links from a Page -====================================== - -Sometimes it is necessary to extract links from web pages. Browsers do -it, web robots do it, and sometimes even humans do it. Since we have a -tool like GETURL at hand, we can solve this problem with some help from -the Bourne shell: - - BEGIN { RS = "http://[#%&\\+\\-\\./0-9\\:;\\?A-Z_a-z\\~]*" } - RT != "" { - command = ("gawk -v Proxy=MyProxy -f geturl.awk " RT \ - " > doc" NR ".html") - print command - } - - Notice that the regular expression for URLs is rather crude. A -precise regular expression is much more complex. But this one works -rather well. One problem is that it is unable to find internal links of -an HTML document. Another problem is that 'ftp', 'telnet', 'news', -'mailto', and other kinds of links are missing in the regular -expression. However, it is straightforward to add them, if doing so is -necessary for other tasks. - - This program reads an HTML file and prints all the HTTP links that it -finds. It relies on 'gawk''s ability to use regular expressions as -record separators. With 'RS' set to a regular expression that matches -links, the second action is executed each time a non-empty link is -found. We can find the matching link itself in 'RT'. - - The action could use the 'system()' function to let another GETURL -retrieve the page, but here we use a different approach. This simple -program prints shell commands that can be piped into 'sh' for execution. -This way it is possible to first extract the links, wrap shell commands -around them, and pipe all the shell commands into a file. After editing -the file, execution of the file retrieves exactly those files that we -really need. In case we do not want to edit, we can retrieve all the -pages like this: - - gawk -f geturl.awk http://www.suse.de | gawk -f webgrab.awk | sh - - After this, you will find the contents of all referenced documents in -files named 'doc*.html' even if they do not contain HTML code. The most -annoying thing is that we always have to pass the proxy to GETURL. If -you do not like to see the headers of the web pages appear on the -screen, you can redirect them to '/dev/null'. Watching the headers -appear can be quite interesting, because it reveals interesting details -such as which web server the companies use. Now, it is clear how the -clever marketing people use web robots to determine the market shares of -Microsoft and Netscape in the web server market. - - Port 80 of any web server is like a small hole in a repellent -firewall. After attaching a browser to port 80, we usually catch a -glimpse of the bright side of the server (its home page). With a tool -like GETURL at hand, we are able to discover some of the more concealed -or even "indecent" services (i.e., lacking conformity to standards of -quality). It can be exciting to see the fancy CGI scripts that lie -there, revealing the inner workings of the server, ready to be called: - - * With a command such as: - - gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/ - - some servers give you a directory listing of the CGI files. - Knowing the names, you can try to call some of them and watch for - useful results. Sometimes there are executables in such - directories (such as Perl interpreters) that you may call remotely. - If there are subdirectories with configuration data of the web - server, this can also be quite interesting to read. - - * The well-known Apache web server usually has its CGI files in the - directory '/cgi-bin'. There you can often find the scripts - 'test-cgi' and 'printenv'. Both tell you some things about the - current connection and the installation of the web server. Just - call: - - gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/test-cgi - gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/printenv - - * Sometimes it is even possible to retrieve system files like the web - server's log file--possibly containing customer data--or even the - file '/etc/passwd'. (We don't recommend this!) - - *Caution:* Although this may sound funny or simply irrelevant, we are -talking about severe security holes. Try to explore your own system -this way and make sure that none of the above reveals too much -information about your system. - - -File: gawkinet.info, Node: STATIST, Next: MAZE, Prev: WEBGRAB, Up: Some Applications and Techniques - -3.6 STATIST: Graphing a Statistical Distribution -================================================ - -In the HTTP server examples we've shown thus far, we never present an -image to the browser and its user. Presenting images is one task. -Generating images that reflect some user input and presenting these -dynamically generated images is another. In this node, we use GNUPlot -for generating '.png', '.ps', or '.gif' files.(1) - - The program we develop takes the statistical parameters of two -samples and computes the t-test statistics. As a result, we get the -probabilities that the means and the variances of both samples are the -same. In order to let the user check plausibility, the program presents -an image of the distributions. The statistical computation follows -'Numerical Recipes in C: The Art of Scientific Computing' by William H. -Press, Saul A. Teukolsky, William T. Vetterling, and Brian P. Flannery. -Since 'gawk' does not have a built-in function for the computation of -the beta function, we use the 'ibeta()' function of GNUPlot. As a side -effect, we learn how to use GNUPlot as a sophisticated calculator. The -comparison of means is done as in 'tutest', paragraph 14.2, page 613, -and the comparison of variances is done as in 'ftest', page 611 in -'Numerical Recipes'. - - As usual, we take the site-independent code for servers and append -our own functions 'SetUpServer()' and 'HandleGET()': - - function SetUpServer() { - TopHeader = "<HTML><title>Statistics with GAWK</title>" - TopDoc = "<BODY>\ - <h2>Please choose one of the following actions:</h2>\ - <UL>\ - <LI><A HREF=" MyPrefix "/AboutServer>About this server</A></LI>\ - <LI><A HREF=" MyPrefix "/EnterParameters>Enter Parameters</A></LI>\ - </UL>" - TopFooter = "</BODY></HTML>" - GnuPlot = "gnuplot 2>&1" - m1=m2=0; v1=v2=1; n1=n2=10 - } - - Here, you see the menu structure that the user sees. Later, we will -see how the program structure of the 'HandleGET()' function reflects the -menu structure. What is missing here is the link for the image we -generate. In an event-driven environment, request, generation, and -delivery of images are separated. - - Notice the way we initialize the 'GnuPlot' command string for the -pipe. By default, GNUPlot outputs the generated image via standard -output, as well as the results of 'print'(ed) calculations via standard -error. The redirection causes standard error to be mixed into standard -output, enabling us to read results of calculations with 'getline'. By -initializing the statistical parameters with some meaningful defaults, -we make sure the user gets an image the first time he uses the program. - - Following is the rather long function 'HandleGET()', which implements -the contents of this service by reacting to the different kinds of -requests from the browser. Before you start playing with this script, -make sure that your browser supports JavaScript and that it also has -this option switched on. The script uses a short snippet of JavaScript -code for delayed opening of a window with an image. A more detailed -explanation follows: - - function HandleGET() { - if(MENU[2] == "AboutServer") { - Document = "This is a GUI for a statistical computation.\ - It compares means and variances of two distributions.\ - It is implemented as one GAWK script and uses GNUPLOT." - } else if (MENU[2] == "EnterParameters") { - Document = "" - if ("m1" in GETARG) { # are there parameters to compare? - Document = Document "<SCRIPT LANGUAGE=\"JavaScript\">\ - setTimeout(\"window.open(\\\"" MyPrefix "/Image" systime()\ - "\\\",\\\"dist\\\", \\\"status=no\\\");\", 1000); </SCRIPT>" - m1 = GETARG["m1"]; v1 = GETARG["v1"]; n1 = GETARG["n1"] - m2 = GETARG["m2"]; v2 = GETARG["v2"]; n2 = GETARG["n2"] - t = (m1-m2)/sqrt(v1/n1+v2/n2) - df = (v1/n1+v2/n2)*(v1/n1+v2/n2)/((v1/n1)*(v1/n1)/(n1-1) \ - + (v2/n2)*(v2/n2) /(n2-1)) - if (v1>v2) { - f = v1/v2 - df1 = n1 - 1 - df2 = n2 - 1 - } else { - f = v2/v1 - df1 = n2 - 1 - df2 = n1 - 1 - } - print "pt=ibeta(" df/2 ",0.5," df/(df+t*t) ")" |& GnuPlot - print "pF=2.0*ibeta(" df2/2 "," df1/2 "," \ - df2/(df2+df1*f) ")" |& GnuPlot - print "print pt, pF" |& GnuPlot - RS="\n"; GnuPlot |& getline; RS="\r\n" # $1 is pt, $2 is pF - print "invsqrt2pi=1.0/sqrt(2.0*pi)" |& GnuPlot - print "nd(x)=invsqrt2pi/sd*exp(-0.5*((x-mu)/sd)**2)" |& GnuPlot - print "set term png small color" |& GnuPlot - #print "set term postscript color" |& GnuPlot - #print "set term gif medium size 320,240" |& GnuPlot - print "set yrange[-0.3:]" |& GnuPlot - print "set label 'p(m1=m2) =" $1 "' at 0,-0.1 left" |& GnuPlot - print "set label 'p(v1=v2) =" $2 "' at 0,-0.2 left" |& GnuPlot - print "plot mu=" m1 ",sd=" sqrt(v1) ", nd(x) title 'sample 1',\ - mu=" m2 ",sd=" sqrt(v2) ", nd(x) title 'sample 2'" |& GnuPlot - print "quit" |& GnuPlot - GnuPlot |& getline Image - while ((GnuPlot |& getline) > 0) - Image = Image RS $0 - close(GnuPlot) - } - Document = Document "\ - <h3>Do these samples have the same Gaussian distribution?</h3>\ - <FORM METHOD=GET> <TABLE BORDER CELLPADDING=5>\ - <TR>\ - <TD>1. Mean </TD> - <TD><input type=text name=m1 value=" m1 " size=8></TD>\ - <TD>1. Variance</TD> - <TD><input type=text name=v1 value=" v1 " size=8></TD>\ - <TD>1. Count </TD> - <TD><input type=text name=n1 value=" n1 " size=8></TD>\ - </TR><TR>\ - <TD>2. Mean </TD> - <TD><input type=text name=m2 value=" m2 " size=8></TD>\ - <TD>2. Variance</TD> - <TD><input type=text name=v2 value=" v2 " size=8></TD>\ - <TD>2. Count </TD> - <TD><input type=text name=n2 value=" n2 " size=8></TD>\ - </TR> <input type=submit value=\"Compute\">\ - </TABLE></FORM><BR>" - } else if (MENU[2] ~ "Image") { - Reason = "OK" ORS "Content-type: image/png" - #Reason = "OK" ORS "Content-type: application/x-postscript" - #Reason = "OK" ORS "Content-type: image/gif" - Header = Footer = "" - Document = Image - } - } - - As usual, we give a short description of the service in the first -menu choice. The third menu choice shows us that generation and -presentation of an image are two separate actions. While the latter -takes place quite instantly in the third menu choice, the former takes -place in the much longer second choice. Image data passes from the -generating action to the presenting action via the variable 'Image' that -contains a complete '.png' image, which is otherwise stored in a file. -If you prefer '.ps' or '.gif' images over the default '.png' images, you -may select these options by uncommenting the appropriate lines. But -remember to do so in two places: when telling GNUPlot which kind of -images to generate, and when transmitting the image at the end of the -program. - - Looking at the end of the program, the way we pass the 'Content-type' -to the browser is a bit unusual. It is appended to the 'OK' of the -first header line to make sure the type information becomes part of the -header. The other variables that get transmitted across the network are -made empty, because in this case we do not have an HTML document to -transmit, but rather raw image data to contain in the body. - - Most of the work is done in the second menu choice. It starts with a -strange JavaScript code snippet. When first implementing this server, -we used a short '"<IMG SRC=" MyPrefix "/Image>"' here. But then -browsers got smarter and tried to improve on speed by requesting the -image and the HTML code at the same time. When doing this, the browser -tries to build up a connection for the image request while the request -for the HTML text is not yet completed. The browser tries to connect to -the 'gawk' server on port 8080 while port 8080 is still in use for -transmission of the HTML text. The connection for the image cannot be -built up, so the image appears as "broken" in the browser window. We -solved this problem by telling the browser to open a separate window for -the image, but only after a delay of 1000 milliseconds. By this time, -the server should be ready for serving the next request. - - But there is one more subtlety in the JavaScript code. Each time the -JavaScript code opens a window for the image, the name of the image is -appended with a timestamp ('systime()'). Why this constant change of -name for the image? Initially, we always named the image 'Image', but -then the Netscape browser noticed the name had _not_ changed since the -previous request and displayed the previous image (caching behavior). -The server core is implemented so that browsers are told _not_ to cache -anything. Obviously HTTP requests do not always work as expected. One -way to circumvent the cache of such overly smart browsers is to change -the name of the image with each request. These three lines of -JavaScript caused us a lot of trouble. - - The rest can be broken down into two phases. At first, we check if -there are statistical parameters. When the program is first started, -there usually are no parameters because it enters