From bc70de7b3302d5a81515b901cae376b8b51d2004 Mon Sep 17 00:00:00 2001
From: "Arnold D. Robbins"
Date: Fri, 16 Jul 2010 13:09:56 +0300
Subject: Move to gawk-3.1.0.
---
doc/gawkinet.info | 4246 +++++++++++++++++++++++++++++++++++++++++++++++++++++
1 file changed, 4246 insertions(+)
create mode 100644 doc/gawkinet.info
(limited to 'doc/gawkinet.info')
diff --git a/doc/gawkinet.info b/doc/gawkinet.info
new file mode 100644
index 00000000..3d5e5d3f
--- /dev/null
+++ b/doc/gawkinet.info
@@ -0,0 +1,4246 @@
+This is gawkinet.info, produced by makeinfo version 4.0 from
+gawkinet.texi.
+
+INFO-DIR-SECTION GNU Packages
+START-INFO-DIR-ENTRY
+* Gawkinet: (gawkinet). TCP/IP Internetworking With `gawk'.
+END-INFO-DIR-ENTRY
+
+ This file documents the networking features in GNU `awk'.
+
+ This is Edition 1.1 of `TCP/IP Internetworking With `gawk'', for the
+3.1.0 (or later) version of the GNU implementation of AWK.
+
+ Copyright (C) 2000, 2001 Free Software Foundation, Inc.
+
+ Permission is granted to copy, distribute and/or modify this document
+under the terms of the GNU Free Documentation License, Version 1.1 or
+any later version published by the Free Software Foundation; with the
+Invariant Sections being "GNU General Public License", the Front-Cover
+texts being (a) (see below), and with the Back-Cover Texts being (b)
+(see below). A copy of the license is included in the section entitled
+"GNU Free Documentation License".
+
+ a. "A GNU Manual"
+
+ b. "You have freedom to copy and modify this GNU Manual, like GNU
+ software. Copies published by the Free Software Foundation raise
+ funds for GNU development."
+
+
+File: gawkinet.info, Node: Top, Next: Preface, Prev: (dir), Up: (dir)
+
+General Introduction
+********************
+
+ This file documents the networking features in GNU Awk (`gawk')
+version 3.1 and later.
+
+* Menu:
+
+* Preface:: About this document.
+* Introduction:: About networkiing.
+* Using Networking:: Some examples.
+* Some Applications and Techniques:: More extended examples.
+* Links:: Where to find the stuff mentioned in this
+ document.
+* GNU Free Documentation License:: The license for this document.
+* Index:: The index.
+
+* Stream Communications:: Sending data streams.
+* Datagram Communications:: Sending self-contained messages.
+* The TCP/IP Protocols:: How these models work in the Internet.
+* Basic Protocols:: The basic protocols.
+* Ports:: The idea behind ports.
+* Making Connections:: Making TCP/IP connections.
+* Gawk Special Files:: How to do `gawk' networking.
+* Special File Fields:: The fields in the special file name.
+* Comparing Protocols:: Differences between the protocols.
+* File /inet/tcp:: The TCP special file.
+* File /inet/udp:: The UDB special file.
+* File /inet/raw:: The RAW special file.
+* TCP Connecting:: Making a TCP connection.
+* Troubleshooting:: Troubleshooting TCP/IP connections.
+* Interacting:: Interacting with a service.
+* Setting Up:: Setting up a service.
+* Email:: Reading email.
+* Web page:: Reading a Web page.
+* Primitive Service:: A primitive Web service.
+* Interacting Service:: A Web service with interaction.
+* CGI Lib:: A simple CGI library.
+* Simple Server:: A simple Web server.
+* Caveats:: Network programming caveats.
+* Challenges:: Where to go from here.
+* PANIC:: An Emergency Web Server.
+* GETURL:: Retrieving Web Pages.
+* REMCONF:: Remote Configuration Of Embedded Systems.
+* URLCHK:: Look For Changed Web Pages.
+* WEBGRAB:: Extract Links From A Page.
+* STATIST:: Graphing A Statistical Distribution.
+* MAZE:: Walking Through A Maze In Virtual Reality.
+* MOBAGWHO:: A Simple Mobile Agent.
+* STOXPRED:: Stock Market Prediction As A Service.
+* PROTBASE:: Searching Through A Protein Database.
+
+
+File: gawkinet.info, Node: Preface, Next: Introduction, Prev: Top, Up: Top
+
+Preface
+*******
+
+ In May of 1997, Ju"rgen Kahrs felt the need for network access from
+`awk', and, with a little help from me, set about adding features to do
+this for `gawk'. At that time, he wrote the bulk of this Info file.
+
+ The code and documentation were added to the `gawk' 3.1 development
+tree, and languished somewhat until I could finally get down to some
+serious work on that version of `gawk'. This finally happened in the
+middle of 2000.
+
+ Meantime, Ju"rgen wrote an article about the Internet special files
+and `|&' operator for `Linux Journal', and made a networking patch for
+the production versions of `gawk' available from his home page. In
+August of 2000 (for `gawk' 3.0.6), this patch also made it to the main
+GNU `ftp' distribution site.
+
+ For release with `gawk', I edited Ju"rgen's prose for English
+grammar and style, as he is not a native English speaker. I also
+rearranged the material somewhat for what I felt was a better order of
+presentation, and (re)wrote some of the introductory material.
+
+ The majority of this document and the code are his work, and the
+high quality and interesting ideas speak for themselves. It is my hope
+that these features will be of significant value to the `awk' community.
+
+
+Arnold Robbins
+Nof Ayalon, ISRAEL
+March, 2001
+
+
+File: gawkinet.info, Node: Introduction, Next: Using Networking, Prev: Preface, Up: Top
+
+Networking Concepts
+*******************
+
+ This major node provides a (necessarily) brief intoduction to
+computer networking concepts. For many applications of `gawk' to
+TCP/IP networking, we hope that this is enough. For more advanced
+tasks, you will need deeper background, and it may be necessary to
+switch to lower-level programming in C or C++.
+
+ There are two real-life models for the way computers send messages
+to each other over a network. While the analogies are not perfect,
+they are close enough to convey the major concepts. These two models
+are the phone system (reliable byte-stream communications), and the
+postal system (best-effort datagrams).
+
+* Menu:
+
+* Stream Communications:: Sending data streams.
+* Datagram Communications:: Sending self-contained messages.
+* The TCP/IP Protocols:: How these models work in the Internet.
+* Making Connections:: Making TCP/IP connections.
+
+
+File: gawkinet.info, Node: Stream Communications, Next: Datagram Communications, Prev: Introduction, Up: Introduction
+
+Reliable Byte-streams (Phone Calls)
+===================================
+
+ When you make a phone call, the following steps occur:
+
+ 1. You dial a number.
+
+ 2. The phone system connects to the called party, telling them there
+ is an incoming call. (Their phone rings.)
+
+ 3. The other party answers the call, or, in the case of a computer
+ network, refuses to answer the call.
+
+ 4. Assuming the other party answers, the connection between you is
+ now a "duplex" (two-way), "reliable" (no data lost), sequenced
+ (data comes out in the order sent) data stream.
+
+ 5. You and your friend may now talk freely, with the phone system
+ moving the data (your voices) from one end to the other. From
+ your point of view, you have a direct end-to-end connection with
+ the person on the other end.
+
+ The same steps occur in a duplex reliable computer networking
+connection. There is considerably more overhead in setting up the
+communications, but once it's done, data moves in both directions,
+reliably, in sequence.
+
+
+File: gawkinet.info, Node: Datagram Communications, Next: The TCP/IP Protocols, Prev: Stream Communications, Up: Introduction
+
+Best-effort Datagrams (Mailed Letters)
+======================================
+
+ Suppose you mail three different documents to your office on the
+other side of the country on two different days. Doing so entails the
+following.
+
+ 1. Each document travels in its own envelope.
+
+ 2. Each envelope contains both the sender and the recipient address.
+
+ 3. Each envelope may travel a different route to its destination.
+
+ 4. The envelopes may arrive in a different order from the one in
+ which they were sent.
+
+ 5. One or more may get lost in the mail. (Although, fortunately,
+ this does not occur very often.)
+
+ 6. In a computer network, one or more "packets" may also arrive
+ multiple times. (This doesn't happen with the postal system!)
+
+
+ The important characteristics of datagram communications, like those
+of the postal system are thus:
+
+ * Delivery is "best effort;" the data may never get there.
+
+ * Each message is self-contained, including the source and
+ destination addresses.
+
+ * Delivery is _not_ sequenced; packets may arrive out of order,
+ and/or multiple times.
+
+ * Unlike the phone system, overhead is considerably lower. It is
+ not necessary to set up the call first.
+
+ The price the user pays for the lower overhead of datagram
+communications is exactly the lower reliability; it is often necessary
+for user-level protocols that use datagram communications to add their
+own reliabilty features on top of the basic communications.
+
+
+File: gawkinet.info, Node: The TCP/IP Protocols, Next: Making Connections, Prev: Datagram Communications, Up: Introduction
+
+The Internet Protocols
+======================
+
+ The Internet Protocol Suite (usually referred as just TCP/IP)(1)
+consists of a number of different protocols at different levels or
+"layers." For our purposes, three protocols provide the fundamental
+communications mechanisms. All other defined protocols are referred to
+as user-level protocols (e.g., HTTP, used later in this Info file).
+
+* Menu:
+
+* Basic Protocols:: The basic protocols.
+* Ports:: The idea behind ports.
+
+ ---------- Footnotes ----------
+
+ (1) It should be noted that although the Internet seems to have
+conquered the world, there are other networking protocol suites in
+existence and in use.
+
+
+File: gawkinet.info, Node: Basic Protocols, Next: Ports, Prev: The TCP/IP Protocols, Up: The TCP/IP Protocols
+
+The Basic Internet Protocols
+----------------------------
+
+IP
+ The Internet Protocol. This protocol is almost never used
+ directly by applications. It provides the basic packet delivery
+ and routing infrastructure of the Internet. Much like the phone
+ company's switching centers or the Post Office's trucks, it is not
+ of much day-to-day interest to the regular user (or programmer).
+ It happens to be a best effort datagram protocol.
+
+UDP
+ The User Datagram Protocol. This is a best effort datagram
+ protocol. It provides a small amount of extra reliability over
+ IP, and adds the notion of "ports", described in *Note TCP and UDP
+ Ports: Ports.
+
+TCP
+ The Transmission Control Protocol. This is a duplex, reliable,
+ sequenced byte-stream protocol, again layered on top of IP, and
+ also providing the notion of ports. This is the protocol that you
+ will most likely use when using `gawk' for network programming.
+
+ All other user-level protocols use either TCP or UDP to do their
+basic communications. Examples are SMTP (Simple Mail Transfer
+Protocol), FTP (File Transfer Protocol) and HTTP (HyperText Transfer
+Protocol).
+
+
+File: gawkinet.info, Node: Ports, Prev: Basic Protocols, Up: The TCP/IP Protocols
+
+TCP and UDP Ports
+-----------------
+
+ In the postal system, the address on an envelope indicates a physical
+location, such as a residence or office building. But there may be
+more than one person at the location; thus you have to further quantify
+the recipient by putting a person or company name on the envelope.
+
+ In the phone system, one phone number may represent an entire
+company, in which case you need a person's extension number in order to
+reach that individual directly. Or, when you call a home, you have to
+say, "May I please speak to ..." before talking to the person directly.
+
+ IP networking provides the concept of addressing. An IP address
+represents a particular computer, but no more. In order to reach the
+mail service on a system, or the FTP or WWW service on a system, you
+have to have some way to further specify which service you want. In
+the Internet Protocol suite, this is done with "port numbers", which
+represent the services, much like an extension number used with a phone
+number.
+
+ Port numbers are 16-bit integers. Unix and Unix-like systems
+reserve ports below 1024 for "well known" services, such as SMTP, FTP,
+and HTTP. Numbers above 1024 may be used by any application, although
+there is no promise made that a particular port number is always
+available.
+
+
+File: gawkinet.info, Node: Making Connections, Prev: The TCP/IP Protocols, Up: Introduction
+
+Making TCP/IP Connections (And Some Terminology)
+================================================
+
+ Two terms come up repeatedly when discussing networking: "client"
+and "server". For now, we'll discuss these terms at the "connection
+level", when first establishing connections between two processes on
+different systems over a network. (Once the connection is established,
+the higher level, or "application level" protocols, such as HTTP or
+FTP, determine who is the client and who is the server. Often, it
+turns out that the client and server are the same in both roles.)
+
+ The "server" is the system providing the service, such as the web
+server or email server. It is the "host" (system) which is _connected
+to_ in a transaction. For this to work though, the server must be
+expecting connections. Much as there has to be someone at the office
+building to answer the phone(1), the server process (usually) has to be
+started first and waiting for a connection.
+
+ The "client" is the system requesting the service. It is the system
+_initiating the connection_ in a transaction. (Just as when you pick
+up the phone to call an office or store.)
+
+ In the TCP/IP framework, each end of a connection is represented by
+a pair of (ADDRESS, PORT) pairs. For the duration of the connection,
+the ports in use at each end are unique, and cannot be used
+simultaneously by other processes on the same system. (Only after
+closing a connection can a new one be built up on the same port. This
+is contrary to the usual behavior of fully developed web servers which
+have to avoid situations in which they are not reachable. We have to
+pay this price in order to enjoy the benefits of a simple communication
+paradigm in `gawk'.)
+
+ Furthermore, once the connection is established, communications are
+"synchronous". I.e., each end waits on the other to finish
+transmitting, before replying. This is much like two people in a phone
+conversation. While both could talk simultaneously, doing so usually
+doesn't work too well.
+
+ In the case of TCP, the synchronicity is enforced by the protocol
+when sending data. Data writes "block" until the data have been
+received on the other end. For both TCP and UDP, data reads block
+until there is incoming data waiting to be read. This is summarized in
+the following table, where an "X" indicates that the given action
+blocks.
+
+TCP X X
+UDP X
+RAW X
+
+ ---------- Footnotes ----------
+
+ (1) In the days before voice mail systems!
+
+
+File: gawkinet.info, Node: Using Networking, Next: Some Applications and Techniques, Prev: Introduction, Up: Top
+
+Networking With `gawk'
+**********************
+
+ The `awk' programming language was originally developed as a
+pattern-matching language for writing short programs to perform data
+manipulation tasks. `awk''s strength is the manipulation of textual
+data that is stored in files. It was never meant to be used for
+networking purposes. To exploit its features in a networking context,
+it's necessary to use an access mode for network connections that
+resembles the access of files as closely as possible.
+
+ `awk' is also meant to be a prototyping language. It is used to
+demonstrate feasibility and to play with features and user interfaces.
+This can be done with file-like handling of network connections.
+`gawk' trades the lack of many of the advanced features of the TCP/IP
+family of protocols for the convenience of simple connection handling.
+The advanced features are available when programming in C or Perl. In
+fact, the network programming in this major node is very similar to
+what is described in books like `Internet Programming with Python',
+`Advanced Perl Programming', or `Web Client Programming with Perl'.
+But it's done here without first having to learn object-oriented
+ideology, underlying languages such as Tcl/Tk, Perl, Python, or all of
+the libraries necessary to extend these languages before they are ready
+for the Internet.
+
+ This major node demonstrates how to use the TCP protocol. The other
+protocols are much less important for most users (UDP) or even
+untractable (RAW).
+
+* Menu:
+
+* Gawk Special Files:: How to do `gawk' networking.
+* TCP Connecting:: Making a TCP connection.
+* Troubleshooting:: Troubleshooting TCP/IP connections.
+* Interacting:: Interacting with a service.
+* Setting Up:: Setting up a service.
+* Email:: Reading email.
+* Web page:: Reading a Web page.
+* Primitive Service:: A primitive Web service.
+* Interacting Service:: A Web service with interaction.
+* Simple Server:: A simple Web server.
+* Caveats:: Network programming caveats.
+* Challenges:: Where to go from here.
+
+
+File: gawkinet.info, Node: Gawk Special Files, Next: TCP Connecting, Prev: Using Networking, Up: Using Networking
+
+`gawk' Networking Mechanisms
+============================
+
+ The `|&' operator introduced in `gawk' 3.1 for use in communicating
+with a "co-process" is described in *Note Two-way Communications With
+Another Process: (gawk)Two-way I/O. It shows how to do two-way I/O to a
+separate process, sending it data with `print' or `printf' and reading
+data with `getline'. If you haven't read it already, you should detour
+there to do so.
+
+ `gawk' transparently extends the two-way I/O mechanism to simple
+networking through the use of special file names. When a "co-process"
+is started that matches the special files we are about to describe,
+`gawk' creates the appropriate network connection, and then two-way I/O
+proceeds as usual.
+
+ At the C, C++ (and basic Perl) level, networking is accomplished via
+"sockets", an Application Programming Interface (API) originally
+developed at the University of California at Berkeley that is now used
+almost universally for TCP/IP networking. Socket level programming,
+while fairly straightforward, requires paying attention to a number of
+details, as well as using binary data. It is not well-suited for use
+from a high-level language like `awk'. The special files provided in
+`gawk' hide the details from the programmer, making things much simpler
+and easier to use.
+
+ The special file name for network access is made up of several
+fields, all of them mandatory, none of them optional:
+
+ /inet/PROTOCOL/LOCALPORT/HOSTNAME/REMOTEPORT
+
+ The `/inet/' field is, of course, constant when accessing the
+network. The LOCALPORT and REMOTEPORT fields do not have a meaning
+when used with `/inet/raw' because "ports" only apply to TCP and UDP.
+So, when using `/inet/raw', the port fields always have to be `0'.
+
+* Menu:
+
+* Special File Fields:: The fields in the special file name.
+* Comparing Protocols:: Differences between the protocols.
+
+
+File: gawkinet.info, Node: Special File Fields, Next: Comparing Protocols, Prev: Gawk Special Files, Up: Gawk Special Files
+
+The Fields of the Special File Name
+-----------------------------------
+
+ This node explains the meaning of all the other fields, as well as
+the range of values and the defaults. All of the fields are mandatory.
