diff options
| -rw-r--r-- | build-aux/ChangeLog | 4 | ||||
| -rwxr-xr-x | build-aux/config.guess | 14 | ||||
| -rw-r--r-- | doc/ChangeLog | 9 | ||||
| -rw-r--r-- | doc/Makefile.am | 7 | ||||
| -rw-r--r-- | doc/Makefile.in | 7 | ||||
| -rw-r--r-- | doc/gawk.info | 536 | ||||
| -rw-r--r-- | doc/gawk.texi | 2 | ||||
| -rw-r--r-- | doc/gawkinet.info | 14 | ||||
| -rw-r--r-- | doc/gawkinet.texi | 2 | ||||
| -rw-r--r-- | doc/gawktexi.in | 2 | ||||
| -rw-r--r-- | doc/wordlist | 265 | ||||
| -rw-r--r-- | doc/wordlist2 | 13 | ||||
| -rw-r--r-- | doc/wordlist3 | 6 | ||||
| -rw-r--r-- | doc/wordlist4 | 597 | ||||
| -rw-r--r-- | support/ChangeLog | 4 | ||||
| -rw-r--r-- | support/dfa.c | 6 | ||||
| -rw-r--r-- | support/dfa.h | 3 |
17 files changed, 936 insertions, 555 deletions
diff --git a/build-aux/ChangeLog b/build-aux/ChangeLog index 8f07b4c6..eaaa6515 100644 --- a/build-aux/ChangeLog +++ b/build-aux/ChangeLog @@ -1,3 +1,7 @@ +2020-09-24 Arnold D. Robbins <arnold@skeeve.com> + + * config.guess: Updated from GNULIB. + 2020-09-11 Arnold D. Robbins <arnold@skeeve.com> * config.sub: Updated from GNULIB. diff --git a/build-aux/config.guess b/build-aux/config.guess index 9aff91cf..8d70ec2b 100755 --- a/build-aux/config.guess +++ b/build-aux/config.guess @@ -2,7 +2,7 @@ # Attempt to guess a canonical system name. # Copyright 1992-2020 Free Software Foundation, Inc. -timestamp='2020-08-17' +timestamp='2020-09-19' # This file is free software; you can redistribute it and/or modify it # under the terms of the GNU General Public License as published by @@ -150,17 +150,15 @@ Linux|GNU|GNU/*) #elif defined(__dietlibc__) LIBC=dietlibc #else + #include <stdarg.h> + #ifdef __DEFINED_va_list + LIBC=musl + #else LIBC=gnu #endif + #endif EOF eval "`$CC_FOR_BUILD -E "$dummy.c" 2>/dev/null | grep '^LIBC' | sed 's, ,,g'`" - - # If ldd exists, use it to detect musl libc. - if command -v ldd >/dev/null && \ - ldd --version 2>&1 | grep -q ^musl - then - LIBC=musl - fi ;; esac diff --git a/doc/ChangeLog b/doc/ChangeLog index 4f485386..bb6aa39e 100644 --- a/doc/ChangeLog +++ b/doc/ChangeLog @@ -1,3 +1,12 @@ +2020-09-24 Arnold D. Robbins <arnold@skeeve.com> + + * gawktexi.in: Fix a spelling error. + * wordlist, wordlist2, wordlist3: Remove words that spell + now recognizes as real words. + * gawkinet.texi: Fix a spelling error. + * Makefile.am (spellinet): New target. + * wordlist4: New file. + 2020-09-18 Arnold D. Robbins <arnold@skeeve.com> * gawktexi.in: Minor fixes. Thanks to Antonio Columbo for diff --git a/doc/Makefile.am b/doc/Makefile.am index 24dd0405..d95d5660 100644 --- a/doc/Makefile.am +++ b/doc/Makefile.am @@ -110,7 +110,7 @@ awkcard.nc: $(CARDFILES) awkcard.pdf: awkcard.ps ps2pdf awkcard.ps awkcard.pdf -spell: spellmanual spellworkflow spellmanpage +spell: spellmanual spellworkflow spellmanpage spellinet spellmanual: @echo ==== gawktexi.in ====; @@ -126,3 +126,8 @@ spellmanpage: @echo ==== gawk.1 ==== export LC_ALL=C ; spell "$(srcdir)"/gawk.1 | \ sort -u | comm -23 - "$(srcdir)"/wordlist3 + +spellinet: + @echo ==== gawkinet.texi ==== + export LC_ALL=C ; spell "$(srcdir)"/gawkinet.texi | \ + sort -u | comm -23 - "$(srcdir)"/wordlist4 diff --git a/doc/Makefile.in b/doc/Makefile.in index c457ea1a..5d33b8a5 100644 --- a/doc/Makefile.in +++ b/doc/Makefile.in @@ -933,7 +933,7 @@ awkcard.nc: $(CARDFILES) awkcard.pdf: awkcard.ps ps2pdf awkcard.ps awkcard.pdf -spell: spellmanual spellworkflow spellmanpage +spell: spellmanual spellworkflow spellmanpage spellinet spellmanual: @echo ==== gawktexi.in ====; @@ -950,6 +950,11 @@ spellmanpage: export LC_ALL=C ; spell "$(srcdir)"/gawk.1 | \ sort -u | comm -23 - "$(srcdir)"/wordlist3 +spellinet: + @echo ==== gawkinet.texi ==== + export LC_ALL=C ; spell "$(srcdir)"/gawkinet.texi | \ + sort -u | comm -23 - "$(srcdir)"/wordlist4 + # Tell versions [3.59,3.63) of GNU make to not export all variables. # Otherwise a system limit (for SysV at least) may be exceeded. .NOEXPORT: diff --git a/doc/gawk.info b/doc/gawk.info index 88c01fae..a3c9a803 100644 --- a/doc/gawk.info +++ b/doc/gawk.info @@ -17892,8 +17892,8 @@ BREs. You use '-E' to specify the use of EREs, and '-F' to specify searching for fixed strings. In practice, systems continue to come with separate 'egrep' and -'fgrep' utilities, for backwards compatibilty. This minor node provides -an 'awk' implementation of 'egrep', which supports all of the +'fgrep' utilities, for backwards compatibility. This minor node +provides an 'awk' implementation of 'egrep', which supports all of the POSIX-mandated options. You invoke it as follows: 'egrep' [OPTIONS] ''PATTERN'' FILES ... @@ -37956,272 +37956,272 @@ Node: Running Examples726294 Node: Clones727022 Node: Cut Program728246 Node: Egrep Program738175 -Node: Id Program747185 -Node: Split Program757132 -Ref: Split Program-Footnote-1760590 -Node: Tee Program760719 -Node: Uniq Program763509 -Node: Wc Program771073 -Ref: Wc Program-Footnote-1775328 -Node: Miscellaneous Programs775422 -Node: Dupword Program776635 -Node: Alarm Program778665 -Node: Translate Program783520 -Ref: Translate Program-Footnote-1788085 -Node: Labels Program788355 -Ref: Labels Program-Footnote-1791706 -Node: Word Sorting791790 -Node: History Sorting795862 -Node: Extract Program798087 -Node: Simple Sed806141 -Node: Igawk Program809215 -Ref: Igawk Program-Footnote-1823546 -Ref: Igawk Program-Footnote-2823748 -Ref: Igawk Program-Footnote-3823870 -Node: Anagram Program823985 -Node: Signature Program827047 -Node: Programs Summary828294 -Node: Programs Exercises829508 -Ref: Programs Exercises-Footnote-1833638 -Node: Advanced