the page coming from -the top menu. Then, we only have to present the user a form that he can -use to change statistical parameters and submit them. Subsequently, the -submission of the form causes the execution of the first phase because -_now_ there _are_ parameters to handle. - - Now that we have parameters, we know there will be an image -available. Therefore we insert the JavaScript code here to initiate the -opening of the image in a separate window. Then, we prepare some -variables that will be passed to GNUPlot for calculation of the -probabilities. Prior to reading the results, we must temporarily change -'RS' because GNUPlot separates lines with newlines. After instructing -GNUPlot to generate a '.png' (or '.ps' or '.gif') image, we initiate the -insertion of some text, explaining the resulting probabilities. The -final 'plot' command actually generates the image data. This raw binary -has to be read in carefully without adding, changing, or deleting a -single byte. Hence the unusual initialization of 'Image' and completion -with a 'while' loop. - - When using this server, it soon becomes clear that it is far from -being perfect. It mixes source code of six scripting languages or -protocols: - - * GNU 'awk' implements a server for the protocol: - * HTTP which transmits: - * HTML text which contains a short piece of: - * JavaScript code opening a separate window. - * A Bourne shell script is used for piping commands into: - * GNUPlot to generate the image to be opened. - - After all this work, the GNUPlot image opens in the JavaScript window -where it can be viewed by the user. - - It is probably better not to mix up so many different languages. The -result is not very readable. Furthermore, the statistical part of the -server does not take care of invalid input. Among others, using -negative variances will cause invalid results. - - ---------- Footnotes ---------- - - (1) Due to licensing problems, the default installation of GNUPlot -disables the generation of '.gif' files. If your installed version does -not accept 'set term gif', just download and install the most recent -version of GNUPlot and the GD library (http://www.boutell.com/gd/) by -Thomas Boutell. Otherwise you still have the chance to generate some -ASCII-art style images with GNUPlot by using 'set term dumb'. (We tried -it and it worked.) - - -File: gawkinet.info, Node: MAZE, Next: MOBAGWHO, Prev: STATIST, Up: Some Applications and Techniques - -3.7 MAZE: Walking Through a Maze In Virtual Reality -=================================================== - - In the long run, every program becomes rococo, and then rubble. - Alan Perlis - - By now, we know how to present arbitrary 'Content-type's to a -browser. In this node, our server will present a 3D world to our -browser. The 3D world is described in a scene description language -(VRML, Virtual Reality Modeling Language) that allows us to travel -through a perspective view of a 2D maze with our browser. Browsers with -a VRML plugin enable exploration of this technology. We could do one of -those boring 'Hello world' examples here, that are usually presented -when introducing novices to VRML. If you have never written any VRML -code, have a look at the VRML FAQ. Presenting a static VRML scene is a -bit trivial; in order to expose 'gawk''s new capabilities, we will -present a dynamically generated VRML scene. The function -'SetUpServer()' is very simple because it only sets the default HTML -page and initializes the random number generator. As usual, the -surrounding server lets you browse the maze. - - function SetUpServer() { - TopHeader = "<HTML><title>Walk through a maze</title>" - TopDoc = "\ - <h2>Please choose one of the following actions:</h2>\ - <UL>\ - <LI><A HREF=" MyPrefix "/AboutServer>About this server</A>\ - <LI><A HREF=" MyPrefix "/VRMLtest>Watch a simple VRML scene</A>\ - </UL>" - TopFooter = "</HTML>" - srand() - } - - The function 'HandleGET()' is a bit longer because it first computes -the maze and afterwards generates the VRML code that is sent across the -network. As shown in the STATIST example (*note STATIST::), we set the -type of the content to VRML and then store the VRML representation of -the maze as the page content. We assume that the maze is stored in a 2D -array. Initially, the maze consists of walls only. Then, we add an -entry and an exit to the maze and let the rest of the work be done by -the function 'MakeMaze()'. Now, only the wall fields are left in the -maze. By iterating over the these fields, we generate one line of VRML -code for each wall field. - - function HandleGET() { - if (MENU[2] == "AboutServer") { - Document = "If your browser has a VRML 2 plugin,\ - this server shows you a simple VRML scene." - } else if (MENU[2] == "VRMLtest") { - XSIZE = YSIZE = 11 # initially, everything is wall - for (y = 0; y < YSIZE; y++) - for (x = 0; x < XSIZE; x++) - Maze[x, y] = "#" - delete Maze[0, 1] # entry is not wall - delete Maze[XSIZE-1, YSIZE-2] # exit is not wall - MakeMaze(1, 1) - Document = "\ - #VRML V2.0 utf8\n\ - Group {\n\ - children [\n\ - PointLight {\n\ - ambientIntensity 0.2\n\ - color 0.7 0.7 0.7\n\ - location 0.0 8.0 10.0\n\ - }\n\ - DEF B1 Background {\n\ - skyColor [0 0 0, 1.0 1.0 1.0 ]\n\ - skyAngle 1.6\n\ - groundColor [1 1 1, 0.8 0.8 0.8, 0.2 0.2 0.2 ]\n\ - groundAngle [ 1.2 1.57 ]\n\ - }\n\ - DEF Wall Shape {\n\ - geometry Box {size 1 1 1}\n\ - appearance Appearance { material Material { diffuseColor 0 0 1 } }\n\ - }\n\ - DEF Entry Viewpoint {\n\ - position 0.5 1.0 5.0\n\ - orientation 0.0 0.0 -1.0 0.52\n\ - }\n" - for (i in Maze) { - split(i, t, SUBSEP) - Document = Document " Transform { translation " - Document = Document t[1] " 0 -" t[2] " children USE Wall }\n" - } - Document = Document " ] # end of group for world\n}" - Reason = "OK" ORS "Content-type: model/vrml" - Header = Footer = "" - } - } - - Finally, we have a look at 'MakeMaze()', the function that generates -the 'Maze' array. When entered, this function assumes that the array -has been initialized so that each element represents a wall element and -the maze is initially full of wall elements. Only the entrance and the -exit of the maze should have been left free. The parameters of the -function tell us which element must be marked as not being a wall. -After this, we take a look at the four neighboring elements and remember -which we have already treated. Of all the neighboring elements, we take -one at random and walk in that direction. Therefore, the wall element -in that direction has to be removed and then, we call the function -recursively for that element. The maze is only completed if we iterate -the above procedure for _all_ neighboring elements (in random order) and -for our present element by recursively calling the function for the -present element. This last iteration could have been done in a loop, -but it is done much simpler recursively. - - Notice that elements with coordinates that are both odd are assumed -to be on our way through the maze and the generating process cannot -terminate as long as there is such an element not being 'delete'd. All -other elements are potentially part of the wall. - - function MakeMaze(x, y) { - delete Maze[x, y] # here we are, we have no wall here - p = 0 # count unvisited fields in all directions - if (x-2 SUBSEP y in Maze) d[p++] = "-x" - if (x SUBSEP y-2 in Maze) d[p++] = "-y" - if (x+2 SUBSEP y in Maze) d[p++] = "+x" - if (x SUBSEP y+2 in Maze) d[p++] = "+y" - if (p>0) { # if there are unvisited fields, go there - p = int(p*rand()) # choose one unvisited field at random - if (d[p] == "-x") { delete Maze[x - 1, y]; MakeMaze(x - 2, y) - } else if (d[p] == "-y") { delete Maze[x, y - 1]; MakeMaze(x, y - 2) - } else if (d[p] == "+x") { delete Maze[x + 1, y]; MakeMaze(x + 2, y) - } else if (d[p] == "+y") { delete Maze[x, y + 1]; MakeMaze(x, y + 2) - } # we are back from recursion - MakeMaze(x, y); # try again while there are unvisited fields - } - } - - -File: gawkinet.info, Node: MOBAGWHO, Next: STOXPRED, Prev: MAZE, Up: Some Applications and Techniques - -3.8 MOBAGWHO: a Simple Mobile Agent -=================================== - - There are two ways of constructing a software design: One way is to - make it so simple that there are obviously no deficiencies, and the - other way is to make it so complicated that there are no obvious - deficiencies. - C. A. R. Hoare - - A "mobile agent" is a program that can be dispatched from a computer -and transported to a remote server for execution. This is called -"migration", which means that a process on another system is started -that is independent from its originator. Ideally, it wanders through a -network while working for its creator or owner. In places like the UMBC -Agent Web, people are quite confident that (mobile) agents are a -software engineering paradigm that enables us to significantly increase -the efficiency of our work. Mobile agents could become the mediators -between users and the networking world. For an unbiased view at this -technology, see the remarkable paper 'Mobile Agents: Are they a good -idea?'.(1) - - When trying to migrate a process from one system to another, a server -process is needed on the receiving side. Depending on the kind of -server process, several ways of implementation come to mind. How the -process is implemented depends upon the kind of server process: - - * HTTP can be used as the protocol for delivery of the migrating - process. In this case, we use a common web server as the receiving - server process. A universal CGI script mediates between migrating - process and web server. Each server willing to accept migrating - agents makes this universal service available. HTTP supplies the - 'POST' method to transfer some data to a file on the web server. - When a CGI script is called remotely with the 'POST' method instead - of the usual 'GET' method, data is transmitted from the client - process to the standard input of the server's CGI script. So, to - implement a mobile agent, we must not only write the agent program - to start on the client side, but also the CGI script to receive the - agent on the server side. - - * The 'PUT' method can also be used for migration. HTTP does not - require a CGI script for migration via 'PUT'. However, with common - web servers there is no advantage to this solution, because web - servers such as Apache require explicit activation of a special - 'PUT' script. - - * 'Agent Tcl' pursues a different course; it relies on a dedicated - server process with a dedicated protocol specialized for receiving - mobile agents. - - Our agent example abuses a common web server as a migration tool. -So, it needs a universal CGI script on the receiving side (the web -server). The receiving script is activated with a 'POST' request when -placed into a location like '/httpd/cgi-bin/PostAgent.sh'. Make sure -that the server system uses a version of 'gawk' that supports network -access (Version 3.1 or later; verify with 'gawk --version'). - - #!/bin/sh - MobAg=/tmp/MobileAgent.$$ - # direct script to mobile agent file - cat > $MobAg - # execute agent concurrently - gawk -f $MobAg $MobAg > /dev/null & - # HTTP header, terminator and body - gawk 'BEGIN { print "\r\nAgent started" }' - rm $MobAg # delete script file of agent - - By making its process id ('$$') part of the unique file name, the -script avoids conflicts between concurrent instances of the script. -First, all lines from standard input (the mobile agent's source code) -are copied into this unique file. Then, the agent is started as a -concurrent process and a short message reporting this fact is sent to -the submitting client. Finally, the script file of the mobile agent is -removed because it is no longer needed. Although it is a short script, -there are several noteworthy points: - -Security - _There is none_. In fact, the CGI script should never be made - available on a server that is part of the Internet because everyone - would be allowed to execute arbitrary commands with it. This - behavior is acceptable only when performing rapid prototyping. - -Self-Reference - Each migrating instance of an agent is started in a way that - enables it to read its own source code from standard input and use - the code for subsequent migrations. This is necessary because it - needs to treat the agent's code as data to transmit. 