+To let the system pick a value, or if the field doesn't apply to the
+protocol, specify it as `0'.
+
+PROTOCOL
+ Determines which member of the TCP/IP family of protocols is
+ selected to transport the data across the network. There are three
+ possible values (always written in lowercase): `tcp', `udp', and
+ `raw'. The exact meaning of each is explained later in this node.
+
+LOCALPORT
+ Determines which port on the local machine is used to communicate
+ across the network. It has no meaning with `/inet/raw' and must
+ therefore be `0'. Application level clients usually use `0' to
+ indicate they do not care which local port is used--instead they
+ specify a remote port to connect to. It is vital for application
+ level servers to use a number different from `0' here because
+ their service has to be available at a specific publicly-known
+ port number. It is possible to use a name from `/etc/services'
+ here.
+
+HOSTNAME
+ Determines which remote host is to be at the other end of the
+ connection. Application level servers must fill this field with a
+ `0' to indicate their being open for all other hosts to connect to
+ them and enforce connection level server behavior this way. It is
+ not possible for an application level server to restrict its
+ availability to one remote host by entering a host name here.
+ Application level clients must enter a name different from `0'.
+ The name can be either symbolic (e.g., `jpl-devvax.jpl.nasa.gov')
+ or numeric (e.g., `128.149.1.143').
+
+REMOTEPORT
+ Determines which port on the remote machine is used to communicate
+ across the network. It has no meaning with `/inet/raw' and must
+ therefore be 0. For `/inet/tcp' and `/inet/udp', application
+ level clients _must_ use a number other than `0' to indicate which
+ port on the remote machine they want to connect to. Application
+ level servers must not fill this field with a `0'. Instead they
+ specify a local port for clients to connect to. It is possible to
+ use a name from `/etc/services' here.
+
+ Experts in network programming will notice that the usual
+client/server asymmetry found at the level of the socket API is not
+visible here. This is for the sake of simplicity of the high-level
+concept. If this asymmetry is necessary for your application, use
+another language. For `gawk', it is more important to enable users to
+write a client program with a minimum of code. What happens when first
+accessing a network connection is seen in the following pseudo-code:
+
+ if ((name of remote host given) && (other side accepts connection)) {
+ rendez-vous successful; transmit with getline or print
+ } else {
+ if ((other side did not accept) && (localport == 0))
+ exit unsuccessful
+ if (TCP) {
+ set up a server accepting connections
+ this means waiting for the client on the other side to connect
+ } else
+ ready
+ }
+
+ The exact behavior of this algorithm depends on the values of the
+fields of the special file name. When in doubt, the following table
+gives you the combinations of values and their meaning. If this table
+is too complicated, focus on the three lines printed in *bold*. All the
+examples in *Note Networking With `gawk': Using Networking, use only the
+patterns printed in bold letters.
+
+PROTOCOL LOCAL HOST REMOTE RESULTING CONNECTION LEVEL
+ PORT NAME PORT BEHAVIOR
+*tcp* *0* *x* *x* *Dedicated client, fails
+ if immediately connecting
+ to a server
+ on the other side fails*
+udp 0 x x Dedicated client
+raw 0 x 0 Dedicated client, works
+ only as `root'
+*tcp, udp* *x* *x* *x* *Client, switches to
+ dedicated server if
+ necessary*
+*tcp, udp* *x* *0* *0* *Dedicated server*
+raw 0 0 0 Dedicated server, works
+ only as `root'
+tcp, udp, raw x x 0 Invalid
+tcp, udp, raw 0 0 x Invalid
+tcp, udp, raw x 0 x Invalid
+tcp, udp 0 0 0 Invalid
+tcp, udp 0 x 0 Invalid
+raw x 0 0 Invalid
+raw 0 x x Invalid
+raw x x x Invalid
+
+ In general, TCP is the preferred mechanism to use. It is the
+simplest protocol to understand and to use. Use the others only if
+circumstances demand low-overhead.
+
+
+File: gawkinet.info, Node: Comparing Protocols, Prev: Special File Fields, Up: Gawk Special Files
+
+Comparing Protocols
+-------------------
+
+ This node develops a pair of programs (sender and receiver) that do
+nothing but send a timestamp from one machine to another. The sender
+and the receiver are implemented with each of the three protocols
+available and demonstrate the differences between them.
+
+* Menu:
+
+* File /inet/tcp:: The TCP special file.
+* File /inet/udp:: The UDB special file.
+* File /inet/raw:: The RAW special file.
+
+
+File: gawkinet.info, Node: File /inet/tcp, Next: File /inet/udp, Prev: Comparing Protocols, Up: Comparing Protocols
+
+`/inet/tcp'
+...........
+
+ Once again, always use TCP. (Use UDP when low-overhead is a
+necessity, and use RAW for network experimentation.) The first example
+is the sender program:
+
+ # Server
+ BEGIN {
+ print strftime() |& "/inet/tcp/8888/0/0"
+ close("/inet/tcp/8888/0/0")
+ }
+
+ The receiver is very simple:
+
+ # Client
+ BEGIN {
+ "/inet/tcp/0/localhost/8888" |& getline
+ print $0
+ close("/inet/tcp/0/localhost/8888")
+ }
+
+ TCP guarantees that the bytes arrive at the receiving end in exactly
+the same order that they were sent. No byte is lost (except for broken
+connections), doubled, or out of order. Some overhead is necessary to
+accomplish this, but this is the price to pay for a reliable service.
+It does matter which side starts first. The sender/server has to be
+started first, and it waits for the receiver to read a line.
+
+
+File: gawkinet.info, Node: File /inet/udp, Next: File /inet/raw, Prev: File /inet/tcp, Up: Comparing Protocols
+
+`/inet/udp'
+...........
+
+ The server and client programs that use UDP are almost identical to
+their TCP counterparts; only the PROTOCOL has changed. As before, it
+does matter which side starts first. The receiving side blocks and
+waits for the sender. In this case, the receiver/client has to be
+started first:
+
+ # Server
+ BEGIN {
+ print strftime() |& "/inet/udp/8888/0/0"
+ close("/inet/udp/8888/0/0")
+ }
+
+ The receiver is almost identical to the TCP receiver:
+
+ # Client
+ BEGIN {
+ "/inet/udp/0/localhost/8888" |& getline
+ print $0
+ close("/inet/udp/0/localhost/8888")
+ }
+
+ UDP cannot guarantee that the datagrams at the receiving end will
+arrive in exactly the same order they were sent. Some datagrams could be
+lost, some doubled, and some out of order. But no overhead is necessary
+to accomplish this. This unreliable behavior is good enough for tasks
+such as data acquisition, logging, and even stateless services like NFS.
+
+
+File: gawkinet.info, Node: File /inet/raw, Prev: File /inet/udp, Up: Comparing Protocols
+
+`/inet/raw'
+...........
+
+ This is an IP-level protocol. Only `root' is allowed to access this
+special file. It is meant to be the basis for implementing and
+experimenting with transport level protocols.(1) In the most general
+case, the sender has to supply the encapsulating header bytes in front
+of the packet and the receiver has to strip the additional bytes from
+the message.
+
+ RAW receivers cannot receive packets sent with TCP or UDP because the
+operating system does not deliver the packets to a RAW receiver. The
+operating system knows about some of the protocols on top of IP and
+decides on its own which packet to deliver to which process. (d.c.)
+Therefore, the UDP receiver must be used for receiving UDP datagrams
+sent with the RAW sender. This is a dark corner, not only of `gawk',
+but also of TCP/IP.
+
+ For extended experimentation with protocols, look into the approach
+implemented in a tool called SPAK. This tool reflects the hierarchical
+layering of protocols (encapsulation) in the way data streams are piped
+out of one program into the next one. It shows which protocol is based
+on which other (lower-level) protocol by looking at the command-line
+ordering of the program calls. Cleverly thought out, SPAK is much
+better than `gawk''s `/inet' for learning the meaning of each and every
+bit in the protocol headers.
+
+ The next example uses the RAW protocol to emulate the behavior of
+UDP. The sender program is the same as above, but with some additional
+bytes that fill the places of the UDP fields:
+
+ BEGIN {
+ Message = "Hello world\n"
+ SourcePort = 0
+ DestinationPort = 8888
+ MessageLength = length(Message)+8
+ RawService = "/inet/raw/0/localhost/0"
+ printf("%c%c%c%c%c%c%c%c%s",
+ SourcePort/256, SourcePort%256,
+ DestinationPort/256, DestinationPort%256,
+ MessageLength/256, MessageLength%256,
+ 0, 0, Message) |& RawService
+ fflush(RawService)
+ close(RawService)
+ }
+
+ Since this program tries to emulate the behavior of UDP, it checks if
+the RAW sender is understood by the UDP receiver but not if the RAW
+receiver can understand the UDP sender. In a real network, the RAW
+receiver is hardly of any use because it gets every IP packet that
+comes across the network. There are usually so many packets that `gawk'
+would be too slow for processing them. Only on a network with little
+traffic can the IP-level receiver program be tested. Programs for
+analyzing IP traffic on modem or ISDN channels should be possible.
+
+ Port numbers do not have a meaning when using `/inet/raw'. Their
+fields have to be `0'. Only TCP and UDP use ports. Receiving data from
+`/inet/raw' is difficult, not only because of processing speed but also
+because data is usually binary and not restricted to ASCII. This
+implies that line separation with `RS' does not work as usual.
+
+ ---------- Footnotes ----------
+
+ (1) This special file is reserved, but not otherwise currently
+implemented.
+
+
+File: gawkinet.info, Node: TCP Connecting, Next: Troubleshooting, Prev: Gawk Special Files, Up: Using Networking
+
+Establishing a TCP Connection
+=============================
+
+ Let's observe a network connection at work. Type in the following
+program and watch the output. Within a second, it connects via TCP
+(`/inet/tcp') to the machine it is running on (`localhost'), and asks
+the service `daytime' on the machine what time it is:
+
+ BEGIN {
+ "/inet/tcp/0/localhost/daytime" |& getline
+ print $0
+ close("/inet/tcp/0/localhost/daytime")
+ }
+
+ Even experienced `awk' users will find the second line strange in two
+respects:
+
+ * A special file is used as a shell command that pipes its output
+ into `getline'. One would rather expect to see the special file
+ being read like any other file (`getline <
+ "/inet/tcp/0/localhost/daytime")'.
+
+ * The operator `|&' has not been part of any `awk' implementation
+ (until now). It is actually the only extension of the `awk'
+ language needed (apart from the special files) to introduce
+ network access.
+
+ The `|&' operator was introduced in `gawk' 3.1 in order to overcome
+the crucial restriction that access to files and pipes in `awk' is
+always unidirectional. It was formerly impossible to use both access
+modes on the same file or pipe. Instead of changing the whole concept
+of file access, the `|&' operator behaves exactly like the usual pipe
+operator except for two additions:
+
+ * Normal shell commands connected to their `gawk' program with a `|&'
+ pipe can be accessed bidirectionally. The `|&' turns out to be a
+ quite general, useful, and natural extension of `awk'.
+
+ * Pipes that consist of a special file name for network connections
+ are not executed as shell commands. Instead, they can be read and
+ written to, just like a full-duplex network connection.
+
+ In the earlier example, the `|&' operator tells `getline' to read a
+line from the special file `/inet/tcp/0/localhost/daytime'. We could
+also have printed a line into the special file. But instead we just
+read a line with the time, printed it, and closed the connection.
+(While we could just let `gawk' close the connection by finishing the
+program, in this Info file we are pedantic, and always explicitly close
+the connections.)
+
+
+File: gawkinet.info, Node: Troubleshooting, Next: Interacting, Prev: TCP Connecting, Up: Using Networking
+
+Troubleshooting Connection Problems
+===================================
+
+ It may well be that for some reason the above program does not run
+on your machine. When looking at possible reasons for this, you will
+learn much about typical problems that arise in network programming.
+First of all, your implementation of `gawk' may not support network
+access because it is a pre-3.1 version or you do not have a network
+interface in your machine. Perhaps your machine uses some other
+protocol like DECnet or Novell's IPX. For the rest of this major node,
+we will assume you work on a Unix machine that supports TCP/IP. If the
+above program does not run on such a machine, it may help to replace
+the name `localhost' with the name of your machine or its IP address.
+If it does, you could replace `localhost' with the name of another
+machine in your vicinity. This way, the program connects to another
+machine. Now you should see the date and time being printed by the
+program. Otherwise your machine may not support the `daytime' service.
+Try changing the service to `chargen' or `ftp'. This way, the program
+connects to other services that should give you some response. If you
+are curious, you should have a look at your file `/etc/services'. It
+could look like this:
+
+ # /etc/services:
+ #
+ # Network services, Internet style
+ #
+ # Name Number/Protcol Alternate name # Comments
+
+ echo 7/tcp
+ echo 7/udp
+ discard 9/tcp sink null
+ discard 9/udp sink null
+ daytime 13/tcp
+ daytime 13/udp
+ chargen 19/tcp ttytst source
+ chargen 19/udp ttytst source
+ ftp 21/tcp
+ telnet 23/tcp
+ smtp 25/tcp mail
+ finger 79/tcp
+ www 80/tcp http # WorldWideWeb HTTP
+ www 80/udp # HyperText Transfer Protocol
+ pop-2 109/tcp postoffice # POP version 2
+ pop-2 109/udp
+ pop-3 110/tcp # POP version 3
+ pop-3 110/udp
+ nntp 119/tcp readnews untp # USENET News
+ irc 194/tcp # Internet Relay Chat
+ irc 194/udp
+ ...
+
+ Here, you find a list of services that traditional Unix machines
+usually support. If your GNU/Linux machine does not do so, it may be
+that these services are switched off in some startup script. Systems
+running some flavor of Microsoft Windows usually do _not_ support such
+services. Nevertheless, it _is_ possible to do networking with `gawk'
+on Microsoft Windows.(1) The first column of the file gives the name of
+the service, the second a unique number, and the protocol that one can
+use to connect to this service. The rest of the line is treated as a
+comment. You see that some services (`echo') support TCP as well as
+UDP.
+
+ ---------- Footnotes ----------
+
+ (1) Microsoft prefered to ignore the TCP/IP family of protocols
+until 1995. Then came the rise of the Netscape browser as a landmark
+"killer application." Microsoft added TCP/IP support and their own
+browser to Microsoft Windows 95 at the last minute. They even
+back-ported their TCP/IP implementation to Microsoft Windows for
+Workgroups 3.11, but it was a rather rudimentary and half-hearted
+implementation. Nevertheless, the equivalent of `/etc/services' resides
+under `c:\windows\services' on Microsoft Windows.
+
+
+File: gawkinet.info, Node: Interacting, Next: Setting Up, Prev: Troubleshooting, Up: Using Networking
+
+Interacting with a Network Service
+==================================
+
+ The next program makes use of the possibility to really interact
+with a network service by printing something into the special file. It
+asks the so-called `finger' service if a user of the machine is logged
+in. When testing this program, try to change `localhost' to some other
+machine name in your local network:
+
+ BEGIN {
+ NetService = "/inet/tcp/0/localhost/finger"
+ print "NAME" |& NetService
+ while ((NetService |& getline) > 0)
+ print $0
+ close(NetService)
+ }
+
+ After telling the service on the machine which user to look for, the
+program repeatedly reads lines that come as a reply. When no more lines
+are coming (because the service has closed the connection), the program
+also closes the connection. Try replacing `"NAME"' with your login name
+(or the name of someone else logged in). For a list of all users
+currently logged in, replace NAME with an empty string `""'.
+
+ The final `close' command could be safely deleted from the above
+script, because the operating system closes any open connection by
+default when a script reaches the end of execution. In order to avoid
+portability problems, it is best to always close connections explicitly.
+With the Linux kernel, for example, proper closing results in flushing
+of buffers. Letting the close happen by default may result in
+discarding buffers.
+
+ When looking at `/etc/services' you may have noticed that the
+`daytime' service is also available with `udp'. In the earlier example,
+change `tcp' to `udp', and change `finger' to `daytime'. After
+starting the modified program, you see the expected day and time
+message. The program then hangs, because it waits for more lines
+coming from the service. However, they never come. This behavior is a
+consequence of the differences between TCP and UDP. When using UDP,
+neither party is automatically informed about the other closing the
+connection. Continuing to experiment this way reveals many other subtle
+differences between TCP and UDP. To avoid such trouble, one should
+always remember the advice Douglas E. Comer and David Stevens give in
+Volume III of their series `Internetworking With TCP' (page 14):
+
+ When designing client-server applications, beginners are strongly
+ advised to use TCP because it provides reliable,
+ connection-oriented communication. Programs only use UDP if the
+ application protocol handles reliability, the application requires
+ hardware broadcast or multicast, or the application cannot
+ tolerate virtual circuit overhead.
+
+
+File: gawkinet.info, Node: Setting Up, Next: Email, Prev: Interacting, Up: Using Networking
+
+Setting Up a Service
+====================
+
+ The preceding programs behaved as clients that connect to a server
+somewhere on the Internet and request a particular service. Now we set
+up such a service to mimic the behavior of the `daytime' service. Such
+a server does not know in advance who is going to connect to it over
+the network. Therefore we cannot insert a name for the host to connect
+to in our special file name.
+
+ Start the following program in one window. Notice that the service
+does not have the name `daytime', but the number `8888'. From looking
+at `/etc/services', you know that names like `daytime' are just
+mnemonics for predetermined 16-bit integers. Only the system
+administrator (`root') could enter our new service into `/etc/services'
+with an appropriate name. Also notice that the service name has to be
+entered into a different field of the special file name because we are
+setting up a server, not a client:
+
+ BEGIN {
+ print strftime() |& "/inet/tcp/8888/0/0"
+ close("/inet/tcp/8888/0/0")
+ }
+
+ Now open another window on the same machine. Copy the client
+program given as the first example (*note Establishing a TCP
+Connection: TCP Connecting.) to a new file and edit it, changing the
+name `daytime' to `8888'. Then start the modified client. You should
+get a reply like this:
+
+ Sat Sep 27 19:08:16 CEST 1997
+
+Both programs explicitly close the connection.