Features833724 -Node: Nondecimal Data835714 -Node: Array Sorting837305 -Node: Controlling Array Traversal838005 -Ref: Controlling Array Traversal-Footnote-1846373 -Node: Array Sorting Functions846491 -Ref: Array Sorting Functions-Footnote-1851582 -Node: Two-way I/O851778 -Ref: Two-way I/O-Footnote-1859499 -Ref: Two-way I/O-Footnote-2859686 -Node: TCP/IP Networking859768 -Node: Profiling862886 -Node: Advanced Features Summary872200 -Node: Internationalization874044 -Node: I18N and L10N875524 -Node: Explaining gettext876211 -Ref: Explaining gettext-Footnote-1882103 -Ref: Explaining gettext-Footnote-2882288 -Node: Programmer i18n882453 -Ref: Programmer i18n-Footnote-1887402 -Node: Translator i18n887451 -Node: String Extraction888245 -Ref: String Extraction-Footnote-1889377 -Node: Printf Ordering889463 -Ref: Printf Ordering-Footnote-1892249 -Node: I18N Portability892313 -Ref: I18N Portability-Footnote-1894769 -Node: I18N Example894832 -Ref: I18N Example-Footnote-1898107 -Ref: I18N Example-Footnote-2898180 -Node: Gawk I18N898289 -Node: I18N Summary898938 -Node: Debugger900279 -Node: Debugging901279 -Node: Debugging Concepts901720 -Node: Debugging Terms903529 -Node: Awk Debugging906104 -Ref: Awk Debugging-Footnote-1907049 -Node: Sample Debugging Session907181 -Node: Debugger Invocation907715 -Node: Finding The Bug909101 -Node: List of Debugger Commands915575 -Node: Breakpoint Control916908 -Node: Debugger Execution Control920602 -Node: Viewing And Changing Data923964 -Node: Execution Stack927505 -Node: Debugger Info929142 -Node: Miscellaneous Debugger Commands933213 -Node: Readline Support938275 -Node: Limitations939171 -Node: Debugging Summary941725 -Node: Namespaces943004 -Node: Global Namespace944115 -Node: Qualified Names945513 -Node: Default Namespace946512 -Node: Changing The Namespace947253 -Node: Naming Rules948867 -Node: Internal Name Management950715 -Node: Namespace Example951757 -Node: Namespace And Features954319 -Node: Namespace Summary955754 -Node: Arbitrary Precision Arithmetic957231 -Node: Computer Arithmetic958718 -Ref: table-numeric-ranges962484 -Ref: table-floating-point-ranges962977 -Ref: Computer Arithmetic-Footnote-1963635 -Node: Math Definitions963692 -Ref: table-ieee-formats967008 -Ref: Math Definitions-Footnote-1967611 -Node: MPFR features967716 -Node: FP Math Caution969434 -Ref: FP Math Caution-Footnote-1970506 -Node: Inexactness of computations970875 -Node: Inexact representation971835 -Node: Comparing FP Values973195 -Node: Errors accumulate974436 -Node: Getting Accuracy975869 -Node: Try To Round978579 -Node: Setting precision979478 -Ref: table-predefined-precision-strings980175 -Node: Setting the rounding mode982005 -Ref: table-gawk-rounding-modes982379 -Ref: Setting the rounding mode-Footnote-1986310 -Node: Arbitrary Precision Integers986489 -Ref: Arbitrary Precision Integers-Footnote-1989664 -Node: Checking for MPFR989813 -Node: POSIX Floating Point Problems991287 -Ref: POSIX Floating Point Problems-Footnote-1995572 -Node: Floating point summary995610 -Node: Dynamic Extensions997800 -Node: Extension Intro999353 -Node: Plugin License1000619 -Node: Extension Mechanism Outline1001416 -Ref: figure-load-extension1001855 -Ref: figure-register-new-function1003420 -Ref: figure-call-new-function1004512 -Node: Extension API Description1006574 -Node: Extension API Functions Introduction1008287 -Ref: table-api-std-headers1010123 -Node: General Data Types1014372 -Ref: General Data Types-Footnote-11023002 -Node: Memory Allocation Functions1023301 -Ref: Memory Allocation Functions-Footnote-11027802 -Node: Constructor Functions1027901 -Node: API Ownership of MPFR and GMP Values1031367 -Node: Registration Functions1032680 -Node: Extension Functions1033380 -Node: Exit Callback Functions1038702 -Node: Extension Version String1039952 -Node: Input Parsers1040615 -Node: Output Wrappers1053336 -Node: Two-way processors1057848 -Node: Printing Messages1060113 -Ref: Printing Messages-Footnote-11061284 -Node: Updating ERRNO1061437 -Node: Requesting Values1062176 -Ref: table-value-types-returned1062913 -Node: Accessing Parameters1063849 -Node: Symbol Table Access1065086 -Node: Symbol table by name1065598 -Ref: Symbol table by name-Footnote-11068622 -Node: Symbol table by cookie1068750 -Ref: Symbol table by cookie-Footnote-11072935 -Node: Cached values1072999 -Ref: Cached values-Footnote-11076535 -Node: Array Manipulation1076688 -Ref: Array Manipulation-Footnote-11077779 -Node: Array Data Types1077816 -Ref: Array Data Types-Footnote-11080474 -Node: Array Functions1080566 -Node: Flattening Arrays1085064 -Node: Creating Arrays1092040 -Node: Redirection API1096807 -Node: Extension API Variables1099640 -Node: Extension Versioning1100351 -Ref: gawk-api-version1100780 -Node: Extension GMP/MPFR Versioning1102511 -Node: Extension API Informational Variables1104139 -Node: Extension API Boilerplate1105212 -Node: Changes from API V11109186 -Node: Finding Extensions1110758 -Node: Extension Example1111317 -Node: Internal File Description1112115 -Node: Internal File Ops1116195 -Ref: Internal File Ops-Footnote-11127545 -Node: Using Internal File Ops1127685 -Ref: Using Internal File Ops-Footnote-11130068 -Node: Extension Samples1130342 -Node: Extension Sample File Functions1131871 -Node: Extension Sample Fnmatch1139520 -Node: Extension Sample Fork1141007 -Node: Extension Sample Inplace1142225 -Node: Extension Sample Ord1145850 -Node: Extension Sample Readdir1146686 -Ref: table-readdir-file-types1147575 -Node: Extension Sample Revout1148642 -Node: Extension Sample Rev2way1149231 -Node: Extension Sample