'gawk' is not - the ideal language for such a job. Lisp and Tcl are more suitable - because they do not make a distinction between program code and - data. - -Independence - After migration, the agent is not linked to its former home in any - way. By reporting 'Agent started', it waves "Goodbye" to its - origin. The originator may choose to terminate or not. - - The originating agent itself is started just like any other -command-line script, and reports the results on standard output. By -letting the name of the original host migrate with the agent, the agent -that migrates to a host far away from its origin can report the result -back home. Having arrived at the end of the journey, the agent -establishes a connection and reports the results. This is the reason -for determining the name of the host with 'uname -n' and storing it in -'MyOrigin' for later use. We may also set variables with the '-v' -option from the command line. This interactivity is only of importance -in the context of starting a mobile agent; therefore this 'BEGIN' -pattern and its action do not take part in migration: - - BEGIN { - if (ARGC != 2) { - print "MOBAG - a simple mobile agent" - print "CALL:\n gawk -f mobag.awk mobag.awk" - print "IN:\n the name of this script as a command-line parameter" - print "PARAM:\n -v MyOrigin=myhost.com" - print "OUT:\n the result on stdout" - print "JK 29.03.1998 01.04.1998" - exit - } - if (MyOrigin == "") { - "uname -n" | getline MyOrigin - close("uname -n") - } - } - - Since 'gawk' cannot manipulate and transmit parts of the program -directly, the source code is read and stored in strings. Therefore, the -program scans itself for the beginning and the ending of functions. -Each line in between is appended to the code string until the end of the -function has been reached. A special case is this part of the program -itself. It is not a function. Placing a similar framework around it -causes it to be treated like a function. Notice that this mechanism -works for all the functions of the source code, but it cannot guarantee -that the order of the functions is preserved during migration: - - #ReadMySelf - /^function / { FUNC = $2 } - /^END/ || /^#ReadMySelf/ { FUNC = $1 } - FUNC != "" { MOBFUN[FUNC] = MOBFUN[FUNC] RS $0 } - (FUNC != "") && (/^}/ || /^#EndOfMySelf/) \ - { FUNC = "" } - #EndOfMySelf - - The web server code in *note A Web Service with Interaction: -Interacting Service, was first developed as a site-independent core. -Likewise, the 'gawk'-based mobile agent starts with an agent-independent -core, to which can be appended application-dependent functions. What -follows is the only application-independent function needed for the -mobile agent: - - function migrate(Destination, MobCode, Label) { - MOBVAR["Label"] = Label - MOBVAR["Destination"] = Destination - RS = ORS = "\r\n" - HttpService = "/inet/tcp/0/" Destination - for (i in MOBFUN) - MobCode = (MobCode "\n" MOBFUN[i]) - MobCode = MobCode "\n\nBEGIN {" - for (i in MOBVAR) - MobCode = (MobCode "\n MOBVAR[\"" i "\"] = \"" MOBVAR[i] "\"") - MobCode = MobCode "\n}\n" - print "POST /cgi-bin/PostAgent.sh HTTP/1.0" |& HttpService - print "Content-length:", length(MobCode) ORS |& HttpService - printf "%s", MobCode |& HttpService - while ((HttpService |& getline) > 0) - print $0 - close(HttpService) - } - - The 'migrate()' function prepares the aforementioned strings -containing the program code and transmits them to a server. A -consequence of this modular approach is that the 'migrate()' function -takes some parameters that aren't needed in this application, but that -will be in future ones. Its mandatory parameter 'Destination' holds the -name (or IP address) of the server that the agent wants as a host for -its code. The optional parameter 'MobCode' may contain some 'gawk' code -that is inserted during migration in front of all other code. The -optional parameter 'Label' may contain a string that tells the agent -what to do in program execution after arrival at its new home site. One -of the serious obstacles in implementing a framework for mobile agents -is that it does not suffice to migrate the code. It is also necessary -to migrate the state of execution of the agent. In contrast to 'Agent -Tcl', this program does not try to migrate the complete set of -variables. The following conventions are used: - - * Each variable in an agent program is local to the current host and - does _not_ migrate. - - * The array 'MOBFUN' shown above is an exception. It is handled by - the function 'migrate()' and does migrate with the application. - - * The other exception is the array 'MOBVAR'. Each variable that - takes part in migration has to be an element of this array. - 'migrate()' also takes care of this. - - Now it's clear what happens to the 'Label' parameter of the function -'migrate()'. It is copied into 'MOBVAR["Label"]' and travels alongside -the other data. Since travelling takes place via HTTP, records must be -separated with '"\r\n"' in 'RS' and 'ORS' as usual. The code assembly -for migration takes place in three steps: - - * Iterate over 'MOBFUN' to collect all functions verbatim. - - * Prepare a 'BEGIN' pattern and put assignments to mobile variables - into the action part. - - * Transmission itself resembles GETURL: the header with the request - and the 'Content-length' is followed by the body. In case there is - any reply over the network, it is read completely and echoed to - standard output to avoid irritating the server. - - The application-independent framework is now almost complete. What -follows is the 'END' pattern that is executed when the mobile agent has -finished reading its own code. First, it checks whether it is already -running on a remote host or not. In case initialization has not yet -taken place, it starts 'MyInit()'. Otherwise (later, on a remote host), -it starts 'MyJob()': - - END { - if (ARGC != 2) exit # stop when called with wrong parameters - if (MyOrigin != "") # is this the originating host? - MyInit() # if so, initialize the application - else # we are on a host with migrated data - MyJob() # so we do our job - } - - All that's left to extend the framework into a complete application -is to write two application-specific functions: 'MyInit()' and -'MyJob()'. Keep in mind that the former is executed once on the -originating host, while the latter is executed after each migration: - - function MyInit() { - MOBVAR["MyOrigin"] = MyOrigin - MOBVAR["Machines"] = "localhost/80 max/80 moritz/80 castor/80" - split(MOBVAR["Machines"], Machines) # which host is the first? - migrate(Machines[1], "", "") # go to the first host - while (("/inet/tcp/8080/0/0" |& getline) > 0) # wait for result - print $0 # print result - close("/inet/tcp/8080/0/0") - } - - As mentioned earlier, this agent takes the name of its origin -('MyOrigin') with it. Then, it takes the name of its first destination -and goes there for further work. Notice that this name has the port -number of the web server appended to the name of the server, because the -function 'migrate()' needs it this way to create the 'HttpService' -variable. Finally, it waits for the result to arrive. The 'MyJob()' -function runs on the remote host: - - function MyJob() { - # forget this host - sub(MOBVAR["Destination"], "", MOBVAR["Machines"]) - MOBVAR["Result"]=MOBVAR["Result"] SUBSEP SUBSEP MOBVAR["Destination"] ":" - while (("who" | getline) > 0) # who is logged in? - MOBVAR["Result"] = MOBVAR["Result"] SUBSEP $0 - close("who") - if (index(MOBVAR["Machines"], "/") > 0) { # any more machines to visit? - split(MOBVAR["Machines"], Machines) # which host is next? - migrate(Machines[1], "", "") # go there - } else { # no more machines - gsub(SUBSEP, "\n", MOBVAR["Result"]) # send result to origin - print MOBVAR["Result"] |& "/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080" - close("/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080") - } - } - - After migrating, the first thing to do in 'MyJob()' is to delete the -name of the current host from the list of hosts to visit. Now, it is -time to start the real work by appending the host's name to the result -string, and reading line by line who is logged in on this host. A very -annoying circumstance is the fact that the elements of 'MOBVAR' cannot -hold the newline character ('"\n"'). If they did, migration of this -string did not work because the string didn't obey the syntax rule for a -string in 'gawk'. 'SUBSEP' is used as a temporary replacement. If the -list of hosts to visit holds at least one more entry, the agent migrates -to that place to go on working there. Otherwise, we replace the -'SUBSEP's with a newline character in the resulting string, and report -it to the originating host, whose name is stored in -'MOBVAR["MyOrigin"]'. - - ---------- Footnotes ---------- - - (1) <http://www.research.ibm.com/massive/mobag.ps> - - -File: gawkinet.info, Node: STOXPRED, Next: PROTBASE, Prev: MOBAGWHO, Up: Some Applications and Techniques - -3.9 STOXPRED: Stock Market Prediction As A Service -================================================== - - Far out in the uncharted backwaters of the unfashionable end of the - Western Spiral arm of the Galaxy lies a small unregarded yellow - sun. - - Orbiting this at a distance of roughly ninety-two million miles is - an utterly insignificant little blue-green planet whose - ape-descendent life forms are so amazingly primitive that they - still think digital watches are a pretty neat idea. - - This planet has -- or rather had -- a problem, which was this: most - of the people living on it were unhappy for pretty much of the - time. Many solutions were suggested for this problem, but most of - these were largely concerned with the movements of small green - pieces of paper, which is odd because it wasn't the small green - pieces of paper that were unhappy. - Douglas Adams, 'The Hitch Hiker's Guide to the Galaxy' - - Valuable services on the Internet are usually _not_ implemented as -mobile agents. There are much simpler ways of implementing services. -All Unix systems provide, for example, the 'cron' service. Unix system -users can write a list of tasks to be done each day, each week, twice a -day, or just once. The list is entered into a file named 'crontab'. -For example, to distribute a newsletter on a daily basis this way, use -'cron' for calling a script each day early in the morning. - - # run at 8 am on weekdays, distribute the newsletter - 0 8 * * 1-5 $HOME/bin/daily.job >> $HOME/log/newsletter 2>&1 - - The script first looks for interesting information on the Internet, -assembles it in a nice form and sends the results via email to the -customers. - - The following is an example of a primitive newsletter on stock market -prediction. It is a report which first tries to predict the change of -each share in the Dow Jones Industrial Index for the particular day. -Then it mentions some especially promising shares as well as some shares -which look remarkably bad on that day. The report ends with the usual -disclaimer which tells every child _not_ to try this at home and hurt -anybody. - - Good morning Uncle Scrooge, - - This is your daily stock market report for Monday, October 16, 2000. - Here are the predictions for today: - - AA neutral - GE up - JNJ down - MSFT neutral - ... - UTX up - DD down - IBM up - MO down - WMT up - DIS up - INTC up - MRK down - XOM down - EK down - IP down - - The most promising shares for today are these: - - INTC http://biz.yahoo.com/n/i/intc.html - - The stock shares to avoid today are these: - - EK http://biz.yahoo.com/n/e/ek.html - IP http://biz.yahoo.com/n/i/ip.html - DD http://biz.yahoo.com/n/d/dd.html - ... - - The script as a whole is rather long. In order to ease the pain of -studying other people's source code, we have broken the script up into -meaningful parts which are invoked one after the other. The basic -structure of the script is as follows: - - BEGIN { - Init() - ReadQuotes() - CleanUp() - Prediction() - Report() - SendMail() - } - - The earlier parts store data into variables and arrays which are -subsequently used by later parts of the script. The 'Init()' function -first checks if the script is invoked correctly (without any -parameters). If not, it informs the user of the correct usage. What -follows are preparations for the retrieval of the historical quote data. -The names of the 30 stock shares are stored in an array 'name' along -with the current date in 'day', 'month', and 'year'. - - All users who are separated from the Internet by a firewall and have -to direct their Internet accesses to a proxy must supply the name of the -proxy to this script with the '-v Proxy=NAME' option. For most users, -the default proxy and port number should suffice. - - function Init() { - if (ARGC != 1) { - print "STOXPRED - daily stock share prediction" - print "IN:\n no parameters, nothing on stdin" - print "PARAM:\n -v Proxy=MyProxy -v ProxyPort=80" - print "OUT:\n commented predictions as email" - print "JK 09.10.2000" - exit - } - # Remember ticker symbols from Dow Jones Industrial Index - StockCount = split("AA GE JNJ MSFT AXP GM JPM PG BA HD KO \ - SBC C HON MCD T CAT HWP MMM UTX DD IBM MO WMT DIS INTC \ - MRK XOM EK IP", name); - # Remember the current date as the end of the time series - day = strftime("%d") - month = strftime("%m") - year = strftime("%Y") - if (Proxy == "") Proxy = "chart.yahoo.com" - if (ProxyPort == 0) ProxyPort = 80 - YahooData = "/inet/tcp/0/" Proxy "/" ProxyPort - } - - There are two really interesting parts in the script. One is the -function which reads the historical stock quotes from an Internet -server. The other is the one that does the actual prediction. In the -following function we see how the quotes are read from the Yahoo server. -The data which comes from the server is in CSV format (comma-separated -values): - - Date,Open,High,Low,Close,Volume - 9-Oct-00,22.75,22.75,21.375,22.375,7888500 - 6-Oct-00,23.8125,24.9375,21.5625,22,10701100 - 5-Oct-00,24.4375,24.625,23.125,23.50,5810300 - - Lines contain values of the same time instant, whereas columns are -separated by commas and contain the kind of data that is described in -the header (first) line. At first, 'gawk' is instructed to separate -columns by commas ('FS = ","'). In the loop that follows, a connection -to the Yahoo server is first opened, then a download takes place, and -finally the connection is closed. All this happens once for each ticker -symbol. In the body of this loop, an Internet address is built up as a -string according to the rules of the Yahoo server. The starting and -ending date are chosen to be exactly the same, but one year apart in the -past. All the action is initiated within the 'printf' command which -transmits the request for data to the Yahoo server. - - In the inner loop, the server's data is first read and then scanned -line by line. Only lines which have six columns and the name of a month -in the first column contain relevant data. This data is stored in the -two-dimensional array 'quote'; one dimension being time, the other being -the ticker symbol. During retrieval of the first stock's data, the -calendar names of the time instances are stored in the array 'day' -because we need them later. - - function ReadQuotes() { - # Retrieve historical data for each ticker symbol - FS = "," - for (stock = 1; stock <= StockCount; stock++) { - URL = "http://chart.yahoo.com/table.csv?s=" name[stock] \ - "&a=" month "&b=" day "&c=" year-1 \ - "&d=" month "&e=" day "&f=" year \ - "g=d&q=q&y=0&z=" name[stock] "&x=.csv" - printf("GET " URL " HTTP/1.0\r\n\r\n") |& YahooData - while ((YahooData |& getline) > 0) { - if (NF == 6 && $1 ~ /Jan|Feb|Mar|Apr|May|Jun|Jul|Aug|Sep|Oct|Nov|Dec/) { - if (stock == 1) - days[++daycount] = $1; - quote[$1, stock] = $5 - } - } - close(YahooData) - } - FS = " " - } - - Now that we _have_ the data, it can be checked once again to make -sure that no individual stock is missing or invalid, and that all the -stock quotes are aligned correctly. Furthermore, we renumber the time -instances. The most recent day gets day number 1 and all other days get -consecutive numbers. All quotes are rounded toward the nearest whole -number in US Dollars. - - function CleanUp() { - # clean up time series; eliminate incomplete data sets - for (d = 1; d <= daycount; d++) { - for (stock = 1; stock <= StockCount; stock++) - if (! ((days[d], stock) in quote)) - stock = StockCount + 10 - if (stock > StockCount + 1) - continue - datacount++ - for (stock = 1; stock <= StockCount; stock++) - data[datacount, stock] = int(0.5 + quote[days[d], stock]) - } - delete quote - delete days - } - - Now we have arrived at the second really interesting part of the -whole affair. What we present here is a very primitive prediction -algorithm: _If a stock fell yesterday, assume it will also fall today; -if it rose yesterday, assume it will rise today_. (Feel free to replace -this algorithm with a smarter one.) If a stock changed in the same -direction on two consecutive days, this is an indication which should be -highlighted. Two-day advances are stored in 'hot' and two-day declines -in 'avoid'. - - The rest of the function is a sanity check. It counts the number of -correct predictions in relation to the total number of predictions one -could have made in the year before. - - function Prediction() { - # Predict each ticker symbol by prolonging yesterday's trend - for (stock = 1; stock <= StockCount; stock++) { - if (data[1, stock] > data[2, stock]) { - predict[stock] = "up" - } else if (data[1, stock] < data[2, stock]) { - predict[stock] = "down" - } else { - predict[stock] = "neutral" - } - if ((data[1, stock] > data[2, stock]) && (data[2, stock] > data[3, stock])) - hot[stock] = 1 - if ((data[1, stock] < data[2, stock]) && (data[2, stock] < data[3, stock])) - avoid[stock] = 1 - } - # Do a plausibility check: how many predictions proved correct? - for (s = 1; s <= StockCount; s++) { - for (d = 1; d <= datacount-2; d++) { - if (data[d+1, s] > data[d+2, s]) { - UpCount++ - } else if (data[d+1, s] < data[d+2, s]) { - DownCount++ - } else { - NeutralCount++ - } - if (((data[d, s] > data[d+1, s]) && (data[d+1, s] > data[d+2, s])) || - ((data[d, s] < data[d+1, s]) && (data[d+1, s] < data[d+2, s])) || - ((data[d, s] == data[d+1, s]) && (data[d+1, s] == data[d+2, s]))) - CorrectCount++ - } - } - } - - At this point the hard work has been done: the array 'predict' -contains the predictions for all the ticker symbols. It is up to the -function 'Report()' to find some nice words to introduce the desired -information. - - function Report() { - # Generate report - report = "\nThis is your daily " - report = report "stock market report for "strftime("%A, %B %d, %Y")".\n" - report = report "Here are the predictions for today:\n\n" - for (stock = 1; stock <= StockCount; stock++) - report = report "\t" name[stock] "\t" predict[stock] "\n" - for (stock in hot) { - if (HotCount++ == 0) - report = report "\nThe most promising shares for today are these:\n\n" - report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \ - tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n" - } - for (stock in avoid) { - if (AvoidCount++ == 0) - report = report "\nThe stock shares to avoid today are these:\n\n" - report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \ - tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n" - } - report = report "\nThis sums up to " HotCount+0 " winners and " AvoidCount+0 - report = report " losers. When using this kind\nof prediction scheme for" - report = report " the 12 months which lie behind us,\nwe get " UpCount - report = report " 'ups' and " DownCount " 'downs' and " NeutralCount - report = report " 'neutrals'. Of all\nthese " UpCount+DownCount+NeutralCount - report = report " predictions " CorrectCount " proved correct next day.\n" - report = report "A success rate of "\ - int(100*CorrectCount/(UpCount+DownCount+NeutralCount)) "%.\n" - report = report "Random choice would have produced a 33% success rate.\n" - report = report "Disclaimer: Like every other prediction of the stock\n" - report = report "market, this report is, of course, complete nonsense.\n" - report = report "If you are stupid enough to believe these predictions\n" - report = report "you should visit a doctor who can treat your ailment." - } - - The function 'SendMail()' goes through the list of customers and -opens a pipe to the 'mail' command for each of them. Each one receives -an email message with a proper subject heading and is addressed with his -full name. - - function SendMail() { - # send report to customers - customer["uncle.scrooge@ducktown.gov"] = "Uncle Scrooge" - customer["more@utopia.org" ] = "Sir Thomas More" - customer["spinoza@denhaag.nl" ] = "Baruch de Spinoza" - customer["marx@highgate.uk" ] = "Karl Marx" - customer["keynes@the.long.run" ] = "John Maynard Keynes" - customer["bierce@devil.hell.org" ] = "Ambrose Bierce" - customer["laplace@paris.fr" ] = "Pierre Simon de Laplace" - for (c in customer) { - MailPipe = "mail -s 'Daily Stock Prediction Newsletter'" c - print "Good morning " customer[c] "," | MailPipe - print report "\n.\n" | MailPipe - close(MailPipe) - } - } - - Be patient when running the script by hand. Retrieving the data for -all the ticker symbols and sending the emails may take several minutes -to complete, depending upon network traffic and the speed of the -available Internet link. The quality of the prediction algorithm is -likely to be disappointing. Try to find a better one. Should you find -one with a success rate of more than 50%, please tell us about it! It -is only for the sake of curiosity, of course. ':-)' - - -File: gawkinet.info, Node: PROTBASE, Prev: STOXPRED, Up: Some Applications and Techniques - -3.10 PROTBASE: Searching Through A Protein Database -=================================================== - - Hoare's Law of Large Problems: Inside every large problem is a - small problem struggling to get out. - - Yahoo's database of stock market data is just one among the many -large databases on the Internet. Another one is located at NCBI -(National Center for Biotechnology Information). Established in 1988 as -a national resource for molecular biology information, NCBI creates -public databases, conducts research in computational biology, develops -software tools for analyzing genome data, and disseminates biomedical -information. In this section, we look at one of NCBI's public services, -which is called BLAST (Basic Local Alignment Search Tool). - - You probably know that the information necessary for reproducing -living cells is encoded in the genetic material of the cells. The -genetic material is a very long chain of four base nucleotides. It is -the order of appearance (the sequence) of nucleotides which contains the -information about the substance to be produced. Scientists in -biotechnology often find a specific fragment, determine the nucleotide -sequence, and need to know where the sequence at hand comes from. This -is where the large databases enter the game. At NCBI, databases store -the knowledge about which sequences have ever been found and where they -have been found. When the scientist sends his sequence to the BLAST -service, the server looks for regions of genetic material in its -database which look the most similar to the delivered nucleotide -sequence. After a search time of some seconds or minutes the server -sends an answer to the scientist. In order to make access simple, NCBI -chose to offer their database service through popular Internet -protocols. There are four basic ways to use the so-called BLAST -services: - - * The easiest way to use BLAST is through the web. Users may simply - point their browsers at the NCBI home page and link to the BLAST - pages. NCBI provides a stable URL that may be used to perform - BLAST searches without interactive use of a web browser. This is - what we will do later in this section. A demonstration client and - a 'README' file demonstrate how to access this URL. - - * Currently, 'blastcl3' is the standard network BLAST client. You - can download 'blastcl3' from the anonymous FTP location. - - * BLAST 2.0 can be run locally as a full executable and can be used - to run BLAST searches against private local databases, or - downloaded copies of the NCBI databases. BLAST 2.0 executables may - be found on the NCBI anonymous FTP server. - - * The NCBI BLAST Email server is the best option for people without - convenient access to the web. A similarity search can be performed - by sending a properly formatted mail message containing the - nucleotide or protein query sequence to <blast@ncbi.nlm.nih.gov>. - The query sequence is compared against the specified database using - the BLAST algorithm and the results are returned in an email - message. For more information on formulating email BLAST searches, - you can send a message consisting of the word "HELP" to the same - address, <blast@ncbi.nlm.nih.gov>. - - Our starting point is the demonstration client mentioned in the first -option. The 'README' file that comes along with the client explains the -whole process in a nutshell. In the rest of this section, we first show -what such requests look like. Then we show how to use 'gawk' to -implement a client in about 10 lines of code. Finally, we show how to -interpret the result returned from the service. - - Sequences are expected to be represented in the standard IUB/IUPAC -amino acid and nucleic acid codes, with these exceptions: lower-case -letters are accepted and are mapped into upper-case; a single hyphen or -dash can be used to represent a gap of indeterminate length; and in -amino acid sequences, 'U' and '*' are acceptable letters (see below). -Before submitting a request, any numerical digits in the query sequence -should either be removed or replaced by appropriate letter codes (e.g., -'N' for unknown nucleic acid residue or 'X' for unknown amino acid -residue). The nucleic acid codes supported are: - - A --> adenosine M --> A C (amino) - C --> cytidine S --> G C (strong) - G --> guanine W --> A T (weak) - T --> thymidine B --> G T C - U --> uridine D --> G A T - R --> G A (purine) H --> A C T - Y --> T C (pyrimidine) V --> G C A - K --> G T (keto) N --> A G C T (any) - - gap of indeterminate length - - Now you know the alphabet of nucleotide sequences. The last two -lines of the following example query show you such a sequence, which is -obviously made up only of elements of the alphabet just described. -Store this example query into a file named 'protbase.request'. You are -now ready to send it to the server with the demonstration client. - - PROGRAM blastn - DATALIB month - EXPECT 0.75 - BEGIN - >GAWK310 the gawking gene GNU AWK - tgcttggctgaggagccataggacgagagcttcctggtgaagtgtgtttcttgaaatcat - caccaccatggacagcaaa - - The actual search request begins with the mandatory parameter -'PROGRAM' in the first column followed by the value 'blastn' (the name -of the program) for searching nucleic acids. The next line contains the -mandatory search parameter 'DATALIB' with the value 'month' for the -newest nucleic acid sequences. The third line contains an optional -'EXPECT' parameter and the value desired for it. The fourth line -contains the mandatory 'BEGIN' directive, followed by the query sequence -in FASTA/Pearson