+
+ Now we will intentionally make a mistake to see what happens when
+the name `8888' (the so-called port) is already used by another service.
+Start the server program in both windows. The first one works, but the
+second one complains that it could not open the connection. Each port
+on a single machine can only be used by one server program at a time.
+Now terminate the server program and change the name `8888' to `echo'.
+After restarting it, the server program does not run any more and you
+know why: there already is an `echo' service running on your machine.
+But even if this isn't true, you would not get your own `echo' server
+running on a Unix machine, because the ports with numbers smaller than
+1024 (`echo' is at port 7) are reserved for `root'. On machines
+running some flavor of Microsoft Windows, there is no restriction that
+reserves ports 1 to 1024 for a privileged user; hence you can start an
+`echo' server there.
+
+ Turning this short server program into something really useful is
+simple. Imagine a server that first reads a file name from the client
+through the network connection, then does something with the file and
+sends a result back to the client. The server-side processing could be:
+
+ BEGIN {
+ NetService = "/inet/tcp/8888/0/0"
+ NetService |& getline
+ CatPipe = ("cat " $1) # sets $0 and the fields
+ while ((CatPipe | getline) > 0)
+ print $0 |& NetService
+ close(NetService)
+ }
+
+and we would have a remote copying facility. Such a server reads the
+name of a file from any client that connects to it and transmits the
+contents of the named file across the net. The server-side processing
+could also be the execution of a command that is transmitted across the
+network. From this example, you can see how simple it is to open up a
+security hole on your machine. If you allow clients to connect to your
+machine and execute arbitrary commands, anyone would be free to do `rm
+-rf *'.
+
+
+File: gawkinet.info, Node: Email, Next: Web page, Prev: Setting Up, Up: Using Networking
+
+Reading Email
+=============
+
+ The distribution of email is usually done by dedicated email servers
+that communicate with your machine using special protocols. To receive
+email, we will use the Post Office Protocol (POP). Sending can be done
+with the much older Simple Mail Transfer Protocol (SMTP).
+
+ When you type in the following program, replace the EMAILHOST by the
+name of your local email server. Ask your administrator if the server
+has a POP service, and then use its name or number in the program below.
+Now the program is ready to connect to your email server, but it will
+not succeed in retrieving your mail because it does not yet know your
+login name or password. Replace them in the program and it shows you
+the first email the server has in store:
+
+ BEGIN {
+ POPService = "/inet/tcp/0/EMAILHOST/pop3"
+ RS = ORS = "\r\n"
+ print "user NAME" |& POPService
+ POPService |& getline
+ print "pass PASSWORD" |& POPService
+ POPService |& getline
+ print "retr 1" |& POPService
+ POPService |& getline
+ if ($1 != "+OK") exit
+ print "quit" |& POPService
+ RS = "\r\n\\.\r\n"
+ POPService |& getline
+ print $0
+ close(POPService)
+ }
+
+ The record separators `RS' and `ORS' are redefined because the
+protocol (POP) requires CR-LF to separate lines. After identifying
+yourself to the email service, the command `retr 1' instructs the
+service to send the first of all your email messages in line. If the
+service replies with something other than `+OK', the program exits;
+maybe there is no email. Otherwise, the program first announces that it
+intends to finish reading email, and then redefines `RS' in order to
+read the entire email as multiline input in one record. From the POP
+RFC, we know that the body of the email always ends with a single line
+containing a single dot. The program looks for this using `RS =
+"\r\n\\.\r\n"'. When it finds this sequence in the mail message, it
+quits. You can invoke this program as often as you like; it does not
+delete the message it reads, but instead leaves it on the server.
+
+
+File: gawkinet.info, Node: Web page, Next: Primitive Service, Prev: Email, Up: Using Networking
+
+Reading a Web Page
+==================
+
+ Retrieving a web page from a web server is as simple as retrieving
+email from an email server. We only have to use a similar, but not
+identical, protocol and a different port. The name of the protocol is
+HyperText Transfer Protocol (HTTP) and the port number is usually 80.
+As in the preceding node, ask your administrator about the name of your
+local web server or proxy web server and its port number for HTTP
+requests.
+
+ The following program employs a rather crude approach toward
+retrieving a web page. It uses the prehistoric syntax of HTTP 0.9,
+which almost all web servers still support. The most noticeable thing
+about it is that the program directs the request to the local proxy
+server whose name you insert in the special file name (which in turn
+calls `www.yahoo.com'):
+
+ BEGIN {
+ RS = ORS = "\r\n"
+ HttpService = "/inet/tcp/0/PROXY/80"
+ print "GET http://www.yahoo.com" |& HttpService
+ while ((HttpService |& getline) > 0)
+ print $0
+ close(HttpService)
+ }
+
+ Again, lines are separated by a redefined `RS' and `ORS'. The `GET'
+request that we send to the server is the only kind of HTTP request
+that existed when the web was created in the early 1990s. HTTP calls
+this `GET' request a "method," which tells the service to transmit a
+web page (here the home page of the Yahoo! search engine). Version 1.0
+added the request methods `HEAD' and `POST'. The current version of
+HTTP is 1.1,(1) and knows the additional request methods `OPTIONS',
+`PUT', `DELETE', and `TRACE'. You can fill in any valid web address,
+and the program prints the HTML code of that page to your screen.
+
+ Notice the similarity between the responses of the POP and HTTP
+services. First, you get a header that is terminated by an empty line,
+and then you get the body of the page in HTML. The lines of the
+headers also have the same form as in POP. There is the name of a
+parameter, then a colon, and finally the value of that parameter.
+
+ Images (`.png' or `.gif' files) can also be retrieved this way, but
+then you get binary data that should be redirected into a file. Another
+application is calling a CGI (Common Gateway Interface) script on some
+server. CGI scripts are used when the contents of a web page are not
+constant, but generated instantly at the moment you send a request for
+the page. For example, to get a detailed report about the current
+quotes of Motorola stock shares, call a CGI script at Yahoo! with the
+following:
+
+ get = "GET http://quote.yahoo.com/q?s=MOT&d=t"
+ print get |& HttpService
+
+ You can also request weather reports this way.
+
+ ---------- Footnotes ----------
+
+ (1) Version 1.0 of HTTP was defined in RFC 1945. HTTP 1.1 was
+initially specified in RFC 2068. In June 1999, RFC 2068 was made
+obsolete by RFC 2616. It is an update without any substantial changes.
+
+
+File: gawkinet.info, Node: Primitive Service, Next: Interacting Service, Prev: Web page, Up: Using Networking
+
+A Primitive Web Service
+=======================
+
+ Now we know enough about HTTP to set up a primitive web service that
+just says `"Hello, world"' when someone connects to it with a browser.
+Compared to the situation in the preceding node, our program changes
+the role. It tries to behave just like the server we have observed.
+Since we are setting up a server here, we have to insert the port
+number in the `localport' field of the special file name. The other two
+fields (HOSTNAME and REMOTEPORT) have to contain a `0' because we do
+not know in advance which host will connect to our service.
+
+ In the early 1990s, all a server had to do was send an HTML document
+and close the connection. Here, we adhere to the modern syntax of HTTP.
+The steps are as follows:
+
+ 1. Send a status line telling the web browser that everything is OK.
+
+ 2. Send a line to tell the browser how many bytes follow in the body
+ of the message. This was not necessary earlier because both
+ parties knew that the document ended when the connection closed.
+ Nowadays it is possible to stay connected after the transmission
+ of one web page. This is to avoid the network traffic necessary
+ for repeatedly establishing TCP connections for requesting several
+ images. Thus, there is the need to tell the receiving party how
+ many bytes will be sent. The header is terminated as usual with an
+ empty line.
+
+ 3. Send the `"Hello, world"' body in HTML. The useless `while' loop
+ swallows the request of the browser. We could actually omit the
+ loop, and on most machines the program would still work. First,
+ start the following program:
+
+ BEGIN {
+ RS = ORS = "\r\n"
+ HttpService = "/inet/tcp/8080/0/0"
+ Hello = "" \
+ "A Famous Greeting" \
+ "Hello, world
"
+ Len = length(Hello) + length(ORS)
+ print "HTTP/1.0 200 OK" |& HttpService
+ print "Content-Length: " Len ORS |& HttpService
+ print Hello |& HttpService
+ while ((HttpService |& getline) > 0)
+ continue;
+ close(HttpService)
+ }
+
+ Now, on the same machine, start your favorite browser and let it
+point to `http://localhost:8080' (the browser needs to know on which
+port our server is listening for requests). If this does not work, the
+browser probably tries to connect to a proxy server that does not know
+your machine. If so, change the browser's configuration so that the
+browser does not try to use a proxy to connect to your machine.
+
+
+File: gawkinet.info, Node: Interacting Service, Next: Simple Server, Prev: Primitive Service, Up: Using Networking
+
+A Web Service with Interaction
+==============================
+
+ This node shows how to set up a simple web server. The subnode is a
+library file that we will use with all the examples in *Note Some
+Applications and Techniques::.
+
+* Menu:
+
+* CGI Lib:: A simple CGI library.
+
+ Setting up a web service that allows user interaction is more
+difficult and shows us the limits of network access in `gawk'. In this
+node, we develop a main program (a `BEGIN' pattern and its action)
+that will become the core of event-driven execution controlled by a
+graphical user interface (GUI). Each HTTP event that the user triggers
+by some action within the browser is received in this central
+procedure. Parameters and menu choices are extracted from this request
+and an appropriate measure is taken according to the user's choice.
+For example:
+
+ BEGIN {
+ if (MyHost == "") {
+ "uname -n" | getline MyHost
+ close("uname -n")
+ }
+ if (MyPort == 0) MyPort = 8080
+ HttpService = "/inet/tcp/" MyPort "/0/0"
+ MyPrefix = "http://" MyHost ":" MyPort
+ SetUpServer()
+ while ("awk" != "complex") {
+ # header lines are terminated this way
+ RS = ORS = "\r\n"
+ Status = 200 # this means OK
+ Reason = "OK"
+ Header = TopHeader
+ Document = TopDoc
+ Footer = TopFooter
+ if (GETARG["Method"] == "GET") {
+ HandleGET()
+ } else if (GETARG["Method"] == "HEAD") {
+ # not yet implemented
+ } else if (GETARG["Method"] != "") {
+ print "bad method", GETARG["Method"]
+ }
+ Prompt = Header Document Footer
+ print "HTTP/1.0", Status, Reason |& HttpService
+ print "Connection: Close" |& HttpService
+ print "Pragma: no-cache" |& HttpService
+ len = length(Prompt) + length(ORS)
+ print "Content-length:", len |& HttpService
+ print ORS Prompt |& HttpService
+ # ignore all the header lines
+ while ((HttpService |& getline) > 0)
+ ;
+ # stop talking to this client
+ close(HttpService)
+ # wait for new client request
+ HttpService |& getline
+ # do some logging
+ print systime(), strftime(), $0
+ # read request parameters
+ CGI_setup($1, $2, $3)
+ }
+ }
+
+ This web server presents menu choices in the form of HTML links.
+Therefore, it has to tell the browser the name of the host it is
+residing on. When starting the server, the user may supply the name of
+the host from the command line with `gawk -v MyHost="Rumpelstilzchen"'.
+If the user does not do this, the server looks up the name of the host
+it is running on for later use as a web address in HTML documents. The
+same applies to the port number. These values are inserted later into
+the HTML content of the web pages to refer to the home system.
+
+ Each server that is built around this core has to initialize some
+application-dependent variables (such as the default home page) in a
+procedure `SetUpServer', which is called immediately before entering the
+infinite loop of the server. For now, we will write an instance that
+initiates a trivial interaction. With this home page, the client user
+can click on two possible choices, and receive the current date either
+in human-readable format or in seconds since 1970:
+
+ function SetUpServer() {
+ TopHeader = ""
+ TopHeader = TopHeader \
+ "My name is GAWK, GNU AWK"
+ TopDoc = "\
+ Do you prefer your date human or \
+ POSIXed?
" ORS ORS
+ TopFooter = ""
+ }
+
+ On the first run through the main loop, the default line terminators
+are set and the default home page is copied to the actual home page.
+Since this is the first run, `GETARG["Method"]' is not initialized yet,
+hence the case selection over the method does nothing. Now that the
+home page is initialized, the server can start communicating to a
+client browser.
+
+ It does so by printing the HTTP header into the network connection
+(`print ... |& HttpService'). This command blocks execution of the
+server script until a client connects. If this server script is
+compared with the primitive one we wrote before, you will notice two
+additional lines in the header. The first instructs the browser to
+close the connection after each request. The second tells the browser
+that it should never try to _remember_ earlier requests that had
+identical web addresses (no caching). Otherwise, it could happen that
+the browser retrieves the time of day in the previous example just once,
+and later it takes the web page from the cache, always displaying the
+same time of day although time advances each second.
+
+ Having supplied the initial home page to the browser with a valid
+document stored in the parameter `Prompt', it closes the connection and
+waits for the next request. When the request comes, a log line is
+printed that allows us to see which request the server receives. The
+final step in the loop is to call the function `CGI_setup', which reads
+all the lines of the request (coming from the browser), processes them,
+and stores the transmitted parameters in the array `PARAM'. The complete
+text of these application-independent functions can be found in *Note A
+Simple CGI Library: CGI Lib. For now, we use a simplified version of
+`CGI_setup':
+
+ function CGI_setup( method, uri, version, i) {
+ delete GETARG; delete MENU; delete PARAM
+ GETARG["Method"] = $1
+ GETARG["URI"] = $2
+ GETARG["Version"] = $3
+ i = index($2, "?")
+ # is there a "?" indicating a CGI request?
+ if (i > 0) {
+ split(substr($2, 1, i-1), MENU, "[/:]")
+ split(substr($2, i+1), PARAM, "&")
+ for (i in PARAM) {
+ j = index(PARAM[i], "=")
+ GETARG[substr(PARAM[i], 1, j-1)] = \
+ substr(PARAM[i], j+1)
+ }
+ } else { # there is no "?", no need for splitting PARAMs
+ split($2, MENU, "[/:]")
+ }
+ }
+
+ At first, the function clears all variables used for global storage
+of request parameters. The rest of the function serves the purpose of
+filling the global parameters with the extracted new values. To
+accomplish this, the name of the requested resource is split into parts
+and stored for later evaluation. If the request contains a `?', then
+the request has CGI variables seamlessly appended to the web address.
+Everything in front of the `?' is split up into menu items, and
+everything behind the `?' is a list of `VARIABLE=VALUE' pairs
+(separated by `&') that also need splitting. This way, CGI variables are
+isolated and stored. This procedure lacks recognition of special
+characters that are transmitted in coded form(1). Here, any optional
+request header and body parts are ignored. We do not need header
+parameters and the request body. However, when refining our approach or
+working with the `POST' and `PUT' methods, reading the header and body
+becomes inevitable. Header parameters should then be stored in a global
+array as well as the body.
+
+ On each subsequent run through the main loop, one request from a
+browser is received, evaluated, and answered according to the user's
+choice. This can be done by letting the value of the HTTP method guide
+the main loop into execution of the procedure `HandleGET', which
+evaluates the user's choice. In this case, we have only one
+hierarchical level of menus, but in the general case, menus are nested.
+The menu choices at each level are separated by `/', just as in file
+names. Notice how simple it is to construct menus of arbitrary depth:
+
+ function HandleGET() {
+ if ( MENU[2] == "human") {
+ Footer = strftime() TopFooter
+ } else if (MENU[2] == "POSIX") {
+ Footer = systime() TopFooter
+ }
+ }
+
+ The disadvantage of this approach is that our server is slow and can
+handle only one request at a time. Its main advantage, however, is that
+the server consists of just one `gawk' program. No need for installing
+an `httpd', and no need for static separate HTML files, CGI scripts, or
+`root' privileges. This is rapid prototyping. This program can be
+started on the same host that runs your browser. Then let your browser
+point to `http://localhost:8080'.
+
+ It is also possible to include images into the HTML pages. Most
+browsers support the not very well-known `.xbm' format, which may
+contain only monochrome pictures but is an ASCII format. Binary images
+are possible but not so easy to handle. Another way of including images
+is to generate them with a tool such as GNUPlot, by calling the tool
+with the `system' function or through a pipe.
+
+ ---------- Footnotes ----------
+
+ (1) As defined in RFC 2068.
+
+
+File: gawkinet.info, Node: CGI Lib, Prev: Interacting Service, Up: Interacting Service
+
+A Simple CGI Library
+--------------------
+
+ HTTP is like being married: you have to be able to handle whatever
+ you're given, while being very careful what you send back.
+ Phil Smith III,
+ `http://www.netfunny.com/rhf/jokes/99/Mar/http.html'
+
+ In *Note A Web Service with Interaction: Interacting Service, we saw
+the function `CGI_setup' as part of the web server "core logic"
+framework. The code presented there handles almost everything necessary
+for CGI requests. One thing it doesn't do is handle encoded characters
+in the requests. For example, an `&' is encoded as a percent sign
+followed by the hexadecimal value--`%26'. These encoded values should
+be decoded. Following is a simple library to perform these tasks.