Read write array1149971 -Node: Extension Sample Readfile1151913 -Node: Extension Sample Time1153008 -Node: Extension Sample API Tests1154760 -Node: gawkextlib1155252 -Node: Extension summary1158170 -Node: Extension Exercises1161872 -Node: Language History1163114 -Node: V7/SVR3.11164770 -Node: SVR41166922 -Node: POSIX1168356 -Node: BTL1169737 -Node: POSIX/GNU1170466 -Node: Feature History1176244 -Node: Common Extensions1192563 -Node: Ranges and Locales1193846 -Ref: Ranges and Locales-Footnote-11198462 -Ref: Ranges and Locales-Footnote-21198489 -Ref: Ranges and Locales-Footnote-31198724 -Node: Contributors1198947 -Node: History summary1204944 -Node: Installation1206324 -Node: Gawk Distribution1207268 -Node: Getting1207752 -Node: Extracting1208715 -Node: Distribution contents1210353 -Node: Unix Installation1216833 -Node: Quick Installation1217515 -Node: Shell Startup Files1219929 -Node: Additional Configuration Options1221018 -Node: Configuration Philosophy1223333 -Node: Non-Unix Installation1225702 -Node: PC Installation1226162 -Node: PC Binary Installation1227000 -Node: PC Compiling1227435 -Node: PC Using1228552 -Node: Cygwin1232105 -Node: MSYS1233329 -Node: VMS Installation1233931 -Node: VMS Compilation1234722 -Ref: VMS Compilation-Footnote-11235951 -Node: VMS Dynamic Extensions1236009 -Node: VMS Installation Details1237694 -Node: VMS Running1239947 -Node: VMS GNV1244226 -Node: VMS Old Gawk1244961 -Node: Bugs1245432 -Node: Bug address1246095 -Node: Usenet1249077 -Node: Maintainers1250081 -Node: Other Versions1251266 -Node: Installation summary1258354 -Node: Notes1259563 -Node: Compatibility Mode1260357 -Node: Additions1261139 -Node: Accessing The Source1262064 -Node: Adding Code1263501 -Node: New Ports1269720 -Node: Derived Files1274095 -Ref: Derived Files-Footnote-11279755 -Ref: Derived Files-Footnote-21279790 -Ref: Derived Files-Footnote-31280388 -Node: Future Extensions1280502 -Node: Implementation Limitations1281160 -Node: Extension Design1282370 -Node: Old Extension Problems1283514 -Ref: Old Extension Problems-Footnote-11285032 -Node: Extension New Mechanism Goals1285089 -Ref: Extension New Mechanism Goals-Footnote-11288453 -Node: Extension Other Design Decisions1288642 -Node: Extension Future Growth1290755 -Node: Notes summary1291361 -Node: Basic Concepts1292519 -Node: Basic High Level1293200 -Ref: figure-general-flow1293482 -Ref: figure-process-flow1294167 -Ref: Basic High Level-Footnote-11297468 -Node: Basic Data Typing1297653 -Node: Glossary1300981 -Node: Copying1332866 -Node: GNU Free Documentation License1370409 -Node: Index1395529 +Node: Id Program747186 +Node: Split Program757133 +Ref: Split Program-Footnote-1760591 +Node: Tee Program760720 +Node: Uniq Program763510 +Node: Wc Program771074 +Ref: Wc Program-Footnote-1775329 +Node: Miscellaneous Programs775423 +Node: Dupword Program776636 +Node: Alarm Program778666 +Node: Translate Program783521 +Ref: Translate Program-Footnote-1788086 +Node: Labels Program788356 +Ref: Labels Program-Footnote-1791707 +Node: Word Sorting791791 +Node: History Sorting795863 +Node: Extract Program798088 +Node: Simple Sed806142 +Node: Igawk Program809216 +Ref: Igawk Program-Footnote-1823547 +Ref: Igawk Program-Footnote-2823749 +Ref: Igawk Program-Footnote-3823871 +Node: Anagram Program823986 +Node: Signature Program827048 +Node: Programs Summary828295 +Node: Programs Exercises829509 +Ref: Programs Exercises-Footnote-1833639 +Node: Advanced Features833725 +Node: Nondecimal Data835715 +Node: Array Sorting837306 +Node: Controlling Array Traversal838006 +Ref: Controlling Array Traversal-Footnote-1846374 +Node: Array Sorting Functions846492 +Ref: Array Sorting Functions-Footnote-1851583 +Node: Two-way I/O851779 +Ref: Two-way I/O-Footnote-1859500 +Ref: Two-way I/O-Footnote-2859687 +Node: TCP/IP Networking859769 +Node: Profiling862887 +Node: Advanced Features Summary872201 +Node: Internationalization874045 +Node: I18N and L10N875525 +Node: Explaining gettext876212 +Ref: Explaining gettext-Footnote-1882104 +Ref: Explaining gettext-Footnote-2882289 +Node: Programmer i18n882454 +Ref: Programmer i18n-Footnote-1887403 +Node: Translator i18n887452 +Node: String Extraction888246 +Ref: String Extraction-Footnote-1889378 +Node: Printf Ordering889464 +Ref: Printf Ordering-Footnote-1892250 +Node: I18N Portability892314 +Ref: I18N Portability-Footnote-1894770 +Node: I18N Example894833 +Ref: I18N Example-Footnote-1898108 +Ref: I18N Example-Footnote-2898181 +Node: Gawk I18N898290 +Node: I18N Summary898939 +Node: Debugger900280 +Node: Debugging901280 +Node: Debugging Concepts901721 +Node: Debugging Terms903530 +Node: Awk Debugging906105 +Ref: Awk Debugging-Footnote-1907050 +Node: Sample Debugging Session907182 +Node: Debugger Invocation907716 +Node: Finding The Bug909102 +Node: List of Debugger Commands915576 +Node: Breakpoint Control916909 +Node: Debugger Execution Control920603 +Node: Viewing And Changing Data923965 +Node: Execution Stack927506 +Node: Debugger Info929143 +Node: Miscellaneous Debugger Commands933214 +Node: Readline Support938276 +Node: Limitations939172 +Node: Debugging Summary941726 +Node: Namespaces943005 +Node: Global Namespace944116 +Node: Qualified Names945514 +Node: Default Namespace946513 +Node: Changing The Namespace947254 +Node: Naming Rules948868 +Node: Internal Name Management950716 +Node: Namespace Example951758 +Node: Namespace And Features954320 +Node: Namespace Summary955755 +Node: Arbitrary Precision Arithmetic957232 +Node: Computer Arithmetic958719 +Ref: table-numeric-ranges962485 +Ref: table-floating-point-ranges962978 +Ref: Computer