format. Each line of information must be less than 80 -characters in length. - - The "month" database contains all new or revised sequences released -in the last 30 days and is useful for searching against new sequences. -There are five different blast programs, 'blastn' being the one that -compares a nucleotide query sequence against a nucleotide sequence -database. - - The last server directive that must appear in every request is the -'BEGIN' directive. The query sequence should immediately follow the -'BEGIN' directive and must appear in FASTA/Pearson format. A sequence -in FASTA/Pearson format begins with a single-line description. The -description line, which is required, is distinguished from the lines of -sequence data that follow it by having a greater-than ('>') symbol in -the first column. For the purposes of the BLAST server, the text of the -description is arbitrary. - - If you prefer to use a client written in 'gawk', just store the -following 10 lines of code into a file named 'protbase.awk' and use this -client instead. Invoke it with 'gawk -f protbase.awk protbase.request'. -Then wait a minute and watch the result coming in. In order to -replicate the demonstration client's behavior as closely as possible, -this client does not use a proxy server. We could also have extended -the client program in *note Retrieving Web Pages: GETURL, to implement -the client request from 'protbase.awk' as a special case. - - { request = request "\n" $0 } - - END { - BLASTService = "/inet/tcp/0/www.ncbi.nlm.nih.gov/80" - printf "POST /cgi-bin/BLAST/nph-blast_report HTTP/1.0\n" |& BLASTService - printf "Content-Length: " length(request) "\n\n" |& BLASTService - printf request |& BLASTService - while ((BLASTService |& getline) > 0) - print $0 - close(BLASTService) - } - - The demonstration client from NCBI is 214 lines long (written in C) -and it is not immediately obvious what it does. Our client is so short -that it _is_ obvious what it does. First it loops over all lines of the -query and stores the whole query into a variable. Then the script -establishes an Internet connection to the NCBI server and transmits the -query by framing it with a proper HTTP request. Finally it receives and -prints the complete result coming from the server. - - Now, let us look at the result. It begins with an HTTP header, which -you can ignore. Then there are some comments about the query having -been filtered to avoid spuriously high scores. After this, there is a -reference to the paper that describes the software being used for -searching the data base. After a repetition of the original query's -description we find the list of significant alignments: - - Sequences producing significant alignments: (bits) Value - - gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733... 38 0.20 - gb|AC021056.12|AC021056 Homo sapiens chromosome 3 clone RP11-115... 38 0.20 - emb|AL160278.10|AL160278 Homo sapiens chromosome 9 clone RP11-57... 38 0.20 - emb|AL391139.11|AL391139 Homo sapiens chromosome X clone RP11-35... 38 0.20 - emb|AL365192.6|AL365192 Homo sapiens chromosome 6 clone RP3-421H... 38 0.20 - emb|AL138812.9|AL138812 Homo sapiens chromosome 11 clone RP1-276... 38 0.20 - gb|AC073881.3|AC073881 Homo sapiens chromosome 15 clone CTD-2169... 38 0.20 - - This means that the query sequence was found in seven human -chromosomes. But the value 0.20 (20%) means that the probability of an -accidental match is rather high (20%) in all cases and should be taken -into account. You may wonder what the first column means. It is a key -to the specific database in which this occurrence was found. The unique -sequence identifiers reported in the search results can be used as -sequence retrieval keys via the NCBI server. The syntax of sequence -header lines used by the NCBI BLAST server depends on the database from -which each sequence was obtained. The table below lists the identifiers -for the databases from which the sequences were derived. - - Database Name Identifier Syntax - ============================ ======================== - GenBank gb|accession|locus - EMBL Data Library emb|accession|locus - DDBJ, DNA Database of Japan dbj|accession|locus - NBRF PIR pir||entry - Protein Research Foundation prf||name - SWISS-PROT sp|accession|entry name - Brookhaven Protein Data Bank pdb|entry|chain - Kabat's Sequences of Immuno... gnl|kabat|identifier - Patents pat|country|number - GenInfo Backbone Id bbs|number - - For example, an identifier might be 'gb|AC021182.14|AC021182', where -the 'gb' tag indicates that the identifier refers to a GenBank sequence, -'AC021182.14' is its GenBank ACCESSION, and 'AC021182' is the GenBank -LOCUS. The identifier contains no spaces, so that a space indicates the -end of the identifier. - - Let us continue in the result listing. Each of the seven alignments -mentioned above is subsequently described in detail. We will have a -closer look at the first of them. - - >gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733N23, WORKING DRAFT SEQUENCE, 4 - unordered pieces - Length = 176383 - - Score = 38.2 bits (19), Expect = 0.20 - Identities = 19/19 (100%) - Strand = Plus / Plus - - Query: 35 tggtgaagtgtgtttcttg 53 - ||||||||||||||||||| - Sbjct: 69786 tggtgaagtgtgtttcttg 69804 - - This alignment was located on the human chromosome 7. The fragment -on which part of the query was found had a total length of 176383. Only -19 of the nucleotides matched and the matching sequence ran from -character 35 to 53 in the query sequence and from 69786 to 69804 in the -fragment on chromosome 7. If you are still reading at this point, you -are probably interested in finding out more about Computational Biology -and you might appreciate the following hints. - - 1. There is a book called 'Introduction to Computational Biology' by - Michael S. Waterman, which is worth reading if you are seriously - interested. You can find a good book review on the Internet. - - 2. While Waterman's book can explain to you the algorithms employed - internally in the database search engines, most practitioners - prefer to approach the subject differently. The applied side of - Computational Biology is called Bioinformatics, and emphasizes the - tools available for day-to-day work as well as how to actually - _use_ them. One of the very few affordable books on Bioinformatics - is 'Developing Bioinformatics Computer Skills'. - - 3. The sequences _gawk_ and _gnuawk_ are in widespread use in the - genetic material of virtually every earthly living being. Let us - take this as a clear indication that the divine creator has - intended 'gawk' to prevail over other scripting languages such as - 'perl', 'tcl', or 'python' which are not even proper sequences. - (:-) - - -File: gawkinet.info, Node: Links, Next: GNU Free Documentation License, Prev: Some Applications and Techniques, Up: Top - -4 Related Links -*************** - -This section lists the URLs for various items discussed in this major -node. They are presented in the order in which they appear. - -'Internet Programming with Python' - <http://www.fsbassociates.com/books/python.htm> - -'Advanced Perl Programming' - <http://www.oreilly.com/catalog/advperl> - -'Web Client Programming with Perl' - <http://www.oreilly.com/catalog/webclient> - -Richard Stevens's home page and book - <http://www.kohala.com/~rstevens> - -The SPAK home page - <http://www.userfriendly.net/linux/RPM/contrib/libc6/i386/spak-0.6b-1.i386.html> - -Volume III of 'Internetworking with TCP/IP', by Comer and Stevens - <http://www.cs.purdue.edu/homes/dec/tcpip3s.cont.html> - -XBM Graphics File Format - <http://www.wotsit.org/download.asp?f=xbm> - -GNUPlot - <http://www.cs.dartmouth.edu/gnuplot_info.html> - -Mark Humphrys' Eliza page - <http://www.compapp.dcu.ie/~humphrys/eliza.html> - -Yahoo! Eliza Information - <http://dir.yahoo.com/Recreation/Games/Computer_Games/Internet_Games/Web_Games/Artificial_Intelligence> - -Java versions of Eliza - <http://www.tjhsst.edu/Psych/ch1/eliza.html> - -Java versions of Eliza with source code - <http://home.adelphia.net/~lifeisgood/eliza/eliza.htm> - -Eliza Programs with Explanations - <http://chayden.net/chayden/eliza/Eliza.shtml> - -Loebner Contest - <http://acm.org/~loebner/loebner-prize.htmlx> - -Tck/Tk Information - <http://www.scriptics.com/> - -Intel 80x86 Processors - <http://developer.intel.com/design/platform/embedpc/what_is.htm> - -AMD Elan Processors - <http://www.amd.com/products/epd/processors/4.32bitcont/32bitcont/index.html> - -XINU - <http://willow.canberra.edu.au/~chrisc/xinu.html> - -GNU/Linux - <http://uclinux.lineo.com/> - -Embedded PCs - <http://dir.yahoo.com/Business_and_Economy/Business_to_Business/Computers/Hardware/Embedded_Control/> - -MiniSQL - <http://www.hughes.com.au/library/> - -Market Share Surveys - <http://www.netcraft.com/survey> - -'Numerical Recipes in C: The Art of Scientific Computing' - <http://www.nr.com> - -VRML - <http://www.vrml.org> - -The VRML FAQ - <http://www.vrml.org/technicalinfo/specifications/specifications.htm#FAQ> - -The UMBC Agent Web - <http://www.cs.umbc.edu/agents> - -Apache Web Server - <http://www.apache.org> - -National Center for Biotechnology Information (NCBI) - <http://www.ncbi.nlm.nih.gov> - -Basic Local Alignment Search Tool (BLAST) - <http://www.ncbi.nlm.nih.gov/BLAST/blast_overview.html> - -NCBI Home Page - <http://www.ncbi.nlm.nih.gov> - -BLAST Pages - <http://www.ncbi.nlm.nih.gov/BLAST> - -BLAST Demonstration Client - <ftp://ncbi.nlm.nih.gov/blast/blasturl/> - -BLAST anonymous FTP location - <ftp://ncbi.nlm.nih.gov/blast/network/netblast/> - -BLAST 2.0 Executables - <ftp://ncbi.nlm.nih.gov/blast/executables/> - -IUB/IUPAC Amino Acid and Nucleic Acid Codes - <http://www.uthscsa.edu/geninfo/blastmail.html#item6> - -FASTA/Pearson Format - <http://www.ncbi.nlm.nih.gov/BLAST/fasta.html> - -Fasta/Pearson Sequence in Java - <http://www.kazusa.or.jp/java/codon_table_java/> - -Book Review of 'Introduction to Computational Biology' - <http://www.acm.org/crossroads/xrds5-1/introcb.html> - -'Developing Bioinformatics Computer Skills' - <http://www.oreilly.com/catalog/bioskills/> - - -File: gawkinet.info, Node: GNU Free Documentation License, Next: Index, Prev: Links, Up: Top - -GNU Free Documentation License -****************************** - - Version 1.3, 3 November 2008 - - Copyright (C) 2000, 2001, 2002, 2007, 2008 Free Software Foundation, Inc. - <http://fsf.org/> - - Everyone is permitted to copy and distribute verbatim copies - of this license document, but changing it is not allowed. - - 0. PREAMBLE - - The purpose of this License is to make a manual, textbook, or other - functional and useful document "free" in the sense of freedom: to - assure everyone the effective freedom to copy and redistribute it, - with or without modifying it, either commercially or - noncommercially. Secondarily, this License preserves for the - author and publisher a way to get credit for their work, while not - being considered responsible for modifications made by others. - - This License is a kind of "copyleft", which means that derivative - works of the document must themselves be free in the same sense. - It complements the GNU General Public License, which is a copyleft - license designed for free software. - - We have designed this License in order to use it for manuals for - free software, because free software needs free documentation: a - free program should come with manuals providing the same freedoms - that the software does. But this License is not limited to - software manuals; it can be used for any textual work, regardless - of subject matter or whether it is published as a printed book. We - recommend this License principally for works whose purpose is - instruction or reference. - - 1. APPLICABILITY AND DEFINITIONS - - This License applies to any manual or other work, in any medium, - that contains a notice placed by the copyright holder saying it can - be distributed under the terms of this License. Such a notice - grants a world-wide, royalty-free license, unlimited in duration, - to use that work under the conditions stated herein. The - "Document", below, refers to any such manual or work. Any member - of the public is a licensee, and is addressed as "you". You accept - the license if you copy, modify or distribute the work in a way - requiring permission under copyright law. - - A "Modified Version" of the Document means any work containing the - Document or a portion of it, either copied verbatim, or with - modifications and/or translated into another language. - - A "Secondary Section" is a named appendix or a front-matter section - of the Document that deals exclusively with the relationship of the - publishers or authors of the Document to the Document's overall - subject (or to related matters) and contains nothing that could - fall directly within that overall subject. (Thus, if the Document - is in part a textbook of mathematics, a Secondary Section may not - explain any mathematics.) The relationship could be a matter of - historical connection with the subject or with related matters, or - of legal, commercial, philosophical, ethical or political position - regarding them. - - The "Invariant Sections" are certain Secondary Sections whose - titles are designated, as being those of Invariant Sections, in the - notice that says that the Document is released under this License. - If a section does not fit the above definition of Secondary then it - is not allowed to be designated as Invariant. The Document may - contain zero Invariant Sections. If the Document does not identify - any Invariant Sections then there are none. - - The "Cover Texts" are certain short passages of text that are - listed, as Front-Cover Texts or Back-Cover Texts, in the notice - that says that the Document is released under this License. A - Front-Cover Text may be at most 5 words, and a Back-Cover Text may - be at most 25 words. - - A "Transparent" copy of the Document means a machine-readable copy, - represented in a format whose specification is available to the - general public, that is suitable for revising the document - straightforwardly with generic text editors or (for images composed - of pixels) generic paint programs or (for drawings) some widely - available drawing editor, and that is suitable for input to text - formatters or for automatic translation to a variety of formats - suitable for input to text formatters. A copy made in an otherwise - Transparent file format whose markup, or absence of markup, has - been arranged to thwart or discourage subsequent modification by - readers is not Transparent. An image format is not Transparent if - used for any substantial amount of text. A copy that is not - "Transparent" is called "Opaque". - - Examples of suitable formats for Transparent copies include plain - ASCII without markup, Texinfo input format, LaTeX input format, - SGML or XML using a publicly available DTD, and standard-conforming - simple HTML, PostScript or PDF designed for human modification. - Examples of transparent image formats include PNG, XCF and JPG. - Opaque formats include proprietary formats that can be read and - edited only by proprietary word processors, SGML or XML for which - the DTD and/or processing tools are not generally available, and - the machine-generated HTML, PostScript or PDF produced by some word - processors for output purposes only. - - The "Title Page" means, for a printed book, the title page itself, - plus such following pages as are needed to hold, legibly, the - material this License requires to appear in the title page. For - works in formats which do not have any title page as such, "Title - Page" means the text near the most prominent appearance of the - work's title, preceding the beginning of the body of the text. - - The "publisher" means any person or entity that distributes copies - of the Document to the public. - - A section "Entitled XYZ" means a named subunit of the Document - whose title either is precisely XYZ or contains XYZ in parentheses - following text that translates XYZ in another language. (Here XYZ - stands for a specific section name mentioned below, such as - "Acknowledgements", "Dedications", "Endorsements", or "History".) - To "Preserve the Title" of such a section when you modify the - Document means that it remains a section "Entitled XYZ" according - to this definition. - - The Document may include Warranty Disclaimers next to the notice - which states that this License applies to the Document. These - Warranty Disclaimers are considered to be included by reference in - this License, but only as regards disclaiming warranties: any other - implication that these Warranty Disclaimers may have is void and - has no effect on the meaning of this License. - - 2. VERBATIM COPYING - - You may copy and distribute the Document in any medium, either - commercially or noncommercially, provided that this License, the - copyright notices, and the license notice saying this License - applies to the Document are reproduced in all copies, and that you - add no other conditions whatsoever to those of this License. You - may not use technical measures to obstruct or control the reading - or further copying of the copies you make or distribute. However, - you may accept compensation in exchange for copies. If you - distribute a large enough number of copies you must also follow the - conditions in section 3. - - You may also lend copies, under the same conditions stated above, - and you may publicly display copies. - - 3. COPYING IN QUANTITY - - If you publish printed copies (or copies in media that commonly - have printed covers) of the Document, numbering more than 100, and - the Document's license notice requires Cover Texts, you must - enclose the copies in covers that carry, clearly and legibly, all - these Cover Texts: Front-Cover Texts on the front cover, and - Back-Cover Texts on the back cover. Both covers must also clearly - and legibly identify you as the publisher of these copies. The - front cover must present the full title with all words of the title - equally prominent and visible. You may add other material on the - covers in addition. Copying with changes limited to the covers, as - long as they preserve the title of the Document and satisfy these - conditions, can be treated as verbatim copying in other respects. - - If the required texts for either cover are too voluminous to fit - legibly, you should put the first ones listed (as many as fit - reasonably) on the actual cover, and continue the rest onto - adjacent pages. - - If you publish or distribute Opaque copies of the Document - numbering more than 100, you must either include a machine-readable - Transparent copy along with each Opaque copy, or state in or with - each Opaque copy a computer-network location from which the general - network-using public has access to download using public-standard - network protocols a complete Transparent copy of the Document, free - of added material. If you use the latter option, you must take - reasonably prudent steps, when you begin distribution of Opaque - copies in quantity, to ensure that this Transparent copy will - remain thus accessible at the stated location until at least one - year after the last time you distribute an Opaque copy (directly or - through your agents or retailers) of that edition to the public. - - It is requested, but not required, that you contact the authors of - the Document well before redistributing any large number of copies, - to give them a chance to provide you with an updated version of the - Document. - - 4. MODIFICATIONS - - You may copy and distribute a Modified Version of the Document - under the conditions of sections 2 and 3 above, provided that you - release the Modified Version under precisely this License, with the - Modified Version filling the role of the Document, thus licensing - distribution and modification of the Modified Version to whoever - possesses a copy of it. In addition, you must do these things in - the Modified Version: - - A. Use in the Title Page (and on the covers, if any) a title - distinct from that of the Document, and from those of previous - versions (which should, if there were any, be listed in the - History section of the Document). You may use the same title - as a previous version if the original publisher of that - version gives permission. - - B. List on the Title Page, as authors, one or more persons or - entities responsible for authorship of the modifications in - the Modified Version, together with at least five of the - principal authors of the Document (all of its principal - authors, if it has fewer than five), unless they release you - from this requirement. - - C. State on the Title page the name of the publisher of the - Modified Version, as the publisher. - - D. Preserve all the copyright notices of the Document. - - E. Add an appropriate copyright notice for your modifications - adjacent to the other copyright notices. - - F. Include, immediately after the copyright notices, a license - notice giving the public permission to use the Modified - Version under the terms of this License, in the form shown in - the Addendum below. - - G. Preserve in that license notice the full lists of Invariant - Sections and required Cover Texts given in the Document's - license notice. - - H. Include an unaltered copy of this License. - - I. Preserve the section Entitled "History", Preserve its Title, - and add to it an item stating at least the title, year, new - authors, and publisher of the Modified Version as given on the - Title Page. If there is no section Entitled "History" in the - Document, create one stating the title, year, authors, and - publisher of the Document as given on its Title Page, then add - an item describing the Modified Version as stated in the - previous sentence. - - J. Preserve the network location, if any, given in the Document - for public access to a Transparent copy of the Document, and - likewise the network locations given in the Document for - previous versions it was based on. These may be placed in the - "History" section. You may omit a network location for a work - that was published at least four years before the Document - itself, or if the original publisher of the version it refers - to gives permission. - - K. For any section Entitled "Acknowledgements" or "Dedications", - Preserve the Title of the section, and preserve in the section - all the substance and tone of each of the contributor - acknowledgements and/or dedications given therein. - - L. Preserve all the Invariant Sections of the Document, unaltered - in their text and in their titles. Section numbers or the - equivalent are not considered part of the section titles. - - M. Delete any section Entitled "Endorsements". Such a section - may not be included in the Modified Version. - - N. Do not retitle any existing section to be Entitled - "Endorsements" or to conflict in title with any Invariant - Section. - - O. Preserve any Warranty Disclaimers. - - If the Modified Version includes new front-matter sections or - appendices that qualify as Secondary Sections and contain no - material copied from the Document, you may at your option designate - some or all of these sections as invariant. To do this, add their - titles to the list of Invariant Sections in the Modified Version's - license notice. These titles must be distinct from any other - section titles. - - You may add a section Entitled "Endorsements", provided it contains - nothing but endorsements of your Modified Version by various - parties--for example, statements of peer review or that the text - has been approved by an organization as the authoritative - definition of a standard. - - You may add a passage of up to five words as a Front-Cover Text, - and a passage of up to 25 words as a Back-Cover Text, to the end of - the list of Cover Texts in the Modified Version. Only one passage - of Front-Cover Text and one of Back-Cover Text may be added by (or - through arrangements made by) any one entity. If the Document - already includes a cover text for the same cover, previously added - by you or by arrangement made by the same entity you are acting on - behalf of, you may not add another; but you may replace the old - one, on explicit permission from the previous publisher that added - the old one. - - The author(s) and publisher(s) of the Document do not by this - License give permission to use their names for publicity for or to - assert or imply endorsement of any Modified Version. - - 5. COMBINING DOCUMENTS - - You may combine the Document with other documents released under - this License, under the terms defined in section 4 above for - modified versions, provided that you include in the combination all - of the Invariant Sections of all of the original documents, - unmodified, and list them all as Invariant Sections of your - combined work in its license notice, and that you preserve all - their Warranty Disclaimers. - - The combined work need only contain one copy of this License, and - multiple identical Invariant Sections may be replaced with a single - copy. If there are multiple Invariant Sections with the same name - but different contents, make the title of each such section unique - by adding at the end of it, in parentheses, the name of the - original author or publisher of that section if known, or else a - unique number. Make the same adjustment to the section titles in - the list of Invariant Sections in the license notice of the - combined work. - - In the combination, you must combine any sections Entitled - "History" in the various original documents, forming one section - Entitled "History"; likewise combine any sections Entitled - "Acknowledgements", and any sections Entitled "Dedications". You - must delete all sections Entitled "Endorsements." - - 6. COLLECTIONS OF DOCUMENTS - - You may make a collection consisting of the Document and other - documents released under this License, and replace the individual - copies of this License in the various documents with a single copy - that is included in the collection, provided that you follow the - rules of this License for verbatim copying of each of the documents - in all other respects. - - You may extract a single document from such a collection, and - distribute it individually under this License, provided you insert - a copy of this License into the extracted document, and follow this - License