+This code is used for all web server examples used throughout the rest
+of this Info file. If you want to use it for your own web server,
+store the source code into a file named `inetlib.awk'. Then you can
+include these functions into your code by placing the following
+statement into your program:
+
+ @include inetlib.awk
+
+on the first line of your script. But beware, this mechanism is only
+possible if you invoke your web server script with `igawk' instead of
+the usual `awk' or `gawk'. Here is the code:
+
+ # CGI Library and core of a web server
+ # Global arrays
+ # GETARG --- arguments to CGI GET command
+ # MENU --- menu items (path names)
+ # PARAM --- parameters of form x=y
+
+ # Optional variable MyHost contains host address
+ # Optional variable MyPort contains port number
+ # Needs TopHeader, TopDoc, TopFooter
+ # Sets MyPrefix, HttpService, Status, Reason
+
+ BEGIN {
+ if (MyHost == "") {
+ "uname -n" | getline MyHost
+ close("uname -n")
+ }
+ if (MyPort == 0) MyPort = 8080
+ HttpService = "/inet/tcp/" MyPort "/0/0"
+ MyPrefix = "http://" MyHost ":" MyPort
+ SetUpServer()
+ while ("awk" != "complex") {
+ # header lines are terminated this way
+ RS = ORS = "\r\n"
+ Status = 200 # this means OK
+ Reason = "OK"
+ Header = TopHeader
+ Document = TopDoc
+ Footer = TopFooter
+ if (GETARG["Method"] == "GET") {
+ HandleGET()
+ } else if (GETARG["Method"] == "HEAD") {
+ # not yet implemented
+ } else if (GETARG["Method"] != "") {
+ print "bad method", GETARG["Method"]
+ }
+ Prompt = Header Document Footer
+ print "HTTP/1.0", Status, Reason |& HttpService
+ print "Connection: Close" |& HttpService
+ print "Pragma: no-cache" |& HttpService
+ len = length(Prompt) + length(ORS)
+ print "Content-length:", len |& HttpService
+ print ORS Prompt |& HttpService
+ # ignore all the header lines
+ while ((HttpService |& getline) > 0)
+ continue
+ # stop talking to this client
+ close(HttpService)
+ # wait for new client request
+ HttpService |& getline
+ # do some logging
+ print systime(), strftime(), $0
+ CGI_setup($1, $2, $3)
+ }
+ }
+
+ function CGI_setup( method, uri, version, i)
+ {
+ delete GETARG
+ delete MENU
+ delete PARAM
+ GETARG["Method"] = method
+ GETARG["URI"] = uri
+ GETARG["Version"] = version
+
+ i = index(uri, "?")
+ if (i > 0) { # is there a "?" indicating a CGI request?
+ split(substr(uri, 1, i-1), MENU, "[/:]")
+ split(substr(uri, i+1), PARAM, "&")
+ for (i in PARAM) {
+ PARAM[i] = _CGI_decode(PARAM[i])
+ j = index(PARAM[i], "=")
+ GETARG[substr(PARAM[i], 1, j-1)] = \
+ substr(PARAM[i], j+1)
+ }
+ } else { # there is no "?", no need for splitting PARAMs
+ split(uri, MENU, "[/:]")
+ }
+ for (i in MENU) # decode characters in path
+ if (i > 4) # but not those in host name
+ MENU[i] = _CGI_decode(MENU[i])
+ }
+
+ This isolates details in a single function, `CGI_setup'. Decoding
+of encoded characters is pushed off to a helper function,
+`_CGI_decode'. The use of the leading underscore (`_') in the function
+name is intended to indicate that it is an "internal" function,
+although there is nothing to enforce this:
+
+ function _CGI_decode(str, hexdigs, i, pre, code1, code2,
+ val, result)
+ {
+ hexdigs = "123456789abcdef"
+
+ i = index(str, "%")
+ if (i == 0) # no work to do
+ return str
+
+ do {
+ pre = substr(str, 1, i-1) # part before %xx
+ code1 = substr(str, i+1, 1) # first hex digit
+ code2 = substr(str, i+2, 1) # second hex digit
+ str = substr(str, i+3) # rest of string
+
+ code1 = tolower(code1)
+ code2 = tolower(code2)
+ val = index(hexdigs, code1) * 16 \
+ + index(hexdigs, code2)
+
+ result = result pre sprintf("%c", val)
+ i = index(str, "%")
+ } while (i != 0)
+ if (length(str) > 0)
+ result = result str
+ return result
+ }
+
+ This works by splitting the string apart around an encoded character.
+The two digits are converted to lowercase and looked up in a string of
+hex digits. Note that `0' is not in the string on purpose; `index'
+returns zero when it's not found, automatically giving the correct
+value! Once the hexadecimal value is converted from characters in a
+string into a numerical value, `sprintf' converts the value back into a
+real character. The following is a simple test harness for the above
+functions:
+
+ BEGIN {
+ CGI_setup("GET",
+ "http://www.gnu.org/cgi-bin/foo?p1=stuff&p2=stuff%26junk" \
+ "&percent=a %25 sign",
+ "1.0")
+ for (i in MENU)
+ printf "MENU[\"%s\"] = %s\n", i, MENU[i]
+ for (i in PARAM)
+ printf "PARAM[\"%s\"] = %s\n", i, PARAM[i]
+ for (i in GETARG)
+ printf "GETARG[\"%s\"] = %s\n", i, GETARG[i]
+ }
+
+ And this is the result when we run it:
+
+ $ gawk -f testserv.awk
+ -| MENU["4"] = www.gnu.org
+ -| MENU["5"] = cgi-bin
+ -| MENU["6"] = foo
+ -| MENU["1"] = http
+ -| MENU["2"] =
+ -| MENU["3"] =
+ -| PARAM["1"] = p1=stuff
+ -| PARAM["2"] = p2=stuff&junk
+ -| PARAM["3"] = percent=a % sign
+ -| GETARG["p1"] = stuff
+ -| GETARG["percent"] = a % sign
+ -| GETARG["p2"] = stuff&junk
+ -| GETARG["Method"] = GET
+ -| GETARG["Version"] = 1.0
+ -| GETARG["URI"] = http://www.gnu.org/cgi-bin/foo?p1=stuff&
+ p2=stuff%26junk&percent=a %25 sign
+
+
+File: gawkinet.info, Node: Simple Server, Next: Caveats, Prev: Interacting Service, Up: Using Networking
+
+A Simple Web Server
+===================
+
+ In the preceding node, we built the core logic for event driven GUIs.
+In this node, we finally extend the core to a real application. No one
+would actually write a commercial web server in `gawk', but it is
+instructive to see that it is feasible in principle.
+
+ The application is ELIZA, the famous program by Joseph Weizenbaum
+that mimics the behavior of a professional psychotherapist when talking
+to you. Weizenbaum would certainly object to this description, but
+this is part of the legend around ELIZA. Take the site-independent
+core logic and append the following code:
+
+ function SetUpServer() {
+ SetUpEliza()
+ TopHeader = \
+ "An HTTP-based System with GAWK\
+ \
+ "
+ TopDoc = "\
+ Please choose one of the following actions:
\
+ "
+ TopFooter = ""
+ }
+
+ `SetUpServer' is similar to the previous example, except for calling
+another function, `SetUpEliza'. This approach can be used to implement
+other kinds of servers. The only changes needed to do so are hidden in
+the functions `SetUpServer' and `HandleGET'. Perhaps it might be
+necessary to implement other HTTP methods. The `igawk' program that
+comes with `gawk' may be useful for this process.
+
+ When extending this example to a complete application, the first
+thing to do is to implement the function `SetUpServer' to initialize
+the HTML pages and some variables. These initializations determine the
+way your HTML pages look (colors, titles, menu items, etc.).
+
+ The function `HandleGET' is a nested case selection that decides
+which page the user wants to see next. Each nesting level refers to a
+menu level of the GUI. Each case implements a certain action of the
+menu. On the deepest level of case selection, the handler essentially
+knows what the user wants and stores the answer into the variable that
+holds the HTML page contents:
+
+ function HandleGET() {
+ # A real HTTP server would treat some parts of the URI as a file name.
+ # We take parts of the URI as menu choices and go on accordingly.
+ if(MENU[2] == "AboutServer") {
+ Document = "This is not a CGI script.\
+ This is an httpd, an HTML file, and a CGI script all \
+ in one GAWK script. It needs no separate www-server, \
+ no installation, and no root privileges.\
+ To run it, do this:
\
+ - start this script with \"gawk -f httpserver.awk\",
\
+ - and on the same host let your www browser open location\
+ \"http://localhost:8080\"
\
+
\\ Details of HTTP come from:
\
+ - Hethmon: Illustrated Guide to HTTP
\
+ RFC 2068JK 14.9.1997
"
+ } else if (MENU[2] == "AboutELIZA") {
+ Document = "This is an implementation of the famous ELIZA\
+ program by Joseph Weizenbaum. It is written in GAWK and\
+ /bin/sh: expad: command not found
+ } else if (MENU[2] == "StartELIZA") {
+ gsub(/\+/, " ", GETARG["YouSay"])
+ # Here we also have to substitute coded special characters
+ Document = ""
+ }
+ }
+
+ Now we are down to the heart of ELIZA, so you can see how it works.
+Initially the user does not say anything; then ELIZA resets its money
+counter and asks the user to tell what comes to mind open heartedly.
+The subsequent answers are converted to uppercase and stored for later
+comparison. ELIZA presents the bill when being confronted with a
+sentence that contains the phrase "shut up." Otherwise, it looks for
+keywords in the sentence, conjugates the rest of the sentence, remembers
+the keyword for later use, and finally selects an answer from the set of
+possible answers:
+
+ function ElizaSays(YouSay) {
+ if (YouSay == "") {
+ cost = 0
+ answer = "HI, IM ELIZA, TELL ME YOUR PROBLEM"
+ } else {
+ q = toupper(YouSay)
+ gsub("'", "", q)
+ if(q == qold) {
+ answer = "PLEASE DONT REPEAT YOURSELF !"
+ } else {
+ if (index(q, "SHUT UP") > 0) {
+ answer = "WELL, PLEASE PAY YOUR BILL. ITS EXACTLY ... $"\
+ int(100*rand()+30+cost/100)
+ } else {
+ qold = q
+ w = "-" # no keyword recognized yet
+ for (i in k) { # search for keywords
+ if (index(q, i) > 0) {
+ w = i
+ break
+ }
+ }
+ if (w == "-") { # no keyword, take old subject
+ w = wold
+ subj = subjold
+ } else { # find subject
+ subj = substr(q, index(q, w) + length(w)+1)
+ wold = w
+ subjold = subj # remember keyword and subject
+ }
+ for (i in conj)
+ gsub(i, conj[i], q) # conjugation
+ # from all answers to this keyword, select one randomly
+ answer = r[indices[int(split(k[w], indices) * rand()) + 1]]
+ # insert subject into answer
+ gsub("_", subj, answer)
+ }
+ }
+ }
+ cost += length(answer) # for later payment : 1 cent per character
+ return answer
+ }
+
+ In the long but simple function `SetUpEliza', you can see tables for
+conjugation, keywords, and answers.(1) The associative array `k'
+contains indices into the array of answers `r'. To choose an answer,
+ELIZA just picks an index randomly:
+
+ function SetUpEliza() {
+ srand()
+ wold = "-"
+ subjold = " "
+
+ # table for conjugation
+ conj[" ARE " ] = " AM "
+ conj["WERE " ] = "WAS "
+ conj[" YOU " ] = " I "
+ conj["YOUR " ] = "MY "
+ conj[" IVE " ] =\
+ conj[" I HAVE " ] = " YOU HAVE "
+ conj[" YOUVE " ] =\
+ conj[" YOU HAVE "] = " I HAVE "
+ conj[" IM " ] =\
+ conj[" I AM " ] = " YOU ARE "
+ conj[" YOURE " ] =\
+ conj[" YOU ARE " ] = " I AM "
+
+ # table of all answers
+ r[1] = "DONT YOU BELIEVE THAT I CAN _"
+ r[2] = "PERHAPS YOU WOULD LIKE TO BE ABLE TO _ ?"
+ ...
+
+ # table for looking up answers that
+ # fit to a certain keyword
+ k["CAN YOU"] = "1 2 3"
+ k["CAN I"] = "4 5"
+ k["YOU ARE"] =\
+ k["YOURE"] = "6 7 8 9"
+ ...
+
+ }
+
+ Some interesting remarks and details (including the original source
+code of ELIZA) are found on Mark Humphrys' home page. Yahoo! also has
+a page with a collection of ELIZA-like programs. Many of them are
+written in Java, some of them disclosing the Java source code, and a
+few even explain how to modify the Java source code.
+
+ ---------- Footnotes ----------
+
+ (1) The version shown here is abbreviated. The full version comes
+with the `gawk' distribution.
+
+
+File: gawkinet.info, Node: Caveats, Next: Challenges, Prev: Simple Server, Up: Using Networking
+
+Network Programming Caveats
+===========================
+
+ By now it should be clear that debugging a networked application is
+more complicated than debugging a single-process single-hosted
+application. The behavior of a networked application sometimes looks
+non-causal because it is not reproducible in a strong sense. Whether a
+network application works or not sometimes depends on the following:
+
+ * How crowded the underlying network is.
+
+ * If the party at the other end is running or not.
+
+ * The state of the party at the other end.
+
+ The most difficult problems for a beginner arise from the hidden
+states of the underlying network. After closing a TCP connection, it's
+often necessary to wait a short while before reopening the connection.
+Even more difficult is the establishment of a connection that
+previously ended with a "broken pipe." Those connections have to "time
+out" for a minute or so before they can reopen. Check this with the
+command `netstat -a', which provides a list of still "active"
+connections.
+
+
+File: gawkinet.info, Node: Challenges, Prev: Caveats, Up: Using Networking
+
+Where To Go From Here
+=====================
+
+ Now, you have learned enough to build your own application. You
+could, for example, take part in the Loebner Contest to win $100,000.
+The Loebner Prize is the first formal instantiation of a Turing Test.
+Hugh Loebner agreed with The Cambridge Center for Behavioral Studies to
+underwrite a contest designed to implement the Turing Test. Dr.
+Loebner pledged a Grand Prize of $100,000 for the first computer whose
+responses were indistinguishable from a human's. Each year an annual
+prize of $2000 and a bronze medal is awarded to the _most_ human
+computer. The winner of the annual contest is the best entry relative
+to other entries that year, irrespective of how good it is in an
+absolute sense. Here is an example of a conversation with the winning
+program of 1997:
+
+ (c)1997 Cambridge Center For Behavioral Studies all rights reserved [CONVERSE]
+ [Intelligent Research Ltd.] Start at: [1997/04/29 08:59:40]
+ PROGRAM[10:39:20]Hi, my name is Catherine, what's yours?
+ JUDGE02[10:39:36]My name is Nathan.
+ PROGRAM[10:39:37]Well, it's nice to meet you, Nathan.
+ PROGRAM[10:39:45]Did you see that story on CNN last night about the lesbian
+ PROGRAM[10:40:03]couple who came out at a White House party on Sunday?
+ JUDGE02[10:40:45]No. I'm sorry I missed that. How did the Prez take it?
+ PROGRAM[10:40:47]Ellen Degeneres was one of them - she was kissing her lover
+ PROGRAM[10:41:08]in front of Bill Clinton. Do you think he was very
+ PROGRAM[10:41:21]embarrassed?
+ JUDGE02[10:41:37]You tell me. I didn't see it.
+ PROGRAM[10:41:38]Are you still a Friend of Bill Clinton?
+ JUDGE02[10:42:22]Yes. I would like to talk about something else. Do you know anything about sculpture.
+ PROGRAM[10:42:24]Well, I suppose he's doing his best like most of us, but he
+ PROGRAM[10:42:35]does seem to attract an UNUSUAL amount of bad publicity,
+ PROGRAM[10:42:51]wouldnt you say--can it all be bad luck?
+ JUDGE02[10:43:20]I asked you if you knew anything about sculpture.
+ PROGRAM[10:43:21]OK, but what happens now--does it all drift on, with
+ PROGRAM[10:43:36]everyone waiting to see how much his friends have said about
+ PROGRAM[10:43:47]him under threat of lots and lots of jail-or will something
+ PROGRAM[10:44:01]dramatic actually happen?
+ JUDGE02[10:44:19]Do you know what sculpture is?
+ PROGRAM[10:44:20]Well, youre more a fan of his than I am I guess---though I
+ PROGRAM[10:44:34]cant SWEAR what Id have done in that locked hotel room, I
+ PROGRAM[10:44:51]must say.
+ JUDGE02[10:45:26]Have you ever been to the Salmagundi Club?
+ PROGRAM[10:45:29]Never. to go back to the original discussion Time to get
+ PROGRAM[10:45:43]off this one I think and onto something more down to earth!
+ JUDGE02[10:46:20]What is more down to earth than art?
+ PROGRAM[10:46:21]I don't know what -- to be honest. -
+ PROGRAM[10:46:30]I suppose it depends on where you're coming from, but as the
+ PROGRAM[10:46:46]song goes in My Fair Lady, "Why can't a woman be more like a
+ PROGRAM[10:47:03]man? "
+ JUDGE02[10:47:52]I liked that song but I prefer "Why can't children be more like we are"
+ JUDGE02[10:48:10]from another play the name of which I cannot remember.
+ PROGRAM[10:48:12]What, if anything, do you enjoy about being a man?
+ JUDGE02[10:49:01]I would enjoy all aspects of life no matter what my gender.
+ PROGRAM[10:49:02]Do you think of yourself as being attractive?
+
+ This program insists on always speaking about the same story around
+Bill Clinton. You see, even a program with a rather narrow mind can
+behave so much like a human being that it can win this prize. It is
+quite common to let these programs talk to each other via network
+connections. But during the competition itself, the program and its
+computer have to be present at the place the competition is held. We
+all would love to see a `gawk' program win in such an event. Maybe it
+is up to you to accomplish this?
+
+ Some other ideas for useful networked applications:
+ * Read the file `doc/awkforai.txt' in the `gawk' distribution. It
+ was written by Ronald P. Loui (Associate Professor of Computer
+ Science, at Washington University in St. Louis,
+ ) and summarizes why he teaches `gawk' to
+ students of Artificial Intelligence. Here are some passages from
+ the text:
+
+ The GAWK manual can be consumed in a single lab session and
+ the language can be mastered by the next morning by the
+ average student. GAWK's automatic initialization, implicit
+ coercion, I/O support and lack of pointers forgive many of
+ the mistakes that young programmers are likely to make.
+ Those who have seen C but not mastered it are happy to see
+ that GAWK retains some of the same sensibilities while adding
+ what must be regarded as spoonsful of syntactic sugar.
+ ...
+ There are further simple answers. Probably the best is the
+ fact that increasingly, undergraduate AI programming is
+ involving the Web. Oren Etzioni (University of Washington,
+ Seattle) has for a while been arguing that the "softbot" is
+ replacing the mechanical engineers' robot as the most
+ glamorous AI testbed. If the artifact whose behavior needs
+ to be controlled in an intelligent way is the software agent,
+ then a language that is well-suited to controlling the
+ software environment is the appropriate language. That would
+ imply a scripting language. If the robot is KAREL, then the
+ right language is "turn left; turn right." If the robot is
+ Netscape, then the right language is something that can
+ generate `netscape -remote
+ 'openURL(http://cs.wustl.edu/~loui)'' with elan.
+ ...
+ AI programming requires high-level thinking. There have
+ always been a few gifted programmers who can write high-level
+ programs in assembly language. Most however need the ambient
+ abstraction to have a higher floor.
+ ...
+ Second, inference is merely the expansion of notation. No
+ matter whether the logic that underlies an AI program is
+ fuzzy, probabilistic, deontic, defeasible, or deductive, the
+ logic merely defines how strings can be transformed into
+ other strings. A language that provides the best support for
+ string processing in the end provides the best support for
+ logic, for the exploration of various logics, and for most
+ forms of symbolic processing that AI might choose to call
+ "reasoning" instead of "logic." The implication is that
+ PROLOG, which saves the AI programmer from having to write a
+ unifier, saves perhaps two dozen lines of GAWK code at the
+ expense of strongly biasing the logic and representational
+ expressiveness of any approach.
+
+ Now that `gawk' itself can connect to the Internet, it should be
+ obvious that it is suitable for writing intelligent web agents.
+
+ * `awk' is strong at pattern recognition and string processing. So,
+ it is well suited to the classic problem of language translation.
+ A first try could be a program that knows the 100 most frequent
+ English words and their counterparts in German or French. The
+ service could be implemented by regularly reading email with the
+ program above, replacing each word by its translation and sending
+ the translation back via SMTP. Users would send English email to
+ their translation service and get back a translated email message
+ in return. As soon as this works, more effort can be spent on a
+ real translation program.
+
+ * Another dialogue-oriented application (on the verge of ridicule)
+ is the email "support service." Troubled customers write an email
+ to an automatic `gawk' service that reads the email. It looks for
+ keywords in the mail and assembles a reply email accordingly. By
+ carefully investigating the email header, and repeating these
+ keywords through the reply email, it is rather simple to give the
+ customer a feeling that someone cares. Ideally, such a service
+ would search a database of previous cases for solutions. If none
+ exists, the database could, for example, consist of all the
+ newsgroups, mailing lists and FAQs on the Internet.
+
+
+File: gawkinet.info, Node: Some Applications and Techniques, Next: Links, Prev: Using Networking, Up: Top
+
+Some Applications and Techniques
+********************************
+
+ In this major node, we look at a number of self-contained scripts,
+with an emphasis on concise networking. Along the way, we work towards
+creating building blocks that encapsulate often needed functions of the
+networking world, show new techniques that broaden the scope of
+problems that can be solved with `gawk', and explore leading edge
+technology that may shape the future of networking.
+
+ We often refer to the site-independent core of the server that we
+built in *Note A Simple Web Server: Simple Server. When building new
+and non-trivial servers, we always copy this building block and append
+new instances of the two functions `SetUpServer' and `HandleGET'.
+
+ This makes a lot of sense, since this scheme of event-driven
+execution provides `gawk' with an interface to the most widely accepted
+standard for GUIs: the web browser. Now, `gawk' can even rival Tcl/Tk.
+
+ Tcl and `gawk' have much in common. Both are simple scripting
+languages that allow us to quickly solve problems with short programs.
+But Tcl has Tk on top of it and `gawk' had nothing comparable up to
+now. While Tcl needs a large and ever changing library (Tk, which was
+bound to the X Window System until recently), `gawk' needs just the
+networking interface and some kind of browser on the client's side.
+Besides better portability, the most important advantage of this
+approach (embracing well-established standards such HTTP and HTML) is
+that _we do not need to change the language_. We let others do the work
+of fighting over protocols and standards. We can use HTML, JavaScript,
+VRML, or whatever else comes along to do our work.
+
+* Menu:
+
+* PANIC:: An Emergency Web Server.
+* GETURL:: Retrieving Web Pages.
+* REMCONF:: Remote Configuration Of Embedded Systems.
+* URLCHK:: Look For Changed Web Pages.
+* WEBGRAB:: Extract Links From A Page.
+* STATIST:: Graphing A Statistical Distribution.
+* MAZE:: Walking Through A Maze In Virtual Reality.
+* MOBAGWHO:: A Simple Mobile Agent.
+* STOXPRED:: Stock Market Prediction As A Service.
+* PROTBASE:: Searching Through A Protein Database.
+
+
+File: gawkinet.info, Node: PANIC, Next: GETURL, Prev: Some Applications and Techniques, Up: Some Applications and Techniques
+
+PANIC: an Emergency Web Server
+==============================
+
+ At first glance, the `"Hello, world"' example in *Note A Primitive
+Web Service: Primitive Service, seems useless. By adding just a few
+lines, we can turn it into something useful.
+
+ The PANIC program tells everyone who connects that the local site is
+not working. When a web server breaks down, it makes a difference if
+customers get a strange "network unreachable" message, or a short
+message telling them that the server has a problem. In such an
+emergency, the hard disk and everything on it (including the regular
+web service) may be unavailable. Rebooting the web server off a
+diskette makes sense in this setting.
+
+ To use the PANIC program as an emergency web server, all you need
+are the `gawk' executable and the program below on a diskette. By
+default, it connects to port 8080. A different value may be supplied on
+the command line:
+
+ BEGIN {
+ RS = ORS = "\r\n"
+ if (MyPort == 0) MyPort = 8080
+ HttpService = "/inet/tcp/" MyPort "/0/0"
+ Hello = "Out Of Service" \
+ "" \
+ "This site is temporarily out of service." \
+ "
"
+ Len = length(Hello) + length(ORS)
+ while ("awk" != "complex") {
+ print "HTTP/1.0 200 OK" |& HttpService
+ print "Content-Length: " Len ORS |& HttpService
+ print Hello |& HttpService
+ while ((HttpService |& getline) > 0)
+ continue;
+ close(HttpService)
+ }
+ }
+
+
+File: gawkinet.info, Node: GETURL, Next: REMCONF, Prev: PANIC, Up: Some Applications and Techniques
+
+GETURL: Retrieving Web Pages
+============================
+
+ GETURL is a versatile building block for shell scripts that need to
+retrieve files from the Internet. It takes a web address as a
+command-line parameter and tries to retrieve the contents of this
+address. The contents are printed to standard output, while the header
+is printed to `/dev/stderr'. A surrounding shell script could analyze
+the contents and extract the text or the links. An ASCII browser could
+be written around GETURL. But more interestingly, web robots are
+straightforward to write on top of GETURL. On the Internet, you can find
+several programs of the same name that do the same job. They are usually
+much more complex internally and at least 10 times longer.
+
+ At first, GETURL checks if it was called with exactly one web
+address. Then, it checks if the user chose to use a special proxy
+server whose name is handed over in a variable. By default, it is
+assumed that the local machine serves as proxy. GETURL uses the `GET'
+method by default to access the web page. By handing over the name of a
+different method (such as `HEAD'), it is possible to choose a different
+behavior. With the `HEAD' method, the user does not receive the body of
+the page content, but does receive the header:
+
+ BEGIN {
+ if (ARGC != 2) {
+ print "GETURL - retrieve Web page via HTTP 1.0"
+ print "IN:\n the URL as a command-line parameter"
+ print "PARAM(S):\n -v Proxy=MyProxy"
+ print "OUT:\n the page content on stdout"
+ print " the page header on stderr"
+ print "JK 16.05.1997"
+ print "ADR 13.08.2000"
+ exit
+ }
+ URL = ARGV[1]; ARGV[1] = ""
+ if (Proxy == "") Proxy = "127.0.0.1"
+ if (ProxyPort == 0) ProxyPort = 80
+ if (Method == "") Method = "GET"
+ HttpService = "/inet/tcp/0/" Proxy "/" ProxyPort
+ ORS = RS = "\r\n\r\n"
+ print Method " " URL " HTTP/1.0" |& HttpService
+ HttpService |& getline Header
+ print Header > "/dev/stderr"
+ while ((HttpService |& getline) > 0)
+ printf "%s", $0
+ close(HttpService)
+ }
+
+ This program can be changed as needed, but be careful with the last
+lines. Make sure transmission of binary data is not corrupted by
+additional line breaks. Even as it is now, the byte sequence
+`"\r\n\r\n"' would disappear if it were contained in binary data. Don't
+get caught in a trap when trying a quick fix on this one.
+
+
+File: gawkinet.info, Node: REMCONF, Next: URLCHK, Prev: GETURL, Up: Some Applications and Techniques
+
+REMCONF: Remote Configuration of Embedded Systems
+=================================================
+
+ Today, you often find powerful processors in embedded systems.
+Dedicated network routers and controllers for all kinds of machinery
+are examples of embedded systems. Processors like the Intel 80x86 or
+the AMD Elan are able to run multitasking operating systems, such as
+XINU or GNU/Linux in embedded PCs. These systems are small and usually
+do not have a keyboard or a display. Therefore it is difficult to set
+up their configuration. There are several widespread ways to set them
+up:
+
+ * DIP switches
+
+ * Read Only Memories such as EPROMs
+
+ * Serial lines or some kind of keyboard
+
+ * Network connections via `telnet' or SNMP
+
+ * HTTP connections with HTML GUIs
+
+ In this node, we look at a solution that uses HTTP connections to
+control variables of an embedded system that are stored in a file.
+Since embedded systems have tight limits on resources like memory, it
+is difficult to employ advanced techniques such as SNMP and HTTP
+servers. `gawk' fits in quite nicely with its single executable which
+needs just a short script to start working. The following program
+stores the variables in a file, and a concurrent process in the
+embedded system may read the file. The program uses the
+site-independent part of the simple web server that we developed in
+*Note A Web Service with Interaction: Interacting Service. As
+mentioned there, all we have to do is to write two new procedures
+`SetUpServer' and `HandleGET':
+
+ function SetUpServer() {
+ TopHeader = "Remote Configuration"
+ TopDoc = "\
+ Please choose one of the following actions:
\
+ "
+ TopFooter = ""
+ if (ConfigFile == "") ConfigFile = "config.asc"
+ }
+
+ The function `SetUpServer' initializes the top level HTML texts as
+usual. It also initializes the name of the file that contains the
+configuration parameters and their values. In case the user supplies a
+name from the command line, that name is used. The file is expected to
+contain one parameter per line, with the name of the parameter in
+column one and the value in column two.
+
+ The function `HandleGET' reflects the structure of the menu tree as
+usual. The first menu choice tells the user what this is all about. The
+second choice reads the configuration file line by line and stores the
+parameters and their values. Notice that the record separator for this
+file is `"\n"', in contrast to the record separator for HTTP. The third
+menu choice builds an HTML table to show the contents of the
+configuration file just read. The fourth choice does the real work of
+changing parameters, and the last one just saves the configuration into
+a file:
+
+ function HandleGET() {
+ if(MENU[2] == "AboutServer") {
+ Document = "This is a GUI for remote configuration of an\
+ embedded system. It is is implemented as one GAWK script."
+ } else if (MENU[2] == "ReadConfig") {
+ RS = "\n"
+ while ((getline < ConfigFile) > 0)
+ config[$1] = $2;
+ close(ConfigFile)
+ RS = "\r\n"
+ Document = "Configuration has been read."
+ } else if (MENU[2] == "CheckConfig") {
+ Document = ""
+ for (i in config)
+ Document = Document "" i " | " \
+ "" config[i] " |
"
+ Document = Document "
"
+ } else if (MENU[2] == "ChangeConfig") {
+ if ("Param" in GETARG) { # any parameter to set?
+ if (GETARG["Param"] in config) { # is parameter valid?
+ config[GETARG["Param"]] = GETARG["Value"]
+ Document = (GETARG["Param"] " = " GETARG["Value"] ".")
+ } else {
+ Document = "Parameter " GETARG["Param"] " is invalid."
+ }
+ } else {
+ Document = ""
+ }
+ } else if (MENU[2] == "SaveConfig") {
+ for (i in config)
+ printf("%s %s\n", i, config[i]) > ConfigFile
+ close(ConfigFile)
+ Document = "Configuration has been saved."
+ }
+ }
+
+ We could also view the configuration file as a database. From this
+point of view, the previous program acts like a primitive database
+server. Real SQL database systems also make a service available by
+providing a TCP port that clients can connect to. But the application
+level protocols they use are usually proprietary and also change from
+time to time. This is also true for the protocol that MiniSQL uses.
+
+
+File: gawkinet.info, Node: URLCHK, Next: WEBGRAB, Prev: REMCONF, Up: Some Applications and Techniques
+
+URLCHK: Look for Changed Web Pages
+==================================
+
+ Most people who make heavy use of Internet resources have a large
+bookmark file with pointers to interesting web sites. It is impossible
+to regularly check by hand if any of these sites have changed. A program
+is needed to automatically look at the headers of web pages and tell
+which ones have changed. URLCHK does the comparison after using GETURL
+with the `HEAD' method to retrieve the header.
+
+ Like GETURL, this program first checks that it is called with exactly
+one command-line parameter. URLCHK also takes the same command-line
+variables `Proxy' and `ProxyPort' as GETURL, because these variables
+are handed over to GETURL for each URL that gets checked. The one and
+only parameter is the name of a file that contains one line for each
+URL. In the first column, we find the URL, and the second and third
+columns hold the length of the URL's body when checked for the two last
+times. Now, we follow this plan:
+
+ 1. Read the URLs from the file and remember their most recent lengths
+
+ 2. Delete the contents of the file
+
+ 3. For each URL, check its new length and write it into the file
+
+ 4. If the most recent and the new length differ, tell the user
+
+ It may seem a bit peculiar to read the URLs from a file together
+with their two most recent lengths, but this approach has several
+advantages. You can call the program again and again with the same
+file. After running the program, you can regenerate the changed URLs by
+extracting those lines that differ in their second and third columns:
+
+ BEGIN {
+ if (ARGC != 2) {
+ print "URLCHK - check if URLs have changed"
+ print "IN:\n the file with URLs as a command-line parameter"
+ print " file contains URL, old length, new length"
+ print "PARAMS:\n -v Proxy=MyProxy -v ProxyPort=8080"
+ print "OUT:\n same as file with URLs"
+ print "JK 02.03.1998"
+ exit
+ }
+ URLfile = ARGV[1]; ARGV[1] = ""
+ if (Proxy != "") Proxy = " -v Proxy=" Proxy
+ if (ProxyPort != "") ProxyPort = " -v ProxyPort=" ProxyPort
+ while ((getline < URLfile) > 0)
+ Length[$1] = $3 + 0
+ close(URLfile) # now, URLfile is read in and can be updated
+ GetHeader = "gawk " Proxy ProxyPort " -v Method=\"HEAD\" -f geturl.awk "
+ for (i in Length) {
+ GetThisHeader = GetHeader i " 2>&1"
+ while ((GetThisHeader | getline) > 0)
+ if (toupper($0) ~ /CONTENT-LENGTH/) NewLength = $2 + 0
+ close(GetThisHeader)
+ print i, Length[i], NewLength > URLfile
+ if (Length[i] != NewLength) # report only changed URLs
+ print i, Length[i], NewLength
+ }
+ close(URLfile)
+ }
+
+ Another thing that may look strange is the way GETURL is called.
+Before calling GETURL, we have to check if the proxy variables need to
+be passed on. If so, we prepare strings that will become part of the
+command line later. In `GetHeader', we store these strings together
+with the longest part of the command line. Later, in the loop over the
+URLs, `GetHeader' is appended with the URL and a redirection operator
+to form the command that reads the URL's header over the Internet.
+GETURL always produces the headers over `/dev/stderr'. That is the
+reason why we need the redirection operator to have the header piped in.
+
+ This program is not perfect because it assumes that changing URLs
+results in changed lengths, which is not necessarily true. A more
+advanced approach is to look at some other header line that holds time
+information. But, as always when things get a bit more complicated,
+this is left as an exercise to the reader.
+
+
+File: gawkinet.info, Node: WEBGRAB, Next: STATIST, Prev: URLCHK, Up: Some Applications and Techniques
+
+WEBGRAB: Extract Links from a Page
+==================================
+
+ Sometimes it is necessary to extract links from web pages. Browsers
+do it, web robots do it, and sometimes even humans do it. Since we
+have a tool like GETURL at hand, we can solve this problem with some
+help from the Bourne shell:
+
+ BEGIN { RS = "http://[#%&\\+\\-\\./0-9\\:;\\?A-Z_a-z\\~]*" }
+ RT != "" {
+ command = ("gawk -v Proxy=MyProxy -f geturl.awk " RT \
+ " > doc" NR ".html")
+ print command
+ }
+
+ Notice that the regular expression for URLs is rather crude. A
+precise regular expression is much more complex. But this one works
+rather well. One problem is that it is unable to find internal links of
+an HTML document. Another problem is that `ftp', `telnet', `news',
+`mailto', and other kinds of links are missing in the regular
+expression. However, it is straightforward to add them, if doing so is
+necessary for other tasks.
+
+ This program reads an HTML file and prints all the HTTP links that
+it finds. It relies on `gawk''s ability to use regular expressions as
+record separators. With `RS' set to a regular expression that matches
+links, the second action is executed each time a non-empty link is
+found. We can find the matching link itself in `RT'.