Arithmetic-Footnote-1963636 +Node: Math Definitions963693 +Ref: table-ieee-formats967009 +Ref: Math Definitions-Footnote-1967612 +Node: MPFR features967717 +Node: FP Math Caution969435 +Ref: FP Math Caution-Footnote-1970507 +Node: Inexactness of computations970876 +Node: Inexact representation971836 +Node: Comparing FP Values973196 +Node: Errors accumulate974437 +Node: Getting Accuracy975870 +Node: Try To Round978580 +Node: Setting precision979479 +Ref: table-predefined-precision-strings980176 +Node: Setting the rounding mode982006 +Ref: table-gawk-rounding-modes982380 +Ref: Setting the rounding mode-Footnote-1986311 +Node: Arbitrary Precision Integers986490 +Ref: Arbitrary Precision Integers-Footnote-1989665 +Node: Checking for MPFR989814 +Node: POSIX Floating Point Problems991288 +Ref: POSIX Floating Point Problems-Footnote-1995573 +Node: Floating point summary995611 +Node: Dynamic Extensions997801 +Node: Extension Intro999354 +Node: Plugin License1000620 +Node: Extension Mechanism Outline1001417 +Ref: figure-load-extension1001856 +Ref: figure-register-new-function1003421 +Ref: figure-call-new-function1004513 +Node: Extension API Description1006575 +Node: Extension API Functions Introduction1008288 +Ref: table-api-std-headers1010124 +Node: General Data Types1014373 +Ref: General Data Types-Footnote-11023003 +Node: Memory Allocation Functions1023302 +Ref: Memory Allocation Functions-Footnote-11027803 +Node: Constructor Functions1027902 +Node: API Ownership of MPFR and GMP Values1031368 +Node: Registration Functions1032681 +Node: Extension Functions1033381 +Node: Exit Callback Functions1038703 +Node: Extension Version String1039953 +Node: Input Parsers1040616 +Node: Output Wrappers1053337 +Node: Two-way processors1057849 +Node: Printing Messages1060114 +Ref: Printing Messages-Footnote-11061285 +Node: Updating ERRNO1061438 +Node: Requesting Values1062177 +Ref: table-value-types-returned1062914 +Node: Accessing Parameters1063850 +Node: Symbol Table Access1065087 +Node: Symbol table by name1065599 +Ref: Symbol table by name-Footnote-11068623 +Node: Symbol table by cookie1068751 +Ref: Symbol table by cookie-Footnote-11072936 +Node: Cached values1073000 +Ref: Cached values-Footnote-11076536 +Node: Array Manipulation1076689 +Ref: Array Manipulation-Footnote-11077780 +Node: Array Data Types1077817 +Ref: Array Data Types-Footnote-11080475 +Node: Array Functions1080567 +Node: Flattening Arrays1085065 +Node: Creating Arrays1092041 +Node: Redirection API1096808 +Node: Extension API Variables1099641 +Node: Extension Versioning1100352 +Ref: gawk-api-version1100781 +Node: Extension GMP/MPFR Versioning1102512 +Node: Extension API Informational Variables1104140 +Node: Extension API Boilerplate1105213 +Node: Changes from API V11109187 +Node: Finding Extensions1110759 +Node: Extension Example1111318 +Node: Internal File Description1112116 +Node: Internal File Ops1116196 +Ref: Internal File Ops-Footnote-11127546 +Node: Using Internal File Ops1127686 +Ref: Using Internal File Ops-Footnote-11130069 +Node: Extension Samples1130343 +Node: Extension Sample File Functions1131872 +Node: Extension Sample Fnmatch1139521 +Node: Extension Sample Fork1141008 +Node: Extension Sample Inplace1142226 +Node: Extension Sample Ord1145851 +Node: Extension Sample Readdir1146687 +Ref: table-readdir-file-types1147576 +Node: Extension Sample Revout1148643 +Node: Extension Sample Rev2way1149232 +Node: Extension Sample Read write array1149972 +Node: Extension Sample Readfile1151914 +Node: Extension Sample Time1153009 +Node: Extension Sample API Tests1154761 +Node: gawkextlib1155253 +Node: Extension summary1158171 +Node: Extension Exercises1161873 +Node: Language History1163115 +Node: V7/SVR3.11164771 +Node: SVR41166923 +Node: POSIX1168357 +Node: BTL1169738 +Node: POSIX/GNU1170467 +Node: Feature History1176245 +Node: Common Extensions1192564 +Node: Ranges and Locales1193847 +Ref: Ranges and Locales-Footnote-11198463 +Ref: Ranges and Locales-Footnote-21198490 +Ref: Ranges and Locales-Footnote-31198725 +Node: Contributors1198948 +Node: History summary1204945 +Node: Installation1206325 +Node: Gawk Distribution1207269 +Node: Getting1207753 +Node: Extracting1208716 +Node: Distribution contents1210354 +Node: Unix Installation1216834 +Node: Quick Installation1217516 +Node: Shell Startup Files1219930 +Node: Additional Configuration Options1221019 +Node: Configuration Philosophy1223334 +Node: Non-Unix Installation1225703 +Node: PC Installation1226163 +Node: PC Binary Installation1227001 +Node: PC Compiling1227436 +Node: PC Using1228553 +Node: Cygwin1232106 +Node: MSYS1233330 +Node: VMS Installation1233932 +Node: VMS Compilation1234723 +Ref: VMS Compilation-Footnote-11235952 +Node: VMS Dynamic Extensions1236010 +Node: VMS Installation Details1237695 +Node: VMS Running1239948 +Node: VMS GNV1244227 +Node: VMS Old Gawk1244962 +Node: Bugs1245433 +Node: Bug address1246096 +Node: Usenet1249078 +Node: Maintainers1250082 +Node: Other Versions1251267 +Node: Installation summary1258355 +Node: Notes1259564 +Node: Compatibility Mode1260358 +Node: Additions1261140 +Node: Accessing The Source1262065 +Node: Adding Code1263502 +Node: New Ports1269721 +Node: Derived Files1274096 +Ref: Derived Files-Footnote-11279756 +Ref: Derived Files-Footnote-21279791 +Ref: Derived Files-Footnote-31280389 +Node: Future Extensions1280503 +Node: Implementation Limitations1281161 +Node: Extension Design1282371 +Node: Old Extension Problems1283515 +Ref: Old Extension Problems-Footnote-11285033 +Node: Extension New Mechanism Goals1285090 +Ref: Extension New Mechanism Goals-Footnote-11288454 +Node: Extension Other Design Decisions1288643 +Node: Extension Future Growth1290756 +Node: Notes summary1291362 +Node: Basic Concepts1292520 +Node: Basic High Level1293201 +Ref: figure-general-flow1293483 +Ref: figure-process-flow1294168 +Ref: Basic High Level-Footnote-11297469 +Node: Basic Data Typing1297654 +Node: Glossary1300982 +Node: Copying1332867 +Node: GNU Free Documentation License1370410 +Node: Index1395530 End Tag Table diff --git a/doc/gawk.texi b/doc/gawk.texi index fdeb01ed..90146b9f 100644 --- a/doc/gawk.texi +++ b/doc/gawk.texi @@ -25337,7 +25337,7 @@ is to search using BREs. You use @command{-E} to specify the use of EREs, and @option{-F} to specify searching for fixed strings. In practice, systems continue to come with separate @command{egrep} -and @command{fgrep} utilities, for backwards compatibilty. This +and @command{fgrep} utilities, for backwards compatibility. This @value{SECTION} provides an @command{awk} implementation of @command{egrep}, which supports all of the POSIX-mandated options. You invoke it as follows: diff --git a/doc/gawkinet.info b/doc/gawkinet.info index 4de7cf0a..626048fa 100644 --- a/doc/gawkinet.info +++ b/doc/gawkinet.info @@ -2894,7 +2894,7 @@ variables. The following conventions are used: Now it's clear what happens to the 'Label' parameter of the function 'migrate()'. It is copied into 'MOBVAR["Label"]' and travels alongside -the other data. Since travelling takes place via HTTP, records must be +the other data. Since traveling takes place via HTTP, records must be separated with '"\r\n"' in 'RS' and 'ORS' as usual. The code assembly for migration takes place in three steps: @@ -4394,12 +4394,12 @@ Node: STATIST104830 Ref: STATIST-Footnote-1117982 Node: MAZE118427 Node: MOBAGWHO124634 -Ref: MOBAGWHO-Footnote-1138652 -Node: STOXPRED138707 -Node: PROTBASE152995 -Node: Links166111 -Node: GNU Free Documentation License169544 -Node: Index194664 +Ref: MOBAGWHO-Footnote-1138651 +Node: STOXPRED138706 +Node: PROTBASE152994 +Node: Links166110 +Node: GNU Free Documentation License169543 +Node: Index194663 End Tag Table diff --git a/doc/gawkinet.texi b/doc/gawkinet.texi index 91c222be..2bb22d93 100644 --- a/doc/gawkinet.texi +++ b/doc/gawkinet.texi @@ -3507,7 +3507,7 @@ takes part in migration has to be an element of this array. Now it's clear what happens to the @code{Label} parameter of the function @code{migrate()}. It is copied into @code{MOBVAR["Label"]} and -travels alongside the other data. Since travelling takes place via HTTP, +travels alongside the other data. Since traveling takes place via HTTP, records must be separated with @code{"\r\n"} in @code{RS} and @code{ORS} as usual. The code assembly for migration takes place in three steps: diff --git a/doc/gawktexi.in b/doc/gawktexi.in index 1f639334..ae1d0bc4 100644 --- a/doc/gawktexi.in +++ b/doc/gawktexi.in @@ -24347,7 +24347,7 @@ is to search using BREs. You use @command{-E} to specify the use of EREs, and @option{-F} to specify searching for fixed strings. In practice, systems continue to come with separate @command{egrep} -and @command{fgrep} utilities, for backwards compatibilty. This +and @command{fgrep} utilities, for backwards compatibility. This @value{SECTION} provides an @command{awk} implementation of @command{egrep}, which supports all of the POSIX-mandated options. You invoke it as follows: diff --git a/doc/wordlist b/doc/wordlist index 3b5f579f..d3aea0be 100644 --- a/doc/wordlist +++ b/doc/wordlist @@ -4,7 +4,6 @@ ABC ABCDEFGHIJKLMNOPQRSTUVWXYZ ABCXYabcdxyz ACLs -ACM ADR AF ANDing @@ -21,14 +20,11 @@ AWKBUFSIZE AWKLIBPATH AWKPATH AWKREADFUNC -Acknowledgements -Adams's AdditionalResources Affero Aharon Aho Akim -Anders Andreas Argind Assaf @@ -46,18 +42,15 @@ BEGINFILE BEL BINMODE BLKSIZE +BREs BSIZE BTL BWK Banzai BeOS -Bentley's Benzinger -Bitwise Bleah Bornstein -Bourne -Breakpoint Brin's Brini Brini's @@ -77,7 +70,6 @@ CEST CFLAGS CGI CHEM -CMP COMFOLLOW COMMONEXT CONFIG @@ -86,7 +78,6 @@ CRC CRTL CSV CTYPE -Callback Cc Chana ChangeLog @@ -98,7 +89,6 @@ Cloutier Cn Co Collado -Constant's Coprocess Coprocesses Coreutils @@ -115,7 +105,6 @@ DDF DEV DF DFA -DGAWK DHAVE DIR DJGPP @@ -123,11 +112,8 @@ DK DST DTD DVI -Datafile Davide Davide's -Decrement -Decrementing Deifik Demaille Dinline @@ -135,15 +121,10 @@ Drepper Duman Dupword EAGAIN -EBCDIC EC EINTR -EMISTERED EMRED -EMX ENDFILE -ENVIRON -EOF EREs ERRNO ESC @@ -151,15 +132,12 @@ EST ETIMEDOUT EWOULDBLOCK EY -Eberhard Ec Ee Efraim Eggert Egrep Embeddable -Emptor -Executables Exp Expat Ey @@ -168,9 +146,7 @@ FD FDL FF FFN -FHS FIELDWIDTHS -FILENAME FIXME FN FNM @@ -180,21 +156,16 @@ FORmula FP FPAT FS -FSF -FSF's FTS FULLXREF FUNCTAB Fabi Fabius Fenlason -Filename Filetrans Fnames Fnmatch -Formatter Formfeed -Fortran FreeBSD Friedl GAWKINETTITLE @@ -205,7 +176,6 @@ GETGRENT GMP GMT GNITS -GNU's GNV GPL GR @@ -214,7 +184,7 @@ GetSystemTimeAsFileTime Getline Getlocaltime Getopt -GitHub +Ggnru Grigera Groucho GyeoNxTFby @@ -231,11 +201,10 @@ Haque Hartholz Hasegawa Hermann -Hitchhiker's Hoare's Hurd -Hurray IA +IDs IFBLK IFCHR IFDIR @@ -256,7 +225,6 @@ ISCHR ISLNK Igawk Illumos -Incrementing Inf Init Inited @@ -274,7 +242,6 @@ JVM Jaegermann Jannick Jeroen -Johansen Johansen's Jul Jun @@ -283,19 +250,15 @@ Kahrs Kai Kasal Kenobi -Kernighan -Kernighan's Korn Krauze Kwityn Kwok LARGEFILE LC -LDFLAGS LEQ LF LGPL -LIBS LINENO LXIX Langston @@ -307,8 +270,6 @@ Lvalue MALLOC MAXLINES MC -MERCHANTABILITY -MINGW MIPS MKS MMC @@ -323,8 +284,6 @@ MSG MSYS MVX MW -Makefile -Makefiles Malka Malmberg MathWorld @@ -358,7 +317,6 @@ NT NUMCUR NaN Nachum -NeXT Neacsu Neacsu's NetBSD @@ -373,13 +331,11 @@ Nonduplicated Noninteractive Nonoption Nov -O'Reilly ODS OFMT OFS OI OM -OMF ORG ORS OU @@ -405,16 +361,12 @@ Ou Oy PASSWD PATCHLEVEL -PATHNAME PCPU PCSI PDF PEBKAC PNG POS -POSIX -POSIXLY -PP PQgetvalue PREC PROCINFO @@ -423,36 +375,27 @@ PW PWD Panos Papadopoulos -Parsers Passwd Peifer PiFormulas Plauger -Plugin PostScript PostgreSQL Postprocessing -PowerPC Pr Pre Preopened -Preprocessor Prestandard Printf -Prolog QSE QSINGLE QTawk Quanstrom Quicksort QuikTrim -RANLIB -README REGEX -RELICENSING REVOUT RLENGTH -RMS ROUNDMODE RRI RSTART @@ -463,16 +406,12 @@ RapidJson Readdir Readfile Readline -Redirections -Redis Regex Regexp Regexps -Reimplementing Retryable Revout RiscOS -Ritchie Rivka Rvalue SA @@ -483,7 +422,6 @@ SIGHUP SIGINT SIGQUIT SIGUSR -SPARC SRC SS SSC @@ -510,11 +448,8 @@ Significand Skywalker Smalltalk Smallville -Solaris -Stallman Std Stepan -Stewartson's Strnum Strtonum Subarrays @@ -522,7 +457,6 @@ Sublicensing SunOS SylvestersSequence TABs -TCP TEXTDOMAIN TIDYMEM TM @@ -531,45 +465,33 @@ TRANslator TZ Tcl Texinfo -Timestamp Topher Toporek Trueman UC -UDP UI -UNIXROOT +ULONG USR UTC UTF -Ubuntu Ulrich -Ultrix -Unary -Uncomment Uniq Uwe VER -VMS VT -Vax Versioning Vinschen WIPO Walamazoo Wallin -Wasserman Watchpoint Wc -Weinberger Weinberger's Weisstein Wfile Wfoo WhidbeyNet -Whitespace Whoope -Wikipedia Woehlke Wsource Wversion @@ -588,14 +510,9 @@ Za Zaphod Zaretskii Zaretskii's -Zcrtdll Zeichen Zeichenkette -Zlinker -Zmt -Zomf Zoulas -Zstack aB aCa aIt @@ -621,7 +538,6 @@ abs abx ac acbfoo -acknowledgements aclocal addrs adm @@ -652,7 +568,6 @@ andrewsumner andspan andy anthony -apache api appendixsec appendixsubsec @@ -661,7 +576,6 @@ approx aqb aqc ar -arctangent arg argc args @@ -736,7 +650,6 @@ bigskip bindtextdomain binmode bisonfix -bitwise blabber blabbers blabby @@ -749,26 +662,21 @@ blockdev blockquote blocksize bool -boolean boundar br brabble brabbles branchname -breakpoint brennan brent brini broderick bt -btl buening buf bufsize buildable -builtin busybox -bwk bwkawk bycount bygid @@ -777,8 +685,6 @@ byuid bz bzip cAsE -callback -callbacks calloc caltech camelot @@ -796,7 +702,6 @@ cd cde cdot ce -centerline cgi cgit cgiwrap @@ -812,6 +717,7 @@ chien chmod chown chr +cilnqsvx cinaP cinap cindex @@ -837,7 +743,6 @@ colname colsep colspec columnfractions -colwidth com comcast commandline @@ -860,16 +765,12 @@ copyrightable coreutils cos cosmogen -counterintuitive -cozx cp cplusplus cr -cron csh cssun csv -csvil ctime cul curdir @@ -882,8 +783,6 @@ daabaaa daburashka danfuzz dartmouth -datadir -datafile datafiles datespec dave @@ -895,36 +794,27 @@ dcngettext dd ddd de -deallocations debuggee -debugger's decommented -decrement -decrementing def del delarray delim -delorie denorm depcomp desc descrip deserialize -designator dest -destructors detailmenu dev devbsize -dfa dfn dgawk dict diff diffs digts -dimensioned dir dircategory direntry @@ -932,7 +822,6 @@ distributable div djgpp dl -dlload dlopen dlsym dn @@ -941,12 +830,10 @@ dom dont dorking doug -dpitts dportein dps dresdnerbank drwxr -dtect dumparray duncan dup @@ -960,7 +847,6 @@ eg egid egrep eklye -el elem elif eliz @@ -969,10 +855,7 @@ emalloc embeddable emory emph -emptor -emxomfar en -encodings enddots endfile endgrent @@ -983,7 +866,6 @@ endpwent enrichening enum env -environ eof eql equiv @@ -999,16 +881,11 @@ euid eval evenheading exe -execl -executables -exepack exitval exp expat expr ext -extenders -extern ezalloc ezwinports fPIC @@ -1024,6 +901,7 @@ ferror fffffffffff fffffffffffd fflush +fgrep fi fieldlist fieldpat @@ -1033,13 +911,8 @@ fifo filedata filefuncs filelist -filename -filenames fileno fileref -filesystem -filesystem's -filesystems filetype filll finalout @@ -1049,6 +922,7 @@ finx firstname flac flist +fmod fmode fn fname @@ -1062,8 +936,6 @@ foobar foooo foooobazbarrrrr fopen -formatter -formatters formfeed fp fpat @@ -1139,14 +1011,15 @@ gnv goawk golang goldberg -goodie -goto gr grcat +grent grep groff groupawk +groupnames groupsbyuser +groupset grp gst gsub @@ -1156,8 +1029,6 @@ gvim gz gzip halign -hankedr -hardcoded hboxes headitem helpfull @@ -1168,8 +1039,6 @@ hhhh hhob histsort hlp -hobbes -hodge hotmail hpmuseum hrule @@ -1209,20 +1078,16 @@ igawk iggy ileaf illumos +ilnqsvx imagedata imageobject -implementers -implementors inbuf -incrementing ind indirectcall indx inelegancies inet -inexactitude inf -infodir inforef informaltable infusarum @@ -1230,8 +1095,6 @@ ing ington init inited -initializations -inline inlinefmt inlineraw inmargin @@ -1244,7 +1107,6 @@ int intdiv interline internl -interprocess io iobuf isarray @@ -1274,7 +1136,6 @@ juan julie karl katie -kb kbd kilgrona kmem @@ -1292,15 +1153,13 @@ le lefthand len leq -lex +lexico lf lflashlight -lgcc lgpl lhs li libexec -libexecdir libintl libmawk libtool @@ -1313,7 +1172,6 @@ linkend linksize linkval lintwarn -linux listsize literallayout localhost @@ -1336,21 +1194,15 @@ lvalues lwall lwc madronabluff -maintainer's makeinfo malloc malloced -mandir -matcher -matchers matchit mathcs mathworld mawk maxelt maxsub -mbfw -mbprintf mediaobject mem memcpy @@ -1366,7 +1218,6 @@ mingw miriam misc mit -mk mkdir mkinstalldirs mktime @@ -1412,8 +1263,6 @@ nInfo nLINE nOUCH nameend -namespace -namespaces namest nan nanosleep @@ -1424,7 +1273,6 @@ nboxes nbsp nc ncustomers -nd ndash ndevicesim ndirs @@ -1450,7 +1298,6 @@ nlink nls nmatches nmemb -nmsu nnn noalign noassign @@ -1470,7 +1317,6 @@ nonintegral noninteractive noninteractively nonmatching -nonnegative nonnumeric nonobvious nonoption @@ -1484,9 +1330,7 @@ nonrectangular nonrepeated nonspecial nonwhitespace -noone nr -nroff ns nul num @@ -1515,7 +1359,6 @@ onetrueawk onlinepubs oo op -opcodes openbsd openfortress opengroup @@ -1546,15 +1389,10 @@ pactechdata panos para param -parameterized parsedebug -parser's -parsers passwd passwdawk pathlist -pathname -pathnames pathto patsplit pawk @@ -1581,41 +1419,26 @@ pid pival pkgdatadir pkgextensiondir -plugin pm pmode png po -podge -portably posix -postfix postincrement pp ppid -pr pre prec -precedences -precisions prefaceinfo preformatted preopened -prepend -prepended -prepending -prepends prepinfo -preprocessor prev -princeton printf printindex printpage -priori proc processarray -profiler prog progfile pseudorandom @@ -1631,6 +1454,7 @@ putchar pw pwcat pwd +pwent pxref qb qc @@ -1643,7 +1467,6 @@ quicksort quiktrim quux rab -radians raincloud raison ramey @@ -1659,36 +1482,28 @@ readfile readline realloc recomputation -reddit redir -redirections reenable -regcomp regex -regexec regexp regexps -reimplementing relationals -relicensing reparsed repl repo -representable resplit ret retargetable -retitle retval revoutput revtwoway rfc rflashlight +rguid righthand rm rms ro -roundTiesToAway roundTiesToEven roundTowardNegative roundTowardPositive @@ -1700,8 +1515,7 @@ rshift rsort rt ru -runnable -runtime +ruid rvalues rw rwarray @@ -1711,14 +1525,12 @@ samp samuel sar savannah -sbcglobal sbin sbuf sc scanf scl scm -scottd sdot searchlist sed @@ -1733,25 +1545,20 @@ setlinebuf settitle sf sfx -shar shellquote shortdayname -shorthands shortmonth shorttitlepage showargs shu si -signedness significand -sim sizeof skeeve skynet slrn smallbook smallexample -smallskip smtp snmp snobol @@ -1764,12 +1571,10 @@ sourceforge sp spanname spanspec -spawnl sprintf sprintlink sq sqQ -sqrt srand src ssize @@ -1802,26 +1607,15 @@ strtonum struct subarray subarrays -subdirectories -subdirectory subentry -subexpression -subexpressions sublicense sublicenses -subscripting substr -substring -substrings subsubsection -subunit sudo summarycontents -superset -svil sylogin sym -symlink syncodeindex synindex sys @@ -1854,19 +1648,16 @@ testpasswd tew tex texi -texindex texinfo textdomain tgroup -th thead thes thischapter thisopt thispage thrudvang -timestamp -timestamps +tid timex titlepage tlines @@ -1876,14 +1667,10 @@ tmy tolower toupper tr -traceback tracy transfile -troff trunc -tst ttotal -tty ttyD ttyV ttyp @@ -1892,11 +1679,11 @@ ttyv tvpeople twords txt -typedef typeof tyw ucb udc +udcf udp uid ulink @@ -1904,13 +1691,10 @@ umask umb umich un -unary -uncommented undef undevicesimus undisplay unduplicated -unformatted unhandled unicode uniq @@ -1922,18 +1706,12 @@ unparenthesized unredirected unsetting unspecialize -untyped unwatch -unwritable uref urefurlonlylinktrue urgen url urlcolor -usebracesinindexestrue -usenet -username -usernames usleep usr ut @@ -1951,10 +1729,8 @@ variadic vbox vc vec -versa versioned vglue -vio vms vmsbuild vr @@ -1965,7 +1741,6 @@ walkarray washington wass watchpoint -watchpoints wb wc wcscoll @@ -1978,12 +1753,8 @@ whhhhy whhhy whhy whidbey -whitespace whizprog -wiki wikipedia -wildcard -wildcards wlv wnewmail wordfreq @@ -1998,7 +1769,6 @@ xFOO xX xaa xab -xalloc xbd xdeadBEEF xdigit @@ -2028,7 +1798,6 @@ xyzzy xz ya yabber -yacc yballs yearday ylwrap diff --git a/doc/wordlist2 b/doc/wordlist2 index fc192113..b576c483 100644 --- a/doc/wordlist2 +++ b/doc/wordlist2 @@ -7,30 +7,22 @@ CFLAGS ChangeLog Ctrl FIXME -FSF -FSF's GCC Gettext -GitHub ISBN Kahrs Libtool -Makefile PCC PDF Rebase Rebasing Repo -SVN TODO Ta Texinfo -Uncomment UsingGit -Workflow Yehezkel ac -apache api arnold arnoldrobbins @@ -41,7 +33,6 @@ automake autotools awk awkgram -builtin cd cindex com @@ -109,7 +100,6 @@ literallayout llvm ltu ludd -maintainer's makeinfo mpfr multiplestates @@ -150,6 +140,7 @@ srv ssh stderr stdout +subentry summarycontents sv syncodeindex @@ -165,6 +156,7 @@ tinycc titlepage tmp toto +ubuntu ui ulink unnumberedsec @@ -179,7 +171,6 @@ vms vr vskip wordpress -workflow worthwile www xref diff --git a/doc/wordlist3 b/doc/wordlist3 index 8b2ad03d..49aa0712 100644 --- a/doc/wordlist3 +++ b/doc/wordlist3 @@ -52,7 +52,6 @@ ORS OpenVMS PREC PROCINFO -PX RLENGTH ROUNDMODE RSTART @@ -68,7 +67,6 @@ TEXTDOMAIN TP Trueman UTC -Weinberger YYYY Za aB @@ -88,7 +86,6 @@ awkprof awkvars bignum bindtextdomain -builtin ch cmd cmp @@ -98,7 +95,6 @@ compl coprocess coprocesses cos -cygwin datespec dcgettext dcngettext @@ -169,7 +165,6 @@ logdir lport lq lshift -macosx metacharacter metacharacters min @@ -187,6 +182,7 @@ nmap nonsignificant nonwhitespace num +op org os parsedebug diff --git a/doc/wordlist4 b/doc/wordlist4 new file mode 100644 index 00000000..f267327a --- /dev/null +++ b/doc/wordlist4 @@ -0,0 +1,597 @@ +AA +ADR +ALINK +API +ARGC +ARGV +AWK +AXP +AboutELIZA +AboutServer +AvoidCount +Awk +Ayalon +BGCOLOR +BLASTService +BR +Boutell +CC +CELLPADDING +CEST +CGI +CNN +CSV +CTD +CatPipe +ChangeConfig +CheckConfig +CleanUp +ConfigFile +CorrectCount +DARKCORNER +DATALIB +DD +DDBJ +DECnet +DEF +DONT +DTD +Degeneres +DownCount +EK +EMBL +EPROMs +EQUIV +ElizaSays +EndOfMySelf +EnterParameters +Etzioni +FASTA +FDL +FFN +FIXME +FN +FS +FUNC +Fasta +Flannery +GAWK's +GETARG +GETURL +GNUPLOT +GNUPlot +GUIs +GenBank +GenInfo +GetHeader +GetThisHeader +GnuPlot +HD +HREF +HWP +HandleGET +Hethmon +Hoare +Hoare's +HotCount +HttpService +Humphrys +HyperText +IM +IMG +INTC +IPX +IPv +ISBN +IUB +IUPAC +IVE +Immuno +Init +Internetworking +JK +JNJ +JPG +JPM +Juergen +Jul +Jun +KAREL +KO +Kabat's +Kahrs +LF +Loebner +Loui +MCD +MMC +MMM +MOBAG +MOBAGWHO +MOBFUN +MOBVAR +MOT +MRK +MSFT +MailPipe +MakeMaze +MiniSQL +MobAg +MobCode +MobileAgent +Multiauthor +MyHost +MyInit +MyJob +MyOrigin +MyPort +MyPrefix +MyProxy +NBRF +NCBI +NCBI's +NF +NR +NetService +NeutralCount +NewLength +Nof +Nov +Novell's +ORS +Oren +PARAM +PARAMS +PARAMs +PATCHLEVEL +PDF +PG +PIR +PNG +POPService +POSIXed +PROT +PROTBASE +PS +Param +Perlis +PointLight +PostAgent +PostScript +Pragma +Prez +ProxyPort +REMCONF +RFCs +RP +RT +ReadConfig +ReadMySelf +ReadQuotes +Rumpelstilzchen +SA +SBC +SNMP +SPAK +SRC +STARTOFRANGE +STATIST +STOXPRED +SUBSEP +Salmagundi +SaveConfig +Sbjct +SendMail +Sep +SetUpEliza +SetUpServer +StartELIZA +StockCount +TD +TR +Tck +Tcl +Teukolsky +Texinfo +Tk +TopDoc +TopFooter +TopHeader +UL +UMBC +URI +URLCHK +URLfile +UTX +UpCount +VLINK +VRML +VRMLtest +Vetterling +WEBGRAB +WINNT +WMT +Waterman's +Weizenbaum +WorldWideWeb +XBM +XCF +XINU +XOM +XP +XSIZE +XYZ +YOURE +YOUVE +YSIZE +YahooData +YouSay +abcdef +acm +adelphia +adenosine +advperl +ai +ambientIntensity +amd +arnold +asc +ascii +asis +au +awk +awkforai +awkinet +bbs +bierce +bigskip +bioskills +bitcont +biz +blastcl +blastmail +blastn +blasturl +boutell +br +caccaccatggacagcaaa +canberra +cgi +cgilib +ch +chargen +charset +chayden +chrisc +cindex +codon +columnfractions +com +compapp +config +conj +cont +contrib +coprocess +copyleft +copyrightable +coreserv +cp +cr +crontab +csv +cytidine +dartmouth +datacount +daycount +dbj +dcu +dd +de +dec +defeasible +denhaag +deontic +detailmenu +dev +devvax +df +dfn +dict +diffuseColor +dir +dircategory +direntry +dist +ducktown +edu +eg +ek +eliza +emailhost +emb +embedpc +emph +endfile +epd +evenheading +exp +fakenode +fasta +ff +ffffff +fi +filenet +filll +finalout +fingerclient +fn +foo +fr +fsbassociates +fsf +ftest +gawcon +gawkinet +gawknet +gawnetf +gd +geninfo +getline +geturl +gif +gnl +gnuawk +gnuplot +gov +groundAngle +groundColor +gsub +guanine +halign +headitem +hexdigs +hfil +highgate +hrule +htm +html +htmlx +http +httpd +https +httpserver +hughes +humphrys +iX +ibeta +ibm +ie +ifhtml +ifinfo +ifnotinfo +ifnottex +iftex +igawk +inet +inetlib +inmargin +insertcopying +int +intc +intel +interline +introcb +invsqrt +ip +irc +iso +java +jp +jpl +kabat +kazusa +keto +keynes +kohala +laplace +len +lflashlight +li +libc +lifeisgood +lineo +linespace +linux +localhost +localport +loebner +loui +mailto +marx +mkdir +mobag +moritz +multiline +multitable +myhost +nAgent +nBEGIN +nThe +nThis +nasa +ncbi +netblast +netcon +netcraft +netfunny +netgawf +netgawk +netscape +netstat +nih +nl +nlm +nntp +noalign +nof +noindent +noncausal +noncommercially +nph +nr +nthese +nwe +oddheading +offinterlineskip +openURL +oreilly +org +overfulls +pF +paris +passwd +pdb +pdict +perl +pir +png +postoffice +pre +prepinfo +prf +printenv +printf +printindex +protbase +ps +pt +purdue +purine +pxref +pyrimidine +qold +rand +readnews +remconf +remoteport +rendez +retr +rf +rflashlight +rhf +rm +rstevens +rvices +samp +sapiens +sc +scriptics +sd +seealso +seeentry +serv +serweb +setTimeout +setchapternewpage +setfilename +settitle +sez +shtml +skeeve +skyAngle +skyColor +smallbook +smallexample +smtp +softbot +sp +spak +spinoza +spoonsful +sprintf +srand +statist +stderr +stdin +stdout +stoxdata +stoxpred +str +strftime +subentry +subj +subjold +sublicense +subnode +substr +subsubsection +suse +synchronicity +syncodeindex +synindex +systime +tcl +tcp +tcpcon +tcpip +technicalinfo +testserv +tex +texinfo +tgcttggctgaggagccataggacgagagcttcctggtgaagtgtgtttcttgaaatcat +tggtgaagtgtgtttcttg +thischapter +thispage +thttp +thymidine +titlepage +tjhsst +tmp +tolower +toupper +ttytst +tutest +txt +uclinux +udp +uk +ul +umbc +uname +unnumberedsec +unregarded +untp +uref +urgen +urgen's +uri +uridine +url +urlchk +userfriendly +utf +uthscsa +val +var +vars +vbox +vous +vr +vrml +vrule +vskip +webclient +webgrab +webser +webserx +wold +wotsit +wouldnt +wustl +www +xbm +xinu +xrds +youre +yrange diff --git a/support/ChangeLog b/support/ChangeLog index 5f6e7bc2..92caed29 100644 --- a/support/ChangeLog +++ b/support/ChangeLog @@ -1,3 +1,7 @@ +2020-09-24 Arnold D. Robbins <arnold@skeeve.com> + + * dfa.c, dfa.h: Synced from GNULIB. + 2020-09-18 Arnold D. Robbins <arnold@skeeve.com> * cdefs.h, dfa.c, intprops.h, regcomp.c, regex.h, regex_internal.h, diff --git a/support/dfa.c b/support/dfa.c index 641f422a..d47acfe2 100644 --- a/support/dfa.c +++ b/support/dfa.c @@ -3656,8 +3656,8 @@ free_mbdata (struct dfa *d) } /* Return true if every construct in D is supported by this DFA matcher. */ -static bool _GL_ATTRIBUTE_PURE -dfa_supported (struct dfa const *d) +bool +dfasupported (struct dfa const *d) { for (idx_t i = 0; i < d->tindex; i++) { @@ -3813,7 +3813,7 @@ dfacomp (char const *s, idx_t len, struct dfa *d, bool searchflag) dfassbuild (d); - if (dfa_supported (d)) + if (dfasupported (d)) { maybe_disable_superset_dfa (d); dfaanalyze (d, searchflag); diff --git a/support/dfa.h b/support/dfa.h index c5bff898..2f77f263 100644 --- a/support/dfa.h +++ b/support/dfa.h @@ -113,6 +113,9 @@ extern struct dfa *dfasuperset (struct dfa const *d) _GL_ATTRIBUTE_PURE; /* The DFA is likely to be fast. */ extern bool dfaisfast (struct dfa const *) _GL_ATTRIBUTE_PURE; +/* Return true if every construct in D is supported by this DFA matcher. */ +extern bool dfasupported (struct dfa const *) _GL_ATTRIBUTE_PURE; + /* Free the storage held by the components of a struct dfa. */ extern void dfafree (struct dfa *); |