in all other respects regarding verbatim copying of that - document. - - 7. AGGREGATION WITH INDEPENDENT WORKS - - A compilation of the Document or its derivatives with other - separate and independent documents or works, in or on a volume of a - storage or distribution medium, is called an "aggregate" if the - copyright resulting from the compilation is not used to limit the - legal rights of the compilation's users beyond what the individual - works permit. When the Document is included in an aggregate, this - License does not apply to the other works in the aggregate which - are not themselves derivative works of the Document. - - If the Cover Text requirement of section 3 is applicable to these - copies of the Document, then if the Document is less than one half - of the entire aggregate, the Document's Cover Texts may be placed - on covers that bracket the Document within the aggregate, or the - electronic equivalent of covers if the Document is in electronic - form. Otherwise they must appear on printed covers that bracket - the whole aggregate. - - 8. TRANSLATION - - Translation is considered a kind of modification, so you may - distribute translations of the Document under the terms of section - 4. Replacing Invariant Sections with translations requires special - permission from their copyright holders, but you may include - translations of some or all Invariant Sections in addition to the - original versions of these Invariant Sections. You may include a - translation of this License, and all the license notices in the - Document, and any Warranty Disclaimers, provided that you also - include the original English version of this License and the - original versions of those notices and disclaimers. In case of a - disagreement between the translation and the original version of - this License or a notice or disclaimer, the original version will - prevail. - - If a section in the Document is Entitled "Acknowledgements", - "Dedications", or "History", the requirement (section 4) to - Preserve its Title (section 1) will typically require changing the - actual title. - - 9. TERMINATION - - You may not copy, modify, sublicense, or distribute the Document - except as expressly provided under this License. Any attempt - otherwise to copy, modify, sublicense, or distribute it is void, - and will automatically terminate your rights under this License. - - However, if you cease all violation of this License, then your - license from a particular copyright holder is reinstated (a) - provisionally, unless and until the copyright holder explicitly and - finally terminates your license, and (b) permanently, if the - copyright holder fails to notify you of the violation by some - reasonable means prior to 60 days after the cessation. - - Moreover, your license from a particular copyright holder is - reinstated permanently if the copyright holder notifies you of the - violation by some reasonable means, this is the first time you have - received notice of violation of this License (for any work) from - that copyright holder, and you cure the violation prior to 30 days - after your receipt of the notice. - - Termination of your rights under this section does not terminate - the licenses of parties who have received copies or rights from you - under this License. If your rights have been terminated and not - permanently reinstated, receipt of a copy of some or all of the - same material does not give you any rights to use it. - - 10. FUTURE REVISIONS OF THIS LICENSE - - The Free Software Foundation may publish new, revised versions of - the GNU Free Documentation License from time to time. Such new - versions will be similar in spirit to the present version, but may - differ in detail to address new problems or concerns. See - <http://www.gnu.org/copyleft/>. - - Each version of the License is given a distinguishing version - number. If the Document specifies that a particular numbered - version of this License "or any later version" applies to it, you - have the option of following the terms and conditions either of - that specified version or of any later version that has been - published (not as a draft) by the Free Software Foundation. If the - Document does not specify a version number of this License, you may - choose any version ever published (not as a draft) by the Free - Software Foundation. If the Document specifies that a proxy can - decide which future versions of this License can be used, that - proxy's public statement of acceptance of a version permanently - authorizes you to choose that version for the Document. - - 11. RELICENSING - - "Massive Multiauthor Collaboration Site" (or "MMC Site") means any - World Wide Web server that publishes copyrightable works and also - provides prominent facilities for anybody to edit those works. A - public wiki that anybody can edit is an example of such a server. - A "Massive Multiauthor Collaboration" (or "MMC") contained in the - site means any set of copyrightable works thus published on the MMC - site. - - "CC-BY-SA" means the Creative Commons Attribution-Share Alike 3.0 - license published by Creative Commons Corporation, a not-for-profit - corporation with a principal place of business in San Francisco, - California, as well as future copyleft versions of that license - published by that same organization. - - "Incorporate" means to publish or republish a Document, in whole or - in part, as part of another Document. - - An MMC is "eligible for relicensing" if it is licensed under this - License, and if all works that were first published under this - License somewhere other than this MMC, and subsequently - incorporated in whole or in part into the MMC, (1) had no cover - texts or invariant sections, and (2) were thus incorporated prior - to November 1, 2008. - - The operator of an MMC Site may republish an MMC contained in the - site under CC-BY-SA on the same site at any time before August 1, - 2009, provided the MMC is eligible for relicensing. - -ADDENDUM: How to use this License for your documents -==================================================== - -To use this License in a document you have written, include a copy of -the License in the document and put the following copyright and license -notices just after the title page: - - Copyright (C) YEAR YOUR NAME. - Permission is granted to copy, distribute and/or modify this document - under the terms of the GNU Free Documentation License, Version 1.3 - or any later version published by the Free Software Foundation; - with no Invariant Sections, no Front-Cover Texts, and no Back-Cover - Texts. A copy of the license is included in the section entitled ``GNU - Free Documentation License''. - - If you have Invariant Sections, Front-Cover Texts and Back-Cover -Texts, replace the "with...Texts." line with this: - - with the Invariant Sections being LIST THEIR TITLES, with - the Front-Cover Texts being LIST, and with the Back-Cover Texts - being LIST. - - If you have Invariant Sections without Cover Texts, or some other -combination of the three, merge those two alternatives to suit the -situation. - - If your document contains nontrivial examples of program code, we -recommend releasing these examples in parallel under your choice of free -software license, such as the GNU General Public License, to permit -their use in free software. - - -File: gawkinet.info, Node: Index, Prev: GNU Free Documentation License, Up: Top - -Index -***** - - -* Menu: - -* /inet/ files (gawk): Gawk Special Files. (line 34) -* /inet/tcp special files (gawk): File /inet/tcp. (line 6) -* /inet/udp special files (gawk): File /inet/udp. (line 6) -* | (vertical bar), |& operator (I/O): TCP Connecting. (line 25) -* advanced features, network connections: Troubleshooting. (line 6) -* agent: Challenges. (line 75) -* agent <1>: MOBAGWHO. (line 6) -* AI: Challenges. (line 75) -* apache: WEBGRAB. (line 72) -* apache <1>: MOBAGWHO. (line 42) -* Bioinformatics: PROTBASE. (line 227) -* BLAST, Basic Local Alignment Search Tool: PROTBASE. (line 6) -* blocking: Making Connections. (line 35) -* Boutell, Thomas: STATIST. (line 6) -* CGI (Common Gateway Interface): MOBAGWHO. (line 42) -* CGI (Common Gateway Interface), dynamic web pages and: Web page. - (line 45) -* CGI (Common Gateway Interface), library: CGI Lib. (line 11) -* clients: Making Connections. (line 21) -* Clinton, Bill: Challenges. (line 58) -* Common Gateway Interface, See CGI: Web page. (line 45) -* Computational Biology: PROTBASE. (line 227) -* contest: Challenges. (line 6) -* cron utility: STOXPRED. (line 23) -* CSV format: STOXPRED. (line 128) -* Dow Jones Industrial Index: STOXPRED. (line 44) -* ELIZA program: Simple Server. (line 11) -* ELIZA program <1>: Simple Server. (line 178) -* email: Email. (line 11) -* FASTA/Pearson format: PROTBASE. (line 102) -* FDL (Free Documentation License): GNU Free Documentation License. - (line 6) -* filenames, for network access: Gawk Special Files. (line 29) -* files, /inet/ (gawk): Gawk Special Files. (line 34) -* files, /inet/tcp (gawk): File /inet/tcp. (line 6) -* files, /inet/udp (gawk): File /inet/udp. (line 6) -* finger utility: Setting Up. (line 22) -* Free Documentation License (FDL): GNU Free Documentation License. - (line 6) -* FTP (File Transfer Protocol): Basic Protocols. (line 45) -* gawk, networking: Using Networking. (line 6) -* gawk, networking, connections: Special File Fields. (line 53) -* gawk, networking, connections <1>: TCP Connecting. (line 6) -* gawk, networking, filenames: Gawk Special Files. (line 29) -* gawk, networking, See Also email: Email. (line 6) -* gawk, networking, service, establishing: Setting Up. (line 6) -* gawk, networking, troubleshooting: Caveats. (line 6) -* gawk, web and, See web service: Interacting Service. (line 6) -* getline command: TCP Connecting. (line 11) -* GETURL program: GETURL. (line 6) -* GIF image format: Web page. (line 45) -* GIF image format <1>: STATIST. (line 6) -* GNU Free Documentation License: GNU Free Documentation License. - (line 6) -* GNU/Linux: Troubleshooting. (line 54) -* GNU/Linux <1>: Interacting. (line 27) -* GNU/Linux <2>: REMCONF. (line 6) -* GNUPlot utility: Interacting Service. (line 189) -* GNUPlot utility <1>: STATIST. (line 6) -* Hoare, C.A.R.: MOBAGWHO. (line 6) -* Hoare, C.A.R. <1>: PROTBASE. (line 6) -* hostname field: Special File Fields. (line 34) -* HTML (Hypertext Markup Language): Web page. (line 29) -* HTTP (Hypertext Transfer Protocol): Basic Protocols. (line 45) -* HTTP (Hypertext Transfer Protocol) <1>: Web page. (line 6) -* HTTP (Hypertext Transfer Protocol), record separators and: Web page. - (line 29) -* HTTP server, core logic: Interacting Service. (line 6) -* HTTP server, core logic <1>: Interacting Service. (line 24) -* Humphrys, Mark: Simple Server. (line 178) -* Hypertext Markup Language (HTML): Web page. (line 29) -* Hypertext Transfer Protocol, See HTTP: Web page. (line 6) -* image format: STATIST. (line 6) -* images, in web pages: Interacting Service. (line 189) -* images, retrieving over networks: Web page. (line 45) -* input/output, two-way, See Also gawk, networking: Gawk Special Files. - (line 19) -* Internet, See networks: Interacting. (line 48) -* JavaScript: STATIST. (line 56) -* Linux: Troubleshooting. (line 54) -* Linux <1>: Interacting. (line 27) -* Linux <2>: REMCONF. (line 6) -* Lisp: MOBAGWHO. (line 98) -* localport field: Gawk Special Files. (line 34) -* Loebner, Hugh: Challenges. (line 6) -* Loui, Ronald: Challenges. (line 75) -* MAZE: MAZE. (line 6) -* Microsoft Windows: WEBGRAB. (line 43) -* Microsoft Windows, networking: Troubleshooting. (line 54) -* Microsoft Windows, networking, ports: Setting Up. (line 37) -* MiniSQL: REMCONF. (line 109) -* MOBAGWHO program: MOBAGWHO. (line 6) -* NCBI, National Center for Biotechnology Information: PROTBASE. - (line 6) -* network type field: Special File Fields. (line 11) -* networks, gawk and: Using Networking. (line 6) -* networks, gawk and, connections: Special File Fields. (line 53) -* networks, gawk and, connections <1>: TCP Connecting. (line 6) -* networks, gawk and, filenames: Gawk Special Files. (line 29) -* networks, gawk and, See Also email: Email. (line 6) -* networks, gawk and, service, establishing: Setting Up. (line 6) -* networks, gawk and, troubleshooting: Caveats. (line 6) -* networks, ports, reserved: Setting Up. (line 37) -* networks, ports, specifying: Special File Fields. (line 24) -* networks, See Also web pages: PANIC. (line 6) -* Numerical Recipes: STATIST. (line 24) -* ORS variable, HTTP and: Web page. (line 29) -* ORS variable, POP and: Email. (line 36) -* PANIC program: PANIC. (line 6) -* Perl: Using Networking. (line 14) -* Perl, gawk networking and: Using Networking. (line 24) -* Perlis, Alan: MAZE. (line 6) -* pipes, networking and: TCP Connecting. (line 30) -* PNG image format: Web page. (line 45) -* PNG image format <1>: STATIST. (line 6) -* POP (Post Office Protocol): Email. (line 6) -* POP (Post Office Protocol) <1>: Email. (line 36) -* Post Office Protocol (POP): Email. (line 6) -* PostScript: STATIST. (line 138) -* PROLOG: Challenges. (line 75) -* PROTBASE: PROTBASE. (line 6) -* protocol field: Special File Fields. (line 17) -* PS image format: STATIST. (line 