+
+ The action could use the `system' function to let another GETURL
+retrieve the page, but here we use a different approach. This simple
+program prints shell commands that can be piped into `sh' for
+execution. This way it is possible to first extract the links, wrap
+shell commands around them, and pipe all the shell commands into a
+file. After editing the file, execution of the file retrieves exactly
+those files that we really need. In case we do not want to edit, we can
+retrieve all the pages like this:
+
+ gawk -f geturl.awk http://www.suse.de | gawk -f webgrab.awk | sh
+
+ After this, you will find the contents of all referenced documents in
+files named `doc*.html' even if they do not contain HTML code. The
+most annoying thing is that we always have to pass the proxy to GETURL.
+If you do not like to see the headers of the web pages appear on the
+screen, you can redirect them to `/dev/null'. Watching the headers
+appear can be quite interesting, because it reveals interesting details
+such as which web server the companies use. Now, it is clear how the
+clever marketing people use web robots to determine the market shares
+of Microsoft and Netscape in the web server market.
+
+ Port 80 of any web server is like a small hole in a repellent
+firewall. After attaching a browser to port 80, we usually catch a
+glimpse of the bright side of the server (its home page). With a tool
+like GETURL at hand, we are able to discover some of the more concealed
+or even "indecent" services (i.e., lacking conformity to standards of
+quality). It can be exciting to see the fancy CGI scripts that lie
+there, revealing the inner workings of the server, ready to be called:
+
+ * With a command such as:
+
+ gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/
+
+ some servers give you a directory listing of the CGI files.
+ Knowing the names, you can try to call some of them and watch for
+ useful results. Sometimes there are executables in such directories
+ (such as Perl interpreters) that you may call remotely. If there
+ are subdirectories with configuration data of the web server, this
+ can also be quite interesting to read.
+
+ * The well-known Apache web server usually has its CGI files in the
+ directory `/cgi-bin'. There you can often find the scripts
+ `test-cgi' and `printenv'. Both tell you some things about the
+ current connection and the installation of the web server. Just
+ call:
+
+ gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/test-cgi
+ gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/printenv
+
+ * Sometimes it is even possible to retrieve system files like the web
+ server's log file--possibly containing customer data--or even the
+ file `/etc/passwd'. (We don't recommend this!)
+
+ *Caution:* Although this may sound funny or simply irrelevant, we
+are talking about severe security holes. Try to explore your own system
+this way and make sure that none of the above reveals too much
+information about your system.
+
+
+File: gawkinet.info, Node: STATIST, Next: MAZE, Prev: WEBGRAB, Up: Some Applications and Techniques
+
+STATIST: Graphing a Statistical Distribution
+============================================
+
+ In the HTTP server examples we've shown thus far, we never present
+an image to the browser and its user. Presenting images is one task.
+Generating images that reflect some user input and presenting these
+dynamically generated images is another. In this node, we use GNUPlot
+for generating `.png', `.ps', or `.gif' files.(1)
+
+ The program we develop takes the statistical parameters of two
+samples and computes the t-test statistics. As a result, we get the
+probabilities that the means and the variances of both samples are the
+same. In order to let the user check plausibility, the program presents
+an image of the distributions. The statistical computation follows
+`Numerical Recipes in C: The Art of Scientific Computing' by William H.
+Press, Saul A. Teukolsky, William T. Vetterling, and Brian P. Flannery.
+Since `gawk' does not have a built-in function for the computation of
+the beta function, we use the `ibeta' function of GNUPlot. As a side
+effect, we learn how to use GNUPlot as a sophisticated calculator. The
+comparison of means is done as in `tutest', paragraph 14.2, page 613,
+and the comparison of variances is done as in `ftest', page 611 in
+`Numerical Recipes'.
+
+ As usual, we take the site-independent code for servers and append
+our own functions `SetUpServer' and `HandleGET':
+
+ function SetUpServer() {
+ TopHeader = "Statistics with GAWK"
+ TopDoc = "\
+ Please choose one of the following actions:
\
+ "
+ TopFooter = ""
+ GnuPlot = "gnuplot 2>&1"
+ m1=m2=0; v1=v2=1; n1=n2=10
+ }
+
+ Here, you see the menu structure that the user sees. Later, we will
+see how the program structure of the `HandleGET' function reflects the
+menu structure. What is missing here is the link for the image we
+generate. In an event-driven environment, request, generation, and
+delivery of images are separated.
+
+ Notice the way we initialize the `GnuPlot' command string for the
+pipe. By default, GNUPlot outputs the generated image via standard
+output, as well as the results of `print'(ed) calculations via standard
+error. The redirection causes standard error to be mixed into standard
+output, enabling us to read results of calculations with `getline'. By
+initializing the statistical parameters with some meaningful defaults,
+we make sure the user gets an image the first time he uses the program.
+
+ Following is the rather long function `HandleGET', which implements
+the contents of this service by reacting to the different kinds of
+requests from the browser. Before you start playing with this script,
+make sure that your browser supports JavaScript and that it also has
+this option switched on. The script uses a short snippet of JavaScript
+code for delayed opening of a window with an image. A more detailed
+explanation follows:
+
+ function HandleGET() {
+ if(MENU[2] == "AboutServer") {
+ Document = "This is a GUI for a statistical computation.\
+ It compares means and variances of two distributions.\
+ It is implemented as one GAWK script and uses GNUPLOT."
+ } else if (MENU[2] == "EnterParameters") {
+ Document = ""
+ if ("m1" in GETARG) { # are there parameters to compare?
+ Document = Document ""
+ m1 = GETARG["m1"]; v1 = GETARG["v1"]; n1 = GETARG["n1"]
+ m2 = GETARG["m2"]; v2 = GETARG["v2"]; n2 = GETARG["n2"]
+ t = (m1-m2)/sqrt(v1/n1+v2/n2)
+ df = (v1/n1+v2/n2)*(v1/n1+v2/n2)/((v1/n1)*(v1/n1)/(n1-1) \
+ + (v2/n2)*(v2/n2) /(n2-1))
+ if (v1>v2) {
+ f = v1/v2
+ df1 = n1 - 1
+ df2 = n2 - 1
+ } else {
+ f = v2/v1
+ df1 = n2 - 1
+ df2 = n1 - 1
+ }
+ print "pt=ibeta(" df/2 ",0.5," df/(df+t*t) ")" |& GnuPlot
+ print "pF=2.0*ibeta(" df2/2 "," df1/2 "," \
+ df2/(df2+df1*f) ")" |& GnuPlot
+ print "print pt, pF" |& GnuPlot
+ RS="\n"; GnuPlot |& getline; RS="\r\n" # $1 is pt, $2 is pF
+ print "invsqrt2pi=1.0/sqrt(2.0*pi)" |& GnuPlot
+ print "nd(x)=invsqrt2pi/sd*exp(-0.5*((x-mu)/sd)**2)" |& GnuPlot
+ print "set term png small color" |& GnuPlot
+ #print "set term postscript color" |& GnuPlot
+ #print "set term gif medium size 320,240" |& GnuPlot
+ print "set yrange[-0.3:]" |& GnuPlot
+ print "set label 'p(m1=m2) =" $1 "' at 0,-0.1 left" |& GnuPlot
+ print "set label 'p(v1=v2) =" $2 "' at 0,-0.2 left" |& GnuPlot
+ print "plot mu=" m1 ",sd=" sqrt(v1) ", nd(x) title 'sample 1',\
+ mu=" m2 ",sd=" sqrt(v2) ", nd(x) title 'sample 2'" |& GnuPlot
+ print "quit" |& GnuPlot
+ GnuPlot |& getline Image
+ while ((GnuPlot |& getline) > 0)
+ Image = Image RS $0
+ close(GnuPlot)
+ }
+ Document = Document "\
+ Do these samples have the same Gaussian distribution?
\
+
"
+ } else if (MENU[2] ~ "Image") {
+ Reason = "OK" ORS "Content-type: image/png"
+ #Reason = "OK" ORS "Content-type: application/x-postscript"
+ #Reason = "OK" ORS "Content-type: image/gif"
+ Header = Footer = ""
+ Document = Image
+ }
+ }
+
+ As usual, we give a short description of the service in the first
+menu choice. The third menu choice shows us that generation and
+presentation of an image are two separate actions. While the latter
+takes place quite instantly in the third menu choice, the former takes
+place in the much longer second choice. Image data passes from the
+generating action to the presenting action via the variable `Image'
+that contains a complete `.png' image, which is otherwise stored in a
+file. If you prefer `.ps' or `.gif' images over the default `.png'
+images, you may select these options by uncommenting the appropriate
+lines. But remember to do so in two places: when telling GNUPlot which
+kind of images to generate, and when transmitting the image at the end
+of the program.
+
+ Looking at the end of the program, the way we pass the
+`Content-type' to the browser is a bit unusual. It is appended to the
+`OK' of the first header line to make sure the type information becomes
+part of the header. The other variables that get transmitted across
+the network are made empty, because in this case we do not have an HTML
+document to transmit, but rather raw image data to contain in the body.
+
+ Most of the work is done in the second menu choice. It starts with a
+strange JavaScript code snippet. When first implementing this server,
+we used a short `"
"' here. But then
+browsers got smarter and tried to improve on speed by requesting the
+image and the HTML code at the same time. When doing this, the browser
+tries to build up a connection for the image request while the request
+for the HTML text is not yet completed. The browser tries to connect to
+the `gawk' server on port 8080 while port 8080 is still in use for
+transmission of the HTML text. The connection for the image cannot be
+built up, so the image appears as "broken" in the browser window. We
+solved this problem by telling the browser to open a separate window
+for the image, but only after a delay of 1000 milliseconds. By this
+time, the server should be ready for serving the next request.
+
+ But there is one more subtlety in the JavaScript code. Each time
+the JavaScript code opens a window for the image, the name of the image
+is appended with a timestamp (`systime'). Why this constant change of
+name for the image? Initially, we always named the image `Image', but
+then the Netscape browser noticed the name had _not_ changed since the
+previous request and displayed the previous image (caching behavior).
+The server core is implemented so that browsers are told _not_ to cache
+anything. Obviously HTTP requests do not always work as expected. One
+way to circumvent the cache of such overly smart browsers is to change
+the name of the image with each request. These three lines of JavaScript
+caused us a lot of trouble.
+
+ The rest can be broken down into two phases. At first, we check if
+there are statistical parameters. When the program is first started,
+there usually are no parameters because it enters the page coming from
+the top menu. Then, we only have to present the user a form that he
+can use to change statistical parameters and submit them. Subsequently,
+the submission of the form causes the execution of the first phase
+because _now_ there _are_ parameters to handle.
+
+ Now that we have parameters, we know there will be an image
+available. Therefore we insert the JavaScript code here to initiate
+the opening of the image in a separate window. Then, we prepare some
+variables that will be passed to GNUPlot for calculation of the
+probabilities. Prior to reading the results, we must temporarily change
+`RS' because GNUPlot separates lines with newlines. After instructing
+GNUPlot to generate a `.png' (or `.ps' or `.gif') image, we initiate
+the insertion of some text, explaining the resulting probabilities. The
+final `plot' command actually generates the image data. This raw binary
+has to be read in carefully without adding, changing, or deleting a
+single byte. Hence the unusual initialization of `Image' and completion
+with a `while' loop.
+
+ When using this server, it soon becomes clear that it is far from
+being perfect. It mixes source code of six scripting languages or
+protocols:
+
+ * GNU `awk' implements a server for the protocol:
+
+ * HTTP which transmits:
+
+ * HTML text which contains a short piece of:
+
+ * JavaScript code opening a separate window.
+
+ * A Bourne shell script is used for piping commands into:
+
+ * GNUPlot to generate the image to be opened.
+
+ After all this work, the GNUPlot image opens in the JavaScript window
+where it can be viewed by the user.
+
+ It is probably better not to mix up so many different languages.
+The result is not very readable. Furthermore, the statistical part of
+the server does not take care of invalid input. Among others, using
+negative variances will cause invalid results.
+
+ ---------- Footnotes ----------
+
+ (1) Due to licensing problems, the default installation of GNUPlot
+disables the generation of `.gif' files. If your installed version
+does not accept `set term gif', just download and install the most
+recent version of GNUPlot and the GD library
+(http://www.boutell.com/gd/) by Thomas Boutell. Otherwise you still
+have the chance to generate some ASCII-art style images with GNUPlot by
+using `set term dumb'. (We tried it and it worked.)
+
+
+File: gawkinet.info, Node: MAZE, Next: MOBAGWHO, Prev: STATIST, Up: Some Applications and Techniques
+
+MAZE: Walking Through a Maze In Virtual Reality
+===============================================
+
+ In the long run, every program becomes rococo, and then rubble.
+ Alan Perlis
+
+ By now, we know how to present arbitrary `Content-type's to a
+browser. In this node, our server will present a 3D world to our
+browser. The 3D world is described in a scene description language
+(VRML, Virtual Reality Modeling Language) that allows us to travel
+through a perspective view of a 2D maze with our browser. Browsers with
+a VRML plugin enable exploration of this technology. We could do one of
+those boring `Hello world' examples here, that are usually presented
+when introducing novices to VRML. If you have never written any VRML
+code, have a look at the VRML FAQ. Presenting a static VRML scene is a
+bit trivial; in order to expose `gawk''s new capabilities, we will
+present a dynamically generated VRML scene. The function `SetUpServer'
+is very simple because it only sets the default HTML page and
+initializes the random number generator. As usual, the surrounding
+server lets you browse the maze.
+
+ function SetUpServer() {
+ TopHeader = "Walk through a maze"
+ TopDoc = "\
+ Please choose one of the following actions:
\
+ "
+ TopFooter = ""
+ srand()
+ }
+
+ The function `HandleGET' is a bit longer because it first computes
+the maze and afterwards generates the VRML code that is sent across the
+network. As shown in the STATIST example (*note STATIST::), we set the
+type of the content to VRML and then store the VRML representation of
+the maze as the page content. We assume that the maze is stored in a 2D
+array. Initially, the maze consists of walls only. Then, we add an
+entry and an exit to the maze and let the rest of the work be done by
+the function `MakeMaze'. Now, only the wall fields are left in the
+maze. By iterating over the these fields, we generate one line of VRML
+code for each wall field.
+
+ function HandleGET() {
+ if (MENU[2] == "AboutServer") {
+ Document = "If your browser has a VRML 2 plugin,\
+ this server shows you a simple VRML scene."
+ } else if (MENU[2] == "VRMLtest") {
+ XSIZE = YSIZE = 11 # initially, everything is wall
+ for (y = 0; y < YSIZE; y++)
+ for (x = 0; x < XSIZE; x++)
+ Maze[x, y] = "#"
+ delete Maze[0, 1] # entry is not wall
+ delete Maze[XSIZE-1, YSIZE-2] # exit is not wall
+ MakeMaze(1, 1)
+ Document = "\
+ #VRML V2.0 utf8\n\
+ Group {\n\
+ children [\n\
+ PointLight {\n\
+ ambientIntensity 0.2\n\
+ color 0.7 0.7 0.7\n\
+ location 0.0 8.0 10.0\n\
+ }\n\
+ DEF B1 Background {\n\
+ skyColor [0 0 0, 1.0 1.0 1.0 ]\n\
+ skyAngle 1.6\n\
+ groundColor [1 1 1, 0.8 0.8 0.8, 0.2 0.2 0.2 ]\n\
+ groundAngle [ 1.2 1.57 ]\n\
+ }\n\
+ DEF Wall Shape {\n\
+ geometry Box {size 1 1 1}\n\
+ appearance Appearance { material Material { diffuseColor 0 0 1 } }\n\
+ }\n\
+ DEF Entry Viewpoint {\n\
+ position 0.5 1.0 5.0\n\
+ orientation 0.0 0.0 -1.0 0.52\n\
+ }\n"
+ for (i in Maze) {
+ split(i, t, SUBSEP)
+ Document = Document " Transform { translation "
+ Document = Document t[1] " 0 -" t[2] " children USE Wall }\n"
+ }
+ Document = Document " ] # end of group for world\n}"
+ Reason = "OK" ORS "Content-type: model/vrml"
+ Header = Footer = ""
+ }
+ }
+
+ Finally, we have a look at `MakeMaze', the function that generates
+the `Maze' array. When entered, this function assumes that the array
+has been initialized so that each element represents a wall element and
+the maze is initially full of wall elements. Only the entrance and the
+exit of the maze should have been left free. The parameters of the
+function tell us which element must be marked as not being a wall.
+After this, we take a look at the four neighbouring elements and
+remember which we have already treated. Of all the neighbouring
+elements, we take one at random and walk in that direction. Therefore,
+the wall element in that direction has to be removed and then, we call
+the function recursively for that element. The maze is only completed
+if we iterate the above procedure for _all_ neighbouring elements (in
+random order) and for our present element by recursively calling the
+function for the present element. This last iteration could have been
+done in a loop, but it is done much simpler recursively.
+
+ Notice that elements with coordinates that are both odd are assumed
+to be on our way through the maze and the generating process cannot
+terminate as long as there is such an element not being `delete'd. All
+other elements are potentially part of the wall.
+
+ function MakeMaze(x, y) {
+ delete Maze[x, y] # here we are, we have no wall here
+ p = 0 # count unvisited fields in all directions
+ if (x-2 SUBSEP y in Maze) d[p++] = "-x"
+ if (x SUBSEP y-2 in Maze) d[p++] = "-y"
+ if (x+2 SUBSEP y in Maze) d[p++] = "+x"
+ if (x SUBSEP y+2 in Maze) d[p++] = "+y"
+ if (p>0) { # if there are univisited fields, go there
+ p = int(p*rand()) # choose one unvisited field at random
+ if (d[p] == "-x") { delete Maze[x - 1, y]; MakeMaze(x - 2, y)
+ } else if (d[p] == "-y") { delete Maze[x, y - 1]; MakeMaze(x, y - 2)
+ } else if (d[p] == "+x") { delete Maze[x + 1, y]; MakeMaze(x + 2, y)
+ } else if (d[p] == "+y") { delete Maze[x, y + 1]; MakeMaze(x, y + 2)
+ } # we are back from recursion
+ MakeMaze(x, y); # try again while there are unvisited fields
+ }
+ }
+
+
+File: gawkinet.info, Node: MOBAGWHO, Next: STOXPRED, Prev: MAZE, Up: Some Applications and Techniques
+
+MOBAGWHO: a Simple Mobile Agent
+===============================
+
+ There are two ways of constructing a software design: One way is to
+ make it so simple that there are obviously no deficiencies, and the
+ other way is to make it so complicated that there are no obvious
+ deficiencies.
+ C. A. R. Hoare
+
+ A "mobile agent" is a program that can be dispatched from a computer
+and transported to a remote server for execution. This is called
+"migration", which means that a process on another system is started
+that is independent from its originator. Ideally, it wanders through a
+network while working for its creator or owner. In places like the UMBC
+Agent Web, people are quite confident that (mobile) agents are a
+software engineering paradigm that enables us to significantly increase
+the efficiency of our work. Mobile agents could become the mediators
+between users and the networking world. For an unbiased view at this
+technology, see the remarkable paper `Mobile Agents: Are they a good
+idea?'.(1)
+
+ When trying to migrate a process from one system to another, a
+server process is needed on the receiving side. Depending on the kind
+of server process, several ways of implementation come to mind. How
+the process is implemented depends upon the kind of server process:
+
+ * HTTP can be used as the protocol for delivery of the migrating
+ process. In this case, we use a common web server as the receiving
+ server process. A universal CGI script mediates between migrating
+ process and web server. Each server willing to accept migrating
+ agents makes this universal service available. HTTP supplies the
+ `POST' method to transfer some data to a file on the web server.
+ When a CGI script is called remotely with the `POST' method
+ instead of the usual `GET' method, data is transmitted from the
+ client process to the standard input of the server's CGI script.
+ So, to implement a mobile agent, we must not only write the agent
+ program to start on the client side, but also the CGI script to
+ receive the agent on the server side.
+
+ * The `PUT' method can also be used for migration. HTTP does not
+ require a CGI script for migration via `PUT'. However, with common
+ web servers there is no advantage to this solution, because web
+ servers such as Apache require explicit activation of a special
+ `PUT' script.
+
+ * `Agent Tcl' pursues a different course; it relies on a dedicated
+ server process with a dedicated protocol specialized for receiving
+ mobile agents.
+
+ Our agent example abuses a common web server as a migration tool.
+So, it needs a universal CGI script on the receiving side (the web
+server). The receiving script is activated with a `POST' request when
+placed into a location like `/httpd/cgi-bin/PostAgent.sh'. Make sure
+that the server system uses a version of `gawk' that supports network
+access (Version 3.1 or later; verify with `gawk --version').
+
+ #!/bin/sh
+ MobAg=/tmp/MobileAgent.$$
+ # direct script to mobile agent file
+ cat > $MobAg
+ # execute agent concurrently
+ gawk -f $MobAg $MobAg > /dev/null &
+ # HTTP header, terminator and body
+ gawk 'BEGIN { print "\r\nAgent started" }'
+ rm $MobAg # delete script file of agent
+
+ By making its process id (`$$') part of the unique file name, the
+script avoids conflicts between concurrent instances of the script.
+First, all lines from standard input (the mobile agent's source code)
+are copied into this unique file. Then, the agent is started as a
+concurrent process and a short message reporting this fact is sent to
+the submitting client. Finally, the script file of the mobile agent is
+removed because it is no longer needed. Although it is a short script,
+there are several noteworthy points:
+
+Security
+ _There is none_. In fact, the CGI script should never be made
+ available on a server that is part of the Internet because everyone
+ would be allowed to execute arbitrary commands with it. This
+ behavior is acceptable only when performing rapid prototyping.
+
+Self-Reference
+ Each migrating instance of an agent is started in a way that
+ enables it to read its own source code from standard input and use
+ the code for subsequent migrations. This is necessary because it
+ needs to treat the agent's code as data to transmit. `gawk' is not
+ the ideal language for such a job. Lisp and Tcl are more suitable
+ because they do not make a distinction between program code and
+ data.
+
+Independence
+ After migration, the agent is not linked to its former home in any
+ way. By reporting `Agent started', it waves "Goodbye" to its
+ origin. The originator may choose to terminate or not.
+
+ The originating agent itself is started just like any other
+command-line script, and reports the results on standard output. By
+letting the name of the original host migrate with the agent, the agent
+that migrates to a host far away from its origin can report the result
+back home. Having arrived at the end of the journey, the agent
+establishes a connection and reports the results. This is the reason
+for determining the name of the host with `uname -n' and storing it in
+`MyOrigin' for later use. We may also set variables with the `-v'
+option from the command line. This interactivity is only of importance
+in the context of starting a mobile agent; therefore this `BEGIN'
+pattern and its action do not take part in migration:
+
+ BEGIN {
+ if (ARGC != 2) {
+ print "MOBAG - a simple mobile agent"
+ print "CALL:\n gawk -f mobag.awk mobag.awk"
+ print "IN:\n the name of this script as a command-line parameter"
+ print "PARAM:\n -v MyOrigin=myhost.com"
+ print "OUT:\n the result on stdout"
+ print "JK 29.03.1998 01.04.1998"
+ exit
+ }
+ if (MyOrigin == "") {
+ "uname -n" | getline MyOrigin
+ close("uname -n")
+ }
+ }
+
+ Since `gawk' cannot manipulate and transmit parts of the program
+directly, the source code is read and stored in strings. Therefore,
+the program scans itself for the beginning and the ending of functions.
+Each line in between is appended to the code string until the end of
+the function has been reached. A special case is this part of the
+program itself. It is not a function. Placing a similar framework
+around it causes it to be treated like a function. Notice that this
+mechanism works for all the functions of the source code, but it cannot
+guarantee that the order of the functions is preserved during migration:
+
+ #ReadMySelf
+ /^function / { FUNC = $2 }
+ /^END/ || /^#ReadMySelf/ { FUNC = $1 }
+ FUNC != "" { MOBFUN[FUNC] = MOBFUN[FUNC] RS $0 }
+ (FUNC != "") && (/^}/ || /^#EndOfMySelf/) \
+ { FUNC = "" }
+ #EndOfMySelf
+
+ The web server code in *Note A Web Service with Interaction:
+Interacting Service, was first developed as a site-independent core.
+Likewise, the `gawk'-based mobile agent starts with an
+agent-independent core, to which can be appended application-dependent
+functions. What follows is the only application-independent function
+needed for the mobile agent:
+
+ function migrate(Destination, MobCode, Label) {
+ MOBVAR["Label"] = Label
+ MOBVAR["Destination"] = Destination
+ RS = ORS = "\r\n"
+ HttpService = "/inet/tcp/0/" Destination
+ for (i in MOBFUN)
+ MobCode = (MobCode "\n" MOBFUN[i])
+ MobCode = MobCode "\n\nBEGIN {"
+ for (i in MOBVAR)
+ MobCode = (MobCode "\n MOBVAR[\"" i "\"] = \"" MOBVAR[i] "\"")
+ MobCode = MobCode "\n}\n"
+ print "POST /cgi-bin/PostAgent.sh HTTP/1.0" |& HttpService
+ print "Content-length:", length(MobCode) ORS |& HttpService
+ printf "%s", MobCode |& HttpService
+ while ((HttpService |& getline) > 0)
+ print $0
+ close(HttpService)
+ }
+
+ The `migrate' function prepares the aforementioned strings
+containing the program code and transmits them to a server. A
+consequence of this modular approach is that the `migrate' function
+takes some parameters that aren't needed in this application, but that
+will be in future ones. Its mandatory parameter `Destination' holds the
+name (or IP address) of the server that the agent wants as a host for
+its code. The optional parameter `MobCode' may contain some `gawk' code
+that is inserted during migration in front of all other code. The
+optional parameter `Label' may contain a string that tells the agent
+what to do in program execution after arrival at its new home site. One
+of the serious obstacles in implementing a framework for mobile agents
+is that it does not suffice to migrate the code. It is also necessary
+to migrate the state of execution of the agent. In contrast to `Agent
+Tcl', this program does not try to migrate the complete set of
+variables. The following conventions are used:
+
+ * Each variable in an agent program is local to the current host and
+ does _not_ migrate.
+
+ * The array `MOBFUN' shown above is an exception. It is handled by
+ the function `migrate' and does migrate with the application.
+
+ * The other exception is the array `MOBVAR'. Each variable that
+ takes part in migration has to be an element of this array.
+ `migrate' also takes care of this.
+
+ Now it's clear what happens to the `Label' parameter of the function
+`migrate'. It is copied into `MOBVAR["Label"]' and travels alongside
+the other data. Since travelling takes place via HTTP, records must be
+separated with `"\r\n"' in `RS' and `ORS' as usual. The code assembly
+for migration takes place in three steps:
+
+ * Iterate over `MOBFUN' to collect all functions verbatim.
+
+ * Prepare a `BEGIN' pattern and put assignments to mobile variables
+ into the action part.
+
+ * Transmission itself resembles GETURL: the header with the request
+ and the `Content-length' is followed by the body. In case there is
+ any reply over the network, it is read completely and echoed to
+ standard output to avoid irritating the server.
+
+ The application-independent framework is now almost complete. What
+follows is the `END' pattern that is executed when the mobile agent has
+finished reading its own code. First, it checks whether it is already
+running on a remote host or not. In case initialization has not yet
+taken place, it starts `MyInit'. Otherwise (later, on a remote host), it
+starts `MyJob':
+
+ END {
+ if (ARGC != 2) exit # stop when called with wrong parameters
+ if (MyOrigin != "") # is this the originating host?
+ MyInit() # if so, initialize the application
+ else # we are on a host with migrated data
+ MyJob() # so we do our job
+ }
+
+ All that's left to extend the framework into a complete application
+is to write two application-specific functions: `MyInit' and `MyJob'.
+Keep in mind that the former is executed once on the originating host,
+while the latter is executed after each migration:
+
+ function MyInit() {
+ MOBVAR["MyOrigin"] = MyOrigin
+ MOBVAR["Machines"] = "localhost/80 max/80 moritz/80 castor/80"
+ split(MOBVAR["Machines"], Machines) # which host is the first?
+ migrate(Machines[1], "", "") # go to the first host
+ while (("/inet/tcp/8080/0/0" |& getline) > 0) # wait for result
+ print $0 # print result
+ close("/inet/tcp/8080/0/0")
+ }
+
+ As mentioned earlier, this agent takes the name of its origin
+(`MyOrigin') with it. Then, it takes the name of its first destination
+and goes there for further work. Notice that this name has the port
+number of the web server appended to the name of the server, because
+the function `migrate' needs it this way to create the `HttpService'
+variable. Finally, it waits for the result to arrive. The `MyJob'
+function runs on the remote host:
+
+ function MyJob() {
+ # forget this host
+ sub(MOBVAR["Destination"], "", MOBVAR["Machines"])
+ MOBVAR["Result"]=MOBVAR["Result"] SUBSEP SUBSEP MOBVAR["Destination"] ":"
+ while (("who" | getline) > 0) # who is logged in?
+ MOBVAR["Result"] = MOBVAR["Result"] SUBSEP $0
+ close("who")
+ if (index(MOBVAR["Machines"], "/") > 0) { # any more machines to visit?
+ split(MOBVAR["Machines"], Machines) # which host is next?
+ migrate(Machines[1], "", "") # go there
+ } else { # no more machines
+ gsub(SUBSEP, "\n", MOBVAR["Result"]) # send result to origin
+ print MOBVAR["Result"] |& "/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080"
+ close("/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080")
+ }
+ }
+
+ After migrating, the first thing to do in `MyJob' is to delete the
+name of the current host from the list of hosts to visit. Now, it is
+time to start the real work by appending the host's name to the result
+string, and reading line by line who is logged in on this host. A very
+annoying circumstance is the fact that the elements of `MOBVAR' cannot
+hold the newline character (`"\n"'). If they did, migration of this
+string did not work because the string didn't obey the syntax rule for
+a string in `gawk'. `SUBSEP' is used as a temporary replacement. If
+the list of hosts to visit holds at least one more entry, the agent
+migrates to that place to go on working there. Otherwise, we replace
+the `SUBSEP's with a newline character in the resulting string, and
+report it to the originating host, whose name is stored in
+`MOBVAR["MyOrigin"]'.
+
+ ---------- Footnotes ----------
+
+ (1) `http://www.research.ibm.com/massive/mobag.ps'
+
+
+File: gawkinet.info, Node: STOXPRED, Next: PROTBASE, Prev: MOBAGWHO, Up: Some Applications and Techniques
+
+STOXPRED: Stock Market Prediction As A Service
+==============================================
+
+ Far out in the uncharted backwaters of the unfashionable end of
+ the Western Spiral arm of the Galaxy lies a small unregarded
+ yellow sun.
+
+ Orbiting this at a distance of roughly ninety-two million miles is
+ an utterly insignificant little blue-green planet whose
+ ape-descendent life forms are so amazingly primitive that they
+ still think digital watches are a pretty neat idea.
+
+ This planet has -- or rather had -- a problem, which was this:
+ most of the people living on it were unhappy for pretty much of
+ the time. Many solutions were suggested for this problem, but
+ most of these were largely concerned with the movements of small
+ green pieces of paper, which is odd because it wasn't the small
+ green pieces of paper that were unhappy.
+ Douglas Adams, `The Hitch Hiker's Guide to the Galaxy'
+
+ Valuable services on the Internet are usually _not_ implemented as
+mobile agents. There are much simpler ways of implementing services.
+All Unix systems provide, for example, the `cron' service. Unix system
+users can write a list of tasks to be done each day, each week, twice a
+day, or just once. The list is entered into a file named `crontab'.
+For example, to distribute a newsletter on a daily basis this way, use
+`cron' for calling a script each day early in the morning.
+
+ # run at 8 am on weekdays, distribute the newsletter
+ 0 8 * * 1-5 $HOME/bin/daily.job >> $HOME/log/newsletter 2>&1
+
+ The script first looks for interesting information on the Internet,
+assembles it in a nice form and sends the results via email to the
+customers.
+
+ The following is an example of a primitive newsletter on stock
+market prediction. It is a report which first tries to predict the
+change of each share in the Dow Jones Industrial Index for the
+particular day. Then it mentions some especially promising shares as
+well as some shares which look remarkably bad on that day. The report
+ends with the usual disclaimer which tells every child _not_ to try
+this at home and hurt anybody.
+
+ Good morning Uncle Scrooge,
+
+ This is your daily stock market report for Monday, October 16, 2000.
+ Here are the predictions for today:
+
+ AA neutral
+ GE up
+ JNJ down
+ MSFT neutral
+ ...
+ UTX up
+ DD down
+ IBM up
+ MO down
+ WMT up
+ DIS up
+ INTC up
+ MRK down
+ XOM down
+ EK down
+ IP down
+
+ The most promising shares for today are these:
+
+ INTC http://biz.yahoo.com/n/i/intc.html
+
+ The stock shares to avoid today are these:
+
+ EK http://biz.yahoo.com/n/e/ek.html
+ IP http://biz.yahoo.com/n/i/ip.html
+ DD http://biz.yahoo.com/n/d/dd.html
+ ...
+
+ The script as a whole is rather long. In order to ease the pain of
+studying other people's source code, we have broken the script up into
+meaningful parts which are invoked one after the other. The basic
+structure of the script is as follows:
+
+ BEGIN {
+ Init()
+ ReadQuotes()
+ CleanUp()
+ Prediction()
+ Report()
+ SendMail()
+ }
+
+ The earlier parts store data into variables and arrays which are
+subsequently used by later parts of the script. The `Init' function
+first checks if the script is invoked correctly (without any
+parameters). If not, it informs the user of the correct usage. What
+follows are preparations for the retrieval of the historical quote
+data. The names of the 30 stock shares are stored in an array `name'
+along with the current date in `day', `month', and `year'.
+
+ All users who are separated from the Internet by a firewall and have
+to direct their Internet accesses to a proxy must supply the name of
+the proxy to this script with the `-v Proxy=NAME' option. For most
+users, the default proxy and port number should suffice.
+
+ function Init() {
+ if (ARGC != 1) {
+ print "STOXPRED - daily stock share prediction"
+ print "IN:\n no parameters, nothing on stdin"
+ print "PARAM:\n -v Proxy=MyProxy -v ProxyPort=80"
+ print "OUT:\n commented predictions as email"
+ print "JK 09.10.2000"
+ exit
+ }
+ # Remember ticker symbols from Dow Jones Industrial Index
+ StockCount = split("AA GE JNJ MSFT AXP GM JPM PG BA HD KO \
+ SBC C HON MCD T CAT HWP MMM UTX DD IBM MO WMT DIS INTC \
+ MRK XOM EK IP", name);
+ # Remember the current date as the end of the time series
+ day = strftime("%d")
+ month = strftime("%m")
+ year = strftime("%Y")
+ if (Proxy == "") Proxy = "chart.yahoo.com"
+ if (ProxyPort == 0) ProxyPort = 80
+ YahooData = "/inet/tcp/0/" Proxy "/" ProxyPort
+ }
+
+ There are two really interesting parts in the script. One is the
+function which reads the historical stock quotes from an Internet
+server. The other is the one that does the actual prediction. In the
+following function we see how the quotes are read from the Yahoo
+server. The data which comes from the server is in CSV format
+(comma-separated values):
+
+ Date,Open,High,Low,Close,Volume
+ 9-Oct-00,22.75,22.75,21.375,22.375,7888500
+ 6-Oct-00,23.8125,24.9375,21.5625,22,10701100
+ 5-Oct-00,24.4375,24.625,23.125,23.50,5810300
+
+ Lines contain values of the same time instant, whereas columns are
+separated by commas and contain the kind of data that is described in
+the header (first) line. At first, `gawk' is instructed to separate
+columns by commas (`FS = ","'). In the loop that follows, a connection
+to the Yahoo server is first opened, then a download takes place, and
+finally the connection is closed. All this happens once for each ticker
+symbol. In the body of this loop, an Internet address is built up as a
+string according to the rules of the Yahoo server. The starting and
+ending date are chosen to be exactly the same, but one year apart in
+the past. All the action is initiated within the `printf' command which
+transmits the request for data to the Yahoo server.
+
+ In the inner loop, the server's data is first read and then scanned
+line by line. Only lines which have six columns and the name of a month
+in the first column contain relevant data. This data is stored in the
+two-dimensional array `quote'; one dimension being time, the other
+being the ticker symbol. During retrieval of the first stock's data,
+the calendar names of the time instances are stored in the array `day'
+because we need them later.
+
+ function ReadQuotes() {
+ # Retrieve historical data for each ticker symbol
+ FS = ","
+ for (stock = 1; stock <= StockCount; stock++) {
+ URL = "http://chart.yahoo.com/table.csv?s=" name[stock] \
+ "&a=" month "&b=" day "&c=" year-1 \
+ "&d=" month "&e=" day "&f=" year \
+ "g=d&q=q&y=0&z=" name[stock] "&x=.csv"
+ printf("GET " URL " HTTP/1.0\r\n\r\n") |& YahooData
+ while ((YahooData |& getline) > 0) {
+ if (NF == 6 && $1 ~ /Jan|Feb|Mar|Apr|May|Jun|Jul|Aug|Sep|Oct|Nov|Dec/) {
+ if (stock == 1)
+ days[++daycount] = $1;
+ quote[$1, stock] = $5
+ }
+ }
+ close(YahooData)
+ }
+ FS = " "
+ }
+
+ Now that we _have_ the data, it can be checked once again to make
+sure that no individual stock is missing or invalid, and that all the
+stock quotes are aligned correctly. Furthermore, we renumber the time
+instances. The most recent day gets day number 1 and all other days get
+consecutive numbers. All quotes are rounded toward the nearest whole
+number in US Dollars.
+
+ function CleanUp() {
+ # clean up time series; eliminate incomplete data sets
+ for (d = 1; d <= daycount; d++) {
+ for (stock = 1; stock <= StockCount; stock++)
+ if (! ((days[d], stock) in quote))
+ stock = StockCount + 10
+ if (stock > StockCount + 1)
+ continue
+ datacount++
+ for (stock = 1; stock <= StockCount; stock++)
+ data[datacount, stock] = int(0.5 + quote[days[d], stock])
+ }
+ delete quote
+ delete days
+ }
+
+ Now we have arrived at the second really interesting part of the
+whole affair. What we present here is a very primitive prediction
+algorithm: _If a stock fell yesterday, assume it will also fall today;
+if it rose yesterday, assume it will rise today_. (Feel free to
+replace this algorithm with a smarter one.) If a stock changed in the
+same direction on two consecutive days, this is an indication which
+should be highlighted. Two-day advances are stored in `hot' and
+two-day declines in `avoid'.
+
+ The rest of the function is a sanity check. It counts the number of
+correct predictions in relation to the total number of predictions one
+could have made in the year before.
+
+ function Prediction() {
+ # Predict each ticker symbol by prolonging yesterday's trend
+ for (stock = 1; stock <= StockCount; stock++) {
+ if (data[1, stock] > data[2, stock]) {
+ predict[stock] = "up"
+ } else if (data[1, stock] < data[2, stock]) {
+ predict[stock] = "down"
+ } else {
+ predict[stock] = "neutral"
+ }
+ if ((data[1, stock] > data[2, stock]) && (data[2, stock] > data[3, stock]))
+ hot[stock] = 1
+ if ((data[1, stock] < data[2, stock]) && (data[2, stock] < data[3, stock]))
+ avoid[stock] = 1
+ }
+ # Do a plausibility check: how many predictions proved correct?
+ for (s = 1; s <= StockCount; s++) {
+ for (d = 1; d <= datacount-2; d++) {
+ if (data[d+1, s] > data[d+2, s]) {
+ UpCount++
+ } else if (data[d+1, s] < data[d+2, s]) {
+ DownCount++
+ } else {
+ NeutralCount++
+ }
+ if (((data[d, s] > data[d+1, s]) && (data[d+1, s] > data[d+2, s])) ||
+ ((data[d, s] < data[d+1, s]) && (data[d+1, s] < data[d+2, s])) ||
+ ((data[d, s] == data[d+1, s]) && (data[d+1, s] == data[d+2, s])))
+ CorrectCount++
+ }
+ }
+ }
+
+ At this point the hard work has been done: the array `predict'
+contains the predictions for all the ticker symbols. It is up to the
+function `Report' to find some nice words to introduce the desired
+information.
+
+ function Report() {
+ # Generate report
+ report = "\nThis is your daily "
+ report = report "stock market report for "strftime("%A, %B %d, %Y")".\n"
+ report = report "Here are the predictions for today:\n\n"
+ for (stock = 1; stock <= StockCount; stock++)
+ report = report "\t" name[stock] "\t" predict[stock] "\n"
+ for (stock in hot) {
+ if (HotCount++ == 0)
+ report = report "\nThe most promising shares for today are these:\n\n"
+ report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \
+ tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n"
+ }
+ for (stock in avoid) {
+ if (AvoidCount++ == 0)
+ report = report "\nThe stock shares to avoid today are these:\n\n"
+ report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \
+ tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n"
+ }
+ report = report "\nThis sums up to " HotCount+0 " winners and " AvoidCount+0
+ report = report " losers. When using this kind\nof prediction scheme for"
+ report = report " the 12 months which lie behind us,\nwe get " UpCount
+ report = report " 'ups' and " DownCount " 'downs' and " NeutralCount
+ report = report " 'neutrals'. Of all\nthese " UpCount+DownCount+NeutralCount
+ report = report " predictions " CorrectCount " proved correct next day.\n"
+ report = report "A success rate of "\
+ int(100*CorrectCount/(UpCount+DownCount+NeutralCount)) "%.\n"
+ report = report "Random choice would have produced a 33% success rate.\n"
+ report = report "Disclaimer: Like every other prediction of the stock\n"
+ report = report "market, this report is, of course, complete nonsense.\n"
+ report = report "If you are stupid enough to believe these predictions\n"
+ report = report "you should visit a doctor who can treat your ailment."
+ }
+
+ The function `SendMail' goes through the list of customers and opens
+a pipe to the `mail' command for each of them. Each one receives an
+email message with a proper subject heading and is addressed with his
+full name.
+
+ function SendMail() {
+ # send report to customers
+ customer["uncle.scrooge@ducktown.gov"] = "Uncle Scrooge"
+ customer["more@utopia.org" ] = "Sir Thomas More"
+ customer["spinoza@denhaag.nl" ] = "Baruch de Spinoza"
+ customer["marx@highgate.uk" ] = "Karl Marx"
+ customer["keynes@the.long.run" ] = "John Maynard Keynes"
+ customer["bierce@devil.hell.org" ] = "Ambrose Bierce"
+ customer["laplace@paris.fr" ] = "Pierre Simon de Laplace"
+ for (c in customer) {
+ MailPipe = "mail -s 'Daily Stock Prediction Newsletter'" c
+ print "Good morning " customer[c] "," | MailPipe
+ print report "\n.\n" | MailPipe
+ close(MailPipe)
+ }
+ }
+
+ Be patient when running the script by hand. Retrieving the data for
+all the ticker symbols and sending the emails may take several minutes
+to complete, depending upon network traffic and the speed of the
+available Internet link. The quality of the prediction algorithm is
+likely to be disappointing. Try to find a better one. Should you find
+one with a success rate of more than 50%, please tell us about it! It
+is only for the sake of curiosity, of course. `:-)'
+
+
+File: gawkinet.info, Node: PROTBASE, Prev: STOXPRED, Up: Some Applications and Techniques
+
+PROTBASE: Searching Through A Protein Database
+==============================================
+
+ Hoare's Law of Large Problems: Inside every large problem is a
+ small problem struggling to get out.
+
+ Yahoo's database of stock market data is just one among the many
+large databases on the Internet. Another one is located at NCBI
+(National Center for Biotechnology Information). Established in 1988 as
+a national resource for molecular biology information, NCBI creates
+public databases, conducts research in computational biology, develops
+software tools for analyzing genome data, and disseminates biomedical
+information. In this section, we look at one of NCBI's public services,
+which is called BLAST (Basic Local Alignment Search Tool).
+
+ You probably know that the information necessary for reproducing
+living cells is encoded in the genetic material of the cells. The
+genetic material is a very long chain of four base nucleotides. It is
+the order of appearance (the sequence) of nucleotides which contains
+the information about the substance to be produced. Scientists in
+biotechnology often find a specific fragment, determine the nucleotide
+sequence, and need to know where the sequence at hand comes from. This
+is where the large databases enter the game. At NCBI, databases store
+the knowledge about which sequences have ever been found and where they
+have been found. When the scientist sends his sequence to the BLAST
+service, the server looks for regions of genetic material in its
+database which look the most similar to the delivered nucleotide
+sequence. After a search time of some seconds or minutes the server
+sends an answer to the scientist. In order to make access simple, NCBI
+chose to offer their database service through popular Internet
+protocols. There are four basic ways to use the so-called BLAST
+services:
+
+ * The easiest way to use BLAST is through the web. Users may simply
+ point their browsers at the NCBI home page and link to the BLAST
+ pages. NCBI provides a stable URL that may be used to perform
+ BLAST searches without interactive use of a web browser. This is
+ what we will do later in this section. A demonstration client and
+ a `README' file demonstrate how to access this URL.
+
+ * Currently, `blastcl3' is the standard network BLAST client. You
+ can download `blastcl3' from the anonymous FTP location.
+
+ * BLAST 2.0 can be run locally as a full executable and can be used
+ to run BLAST searches against private local databases, or
+ downloaded copies of the NCBI databases. BLAST 2.0 executables may
+ be found on the NCBI anonymous FTP server.
+
+ * The NCBI BLAST Email server is the best option for people without
+ convenient access to the web. A similarity search can be performed
+ by sending a properly formatted mail message containing the
+ nucleotide or protein query sequence to .
+ The query sequence is compared against the specified database
+ using the BLAST algorithm and the results are returned in an email
+ message. For more information on formulating email BLAST searches,
+ you can send a message consisting of the word "HELP" to the same
+ address, .
+
+ Our starting point is the demonstration client mentioned in the
+first option. The `README' file that comes along with the client
+explains the whole process in a nutshell. In the rest of this section,
+we first show what such requests look like. Then we show how to use
+`gawk' to implement a client in about 10 lines of code. Finally, we
+show how to interpret the result returned from the service.
+
+ Sequences are expected to be represented in the standard IUB/IUPAC
+amino acid and nucleic acid codes, with these exceptions: lower-case
+letters are accepted and are mapped into upper-case; a single hyphen or
+dash can be used to represent a gap of indeterminate length; and in
+amino acid sequences, `U' and `*' are acceptable letters (see below).
+Before submitting a request, any numerical digits in the query sequence
+should either be removed or replaced by appropriate letter codes (e.g.,
+`N' for unknown nucleic acid residue or `X' for unknown amino acid
+residue). The nucleic acid codes supported are:
+
+ A --> adenosine M --> A C (amino)
+ C --> cytidine S --> G C (strong)
+ G --> guanine W --> A T (weak)
+ T --> thymidine B --> G T C
+ U --> uridine D --> G A T
+ R --> G A (purine) H --> A C T
+ Y --> T C (pyrimidine) V --> G C A
+ K --> G T (keto) N --> A G C T (any)
+ - gap of indeterminate length
+
+ Now you know the alphabet of nucleotide sequences. The last two lines
+of the following example query show you such a sequence, which is
+obviously made up only of elements of the alphabet just described.
+Store this example query into a file named `protbase.request'. You are
+now ready to send it to the server with the demonstration client.
+
+ PROGRAM blastn
+ DATALIB month
+ EXPECT 0.75
+ BEGIN
+ >GAWK310 the gawking gene GNU AWK
+ tgcttggctgaggagccataggacgagagcttcctggtgaagtgtgtttcttgaaatcat
+ caccaccatggacagcaaa
+
+ The actual search request begins with the mandatory parameter
+`PROGRAM' in the first column followed by the value `blastn' (the name
+of the program) for searching nucleic acids. The next line contains
+the mandatory search parameter `DATALIB' with the value `month' for the
+newest nucleic acid sequences. The third line contains an optional
+`EXPECT' parameter and the value desired for it. The fourth line
+contains the mandatory `BEGIN' directive, followed by the query
+sequence in FASTA/Pearson format. Each line of information must be
+less than 80 characters in length.
+
+ The "month" database contains all new or revised sequences released
+in the last 30 days and is useful for searching against new sequences.
+There are five different blast programs, `blastn' being the one that
+compares a nucleotide query sequence against a nucleotide sequence
+database.
+
+ The last server directive that must appear in every request is the
+`BEGIN' directive. The query sequence should immediately follow the
+`BEGIN' directive and must appear in FASTA/Pearson format. A sequence
+in FASTA/Pearson format begins with a single-line description. The
+description line, which is required, is distinguished from the lines of
+sequence data that follow it by having a greater-than (`>') symbol in
+the first column. For the purposes of the BLAST server, the text of
+the description is arbitrary.
+
+ If you prefer to use a client written in `gawk', just store the
+following 10 lines of code into a file named `protbase.awk' and use
+this client instead. Invoke it with `gawk -f protbase.awk
+protbase.request'. Then wait a minute and watch the result coming in.
+In order to replicate the demonstration client's behaviour as closely
+as possible, this client does not use a proxy server. We could also
+have extended the client program in *Note Retrieving Web Pages: GETURL,
+to implement the client request from `protbase.awk' as a special case.
+
+ { request = request "\n" $0 }
+
+ END {
+ BLASTService = "/inet/tcp/0/www.ncbi.nlm.nih.gov/80"
+ printf "POST /cgi-bin/BLAST/nph-blast_report HTTP/1.0\n" |& BLASTService
+ printf "Content-Length: " length(request) "\n\n" |& BLASTService
+ printf request |& BLASTService
+ while ((BLASTService |& getline) > 0)
+ print $0
+ close(BLASTService)
+ }
+
+ The demonstration client from NCBI is 214 lines long (written in C)
+and it is not immediately obvious what it does. Our client is so short
+that it _is_ obvious what it does. First it loops over all lines of the
+query and stores the whole query into a variable. Then the script
+establishes an Internet connection to the NCBI server and transmits the
+query by framing it with a proper HTTP request. Finally it receives and
+prints the complete result coming from the server.
+
+ Now, let us look at the result. It begins with an HTTP header, which
+you can ignore. Then there are some comments about the query having been
+filtered to avoid spuriously high scores. After this, there is a
+reference to the paper that describes the software being used for
+searching the data base. After a repitition of the original query's
+description we find the list of significant alignments:
+
+ Sequences producing significant alignments: (bits) Value
+
+ gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733... 38 0.20
+ gb|AC021056.12|AC021056 Homo sapiens chromosome 3 clone RP11-115... 38 0.20
+ emb|AL160278.10|AL160278 Homo sapiens chromosome 9 clone RP11-57... 38 0.20
+ emb|AL391139.11|AL391139 Homo sapiens chromosome X clone RP11-35... 38 0.20
+ emb|AL365192.6|AL365192 Homo sapiens chromosome 6 clone RP3-421H... 38 0.20
+ emb|AL138812.9|AL138812 Homo sapiens chromosome 11 clone RP1-276... 38 0.20
+ gb|AC073881.3|AC073881 Homo sapiens chromosome 15 clone CTD-2169... 38 0.20
+
+ This means that the query sequence was found in seven human
+chromosomes. But the value 0.20 (20%) means that the probability of an
+accidental match is rather high (20%) in all cases and should be taken
+into account. You may wonder what the first column means. It is a key
+to the specific database in which this occurence was found. The unique
+sequence identifiers reported in the search results can be used as
+sequence retrieval keys via the NCBI server. The syntax of sequence
+header lines used by the NCBI BLAST server depends on the database from
+which each sequence was obtained. The table below lists the
+identifiers for the databases from which the sequences were derived.
+
+ Database Name Identifier Syntax
+ ============================ ========================
+ GenBank gb|accession|locus
+ EMBL Data Library emb|accession|locus
+ DDBJ, DNA Database of Japan dbj|accession|locus
+ NBRF PIR pir||entry
+ Protein Research Foundation prf||name
+ SWISS-PROT sp|accession|entry name
+ Brookhaven Protein Data Bank pdb|entry|chain
+ Kabat's Sequences of Immuno... gnl|kabat|identifier
+ Patents pat|country|number
+ GenInfo Backbone Id bbs|number
+
+ For example, an identifier might be `gb|AC021182.14|AC021182', where
+the `gb' tag indicates that the identifier refers to a GenBank sequence,
+`AC021182.14' is its GenBank ACCESSION, and `AC021182' is the GenBank
+LOCUS. The identifier contains no spaces, so that a space indicates
+the end of the identifier.
+
+ Let us continue in the result listing. Each of the seven alignments
+mentioned above is subsequently described in detail. We will have a
+closer look at the first of them.
+
+ >gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733N23, WORKING DRAFT SEQUENCE, 4
+ unordered pieces
+ Length = 176383
+
+ Score = 38.2 bits (19), Expect = 0.20
+ Identities = 19/19 (100%)
+ Strand = Plus / Plus
+
+ Query: 35 tggtgaagtgtgtttcttg 53
+ |||||||||||||||||||
+ Sbjct: 69786 tggtgaagtgtgtttcttg 69804
+
+ This alignment was located on the human chromosome 7. The fragment
+on which part of the query was found had a total length of 176383. Only
+19 of the nucleotides matched and the