6) -* Python: Using Networking. (line 14) -* Python, gawk networking and: Using Networking. (line 24) -* record separators, HTTP and: Web page. (line 29) -* record separators, POP and: Email. (line 36) -* REMCONF program: REMCONF. (line 6) -* remoteport field: Gawk Special Files. (line 34) -* RFC 1939: Email. (line 6) -* RFC 1939 <1>: Email. (line 36) -* RFC 1945: Web page. (line 29) -* RFC 2068: Web page. (line 6) -* RFC 2068 <1>: Interacting Service. (line 104) -* RFC 2616: Web page. (line 6) -* RFC 821: Email. (line 6) -* robot: Challenges. (line 84) -* robot <1>: WEBGRAB. (line 6) -* RS variable, HTTP and: Web page. (line 29) -* RS variable, POP and: Email. (line 36) -* servers: Making Connections. (line 14) -* servers <1>: Setting Up. (line 22) -* servers, as hosts: Special File Fields. (line 34) -* servers, HTTP: Interacting Service. (line 6) -* servers, web: Simple Server. (line 6) -* Simple Mail Transfer Protocol (SMTP): Email. (line 6) -* SMTP (Simple Mail Transfer Protocol): Basic Protocols. (line 45) -* SMTP (Simple Mail Transfer Protocol) <1>: Email. (line 6) -* STATIST program: STATIST. (line 6) -* STOXPRED program: STOXPRED. (line 6) -* synchronous communications: Making Connections. (line 35) -* Tcl/Tk: Using Networking. (line 14) -* Tcl/Tk, gawk and: Using Networking. (line 24) -* Tcl/Tk, gawk and <1>: Some Applications and Techniques. - (line 22) -* TCP (Transmission Control Protocol): Using Networking. (line 29) -* TCP (Transmission Control Protocol) <1>: File /inet/tcp. (line 6) -* TCP (Transmission Control Protocol), connection, establishing: TCP Connecting. - (line 6) -* TCP (Transmission Control Protocol), UDP and: Interacting. (line 48) -* TCP/IP, network type, selecting: Special File Fields. (line 11) -* TCP/IP, protocols, selecting: Special File Fields. (line 17) -* TCP/IP, sockets and: Gawk Special Files. (line 19) -* Transmission Control Protocol, See TCP: Using Networking. (line 29) -* troubleshooting, gawk, networks: Caveats. (line 6) -* troubleshooting, networks, connections: Troubleshooting. (line 6) -* troubleshooting, networks, timeouts: Caveats. (line 18) -* UDP (User Datagram Protocol): File /inet/udp. (line 6) -* UDP (User Datagram Protocol), TCP and: Interacting. (line 48) -* Unix, network ports and: Setting Up. (line 37) -* URLCHK program: URLCHK. (line 6) -* User Datagram Protocol, See UDP: File /inet/udp. (line 6) -* vertical bar (|), |& operator (I/O): TCP Connecting. (line 25) -* VRML: MAZE. (line 6) -* web browsers, See web service: Interacting Service. (line 6) -* web pages: Web page. (line 6) -* web pages, images in: Interacting Service. (line 189) -* web pages, retrieving: GETURL. (line 6) -* web servers: Simple Server. (line 6) -* web service: Primitive Service. (line 6) -* web service <1>: PANIC. (line 6) -* WEBGRAB program: WEBGRAB. (line 6) -* Weizenbaum, Joseph: Simple Server. (line 11) -* XBM image format: Interacting Service. (line 189) -* Yahoo!: REMCONF. (line 6) -* Yahoo! <1>: STOXPRED. (line 6) - - - -Tag Table: -Node: Top2022 -Node: Preface5665 -Node: Introduction7040 -Node: Stream Communications8066 -Node: Datagram Communications9240 -Node: The TCP/IP Protocols10870 -Ref: The TCP/IP Protocols-Footnote-111554 -Node: Basic Protocols11711 -Ref: Basic Protocols-Footnote-113756 -Node: Ports13785 -Node: Making Connections15192 -Ref: Making Connections-Footnote-117750 -Ref: Making Connections-Footnote-217797 -Node: Using Networking17978 -Node: Gawk Special Files20301 -Node: Special File Fields22110 -Ref: table-inet-components26003 -Node: Comparing Protocols27312 -Node: File /inet/tcp27846 -Node: File /inet/udp28874 -Ref: File /inet/udp-Footnote-130573 -Node: TCP Connecting30827 -Node: Troubleshooting33173 -Ref: Troubleshooting-Footnote-136232 -Node: Interacting36805 -Node: Setting Up39545 -Node: Email43048 -Node: Web page45380 -Ref: Web page-Footnote-148197 -Node: Primitive Service48395 -Node: Interacting Service51136 -Ref: Interacting Service-Footnote-160303 -Node: CGI Lib60335 -Node: Simple Server67310 -Ref: Simple Server-Footnote-175053 -Node: Caveats75154 -Node: Challenges76299 -Node: Some Applications and Techniques84997 -Node: PANIC87462 -Node: GETURL89186 -Node: REMCONF91819 -Node: URLCHK97314 -Node: WEBGRAB101166 -Node: STATIST105628 -Ref: STATIST-Footnote-1117377 -Node: MAZE117822 -Node: MOBAGWHO124029 -Ref: MOBAGWHO-Footnote-1138047 -Node: STOXPRED138102 -Node: PROTBASE152390 -Node: Links165506 -Node: GNU Free Documentation License168939 -Node: Index194059 - -End Tag Table diff --git a/doc/gawktexi.in b/doc/gawktexi.in index afcf749a..14a1748c 100644 --- a/doc/gawktexi.in +++ b/doc/gawktexi.in @@ -18491,12 +18491,12 @@ Return the value of @var{val}, shifted right by @var{count} bits. Return the bitwise XOR of the arguments. There must be at least two. @end table -For all of these functions, first the double-precision floating-point value is -converted to the widest C unsigned integer type, then the bitwise operation is -performed. If the result cannot be represented exactly as a C @code{double}, -leading nonzero bits are removed one by one until it can be represented -exactly. The result is then converted back into a C @code{double}. (If -you don't understand this paragraph, don't worry about it.) +@quotation CAUTION +Beginning with @command{gawk} @value{VERSION} 4.2, negative +operands are not allowed for any of these functions. A negative +operand produces a fatal error. See the sidebar +``Beware The Smoke and Mirrors!'' for more information as to why. +@end quotation Here is a user-defined function (@pxref{User-defined}) that illustrates the use of these functions: @@ -18601,6 +18601,60 @@ decimal and octal values for the same numbers and then demonstrates the results of the @code{compl()}, @code{lshift()}, and @code{rshift()} functions. +@sidebar Beware The Smoke and Mirrors! + +It other languages, bitwise operations are performed on integer values, +not floating-point values. As a general statement, such operations work +best when performed on unsigned integers. + +@command{gawk} attempts to treat the arguments to the bitwise functions +as unsigned integers. For this reason, negative arguments produce a +fatal error. + +In normal operation, for all of these functions, first the +double-precision floating-point value is converted to the widest C +unsigned integer type, then the bitwise operation is performed. If the +result cannot be represented exactly as a C @code{double}, leading +nonzero bits are removed one by one until it can be represented exactly. +The result is then converted back into a C @code{double}.@footnote{If you don't +understand this paragraph, the upshot is that @command{gawk} can only +store a particular range of integer values; numbers outside that range +are reduced to fit within the range.} + +However, when using arbitrary precision arithmetic with the @option{-M} +option (@pxref{Arbitrary Precision Arithmetic}), the results may differ. +This is particularly noticable with the @code{compl()} function: + +@example +$ @kbd{gawk 'BEGIN @{ print compl(42) @}'} +@print{} 9007199254740949 +$ @kbd{gawk -M 'BEGIN @{ print compl(42) @}'} +@print{} -43 +@end example + +What's going on becomes clear when printing the results +in hexadecimal: + +@example +$ @kbd{gawk 'BEGIN @{ printf "%#x\n", compl(42) @}'} +@print{} 0x1fffffffffffd5 +$ @kbd{gawk -M 'BEGIN @{ printf "%#x\n", compl(42) @}'} +@print{} 0xffffffffffffffd5 +@end example + +When using the @option{-M} option, under the hood, @command{gawk} uses +GNU MP arbitrary precision integers which have at least 64 bits of precision. +When not using @option{-M}, @command{gawk} stores integral values in +regular double-precision floating point, which only maintain 53 bits of +precision. Furthermore, the GNU MP library treats (or least seems to treat) +the leading bit as a sign bit; thus the result with @option{-M} in this case is +a negative number. + +In short, using @command{gawk} for any but the simplest kind of bitwise +operations is probably a bad idea; caveat emptor! + +@end sidebar + @node Type Functions @subsection Getting Type Information @@ -814,11 +814,11 @@ do_mpfr_compl(int nargs) /* [+-]inf or NaN */ return tmp; } - if (do_lint) { - if (mpfr_sgn(p) < 0) - lintwarn("%s", - mpg_fmt(_("compl(%Rg): negative value will give strange results"), p) + if (mpfr_sgn(p) < 0) + fatal("%s", + mpg_fmt(_("compl(%Rg): negative value is not allowed"), p) ); + if (do_lint) { if (! mpfr_integer_p(p)) lintwarn("%s", mpg_fmt(_("comp(%Rg): fractional value will be truncated"), p) @@ -830,12 +830,10 @@ do_mpfr_compl(int nargs) } else { /* (tmp->flags & MPZN) != 0 */ zptr = tmp->mpg_i; - if (do_lint) { - if (mpz_sgn(zptr) < 0) - lintwarn("%s", - mpg_fmt(_("cmpl(%Zd): negative values will give strange results"), zptr) + if (mpz_sgn(zptr) < 0) + fatal("%s", + mpg_fmt(_("compl(%Zd): negative values is not allowed"), zptr) ); - } } r = mpg_integer(); @@ -871,13 +869,13 @@ get_intval(NODE *t1, int argnum, const char *op) return pz; /* should be freed */ } - if (do_lint) { - if (mpfr_sgn(left) < 0) - lintwarn("%s", - mpg_fmt(_("%s: argument #%d negative value %Rg will give strange results"), + if (mpfr_sgn(left) < 0) + fatal("%s", + mpg_fmt(_("%s: argument #%d negative value %Rg is not allowed"), op, argnum, left) ); + if (do_lint) { if (! mpfr_integer_p(left)) lintwarn("%s", mpg_fmt(_("%s: argument #%d fractional value %Rg will be truncated"), @@ -892,13 +890,12 @@ get_intval(NODE *t1, int argnum, const char *op) } /* (t1->flags & MPZN) != 0 */ pz = t1->mpg_i; - if (do_lint) { - if (mpz_sgn(pz) < 0) - lintwarn("%s", - mpg_fmt(_("%s: argument #%d negative value %Zd will give strange results"), + if (mpz_sgn(pz) < 0) + fatal("%s", + mpg_fmt(_("%s: argument #%d negative value %Zd is not allowed"), op, argnum, pz) ); - } + return pz; /* must not be freed */ } diff --git a/vms/ChangeLog b/vms/ChangeLog index 29f0363a..dd021669 100644 --- a/vms/ChangeLog +++ b/vms/ChangeLog @@ -1,3 +1,8 @@ +2016-10-24 John E. Malmberg <wb8tyw@qsl.net> + + * backup_gawk_src.com: Do not backup entire git repository. + * pcsi_product_gawk.com: Create a ZIP archive of PCSI kit. + 2016-10-23 Arnold D. Robbins <arnold@skeeve.com> * General: Remove trailing whitespace from all relevant files. diff --git a/vms/backup_gawk_src.com b/vms/backup_gawk_src.com index d1e47fbe..abee8d71 100644 --- a/vms/backup_gawk_src.com +++ b/vms/backup_gawk_src.com @@ -71,11 +71,11 @@ $!------------------------------------------- $ interchange = "" $ if arch_code .eqs. "V" $ then -$ interchange = "/interchange" +$ interchange = "/interchange/exclude=[.$5ngit...]*.*" $ endif $ if (swvers_maj .ges. "8") .and. (swvers_min .ges. 4) $ then -$ interchange = "/interchange/noconvert" +$ interchange = "/interchange/noconvert/exclude=[.^.git...]*.*" $ endif $! $! diff --git a/vms/pcsi_product_gawk.com b/vms/pcsi_product_gawk.com index b0d9febd..b0fc50f8 100644 --- a/vms/pcsi_product_gawk.com +++ b/vms/pcsi_product_gawk.com @@ -93,6 +93,12 @@ $! Regenerate the PCSI Text file. $!--------------------------------- $ @[.vms]build_gawk_pcsi_text.com $! +$ base = "" +$ arch_name = f$edit(f$getsyi("arch_name"),"UPCASE") +$ if arch_name .eqs. "ALPHA" then base = "AXPVMS" +$ if arch_name .eqs. "IA64" then base = "I64VMS" +$ if arch_name .eqs. "VAX" then base = "VAXVMS" +$! $! $! Parse the kit name into components. $!--------------------------------------- @@ -112,6 +118,7 @@ $ updatepatch = f$element(4, "-", kit_name) $ if updatepatch .eqs. "" then updatepatch = "" $! $ version_fao = "!AS.!AS" +$ if arch_name .eqs. "VAX" then version_fao = "!AS$5n!AS" $ mmversion = f$fao(version_fao, "''majorver'", "''minorver'") $ if updatepatch .nes. "" $ then @@ -120,6 +127,13 @@ $ else $ version = "''mmversion'" $ endif $! +$ node_swvers = f$getsyi("node_swvers") +$ vms_vernum = f$extract(1, f$length(node_swvers), node_swvers) +$ tagver = vms_vernum - "." - "." - "-" +$ zip_name = producer + "-" + base + "-" + tagver + "-" + product_name +$ zip_name = zip_name + "-" + mmversion + "-" + updatepatch + "-1" +$ zip_name = f$edit(zip_name, "lowercase") +$! $! $! Move to the base directories $ current_default = f$environment("DEFAULT") @@ -143,12 +157,6 @@ $ gnu_src = src1 + src2 + src3 + src4 + src5 + src6 + src7 + src8 + src9 $ gnu_src = gnu_src + src10 + src11 + src12 $! $! -$ base = "" -$ arch_name = f$edit(f$getsyi("arch_name"),"UPCASE") -$ if arch_name .eqs. "ALPHA" then base = "AXPVMS" -$ if arch_name .eqs. "IA64" then base = "I64VMS" -$ if arch_name .eqs. "VAX" then base = "VAXVMS" -$! $ if base .eqs. "" then exit 44 $! $ pcsi_option = "/option=noconfirm" @@ -167,19 +175,10 @@ $product package 'product_name' - /format=sequential 'pcsi_option' $! $! -$! VAX can not do a compressed kit. -$! ZIP -9 "-V" does a better job, so no reason to normally build a compressed -$! kit. -$!---------------------------------- -$if p1 .eqs. "COMPRESSED" +$! +$if f$type(zip) .eqs. "STRING" $then -$ if arch_code .nes. "V" -$ then -$ product copy /options=(novalidate, noconfirm) /format=compressed - - 'product_name' - - /source=stage_root:[kit]/dest=stage_root:[kit] - - /version='version'/base='base' -$ endif +$ zip "-9Vj" stage_root:[kit]'zip_name'.zip stage_root:[kit]'kit_name'.pcsi $endif $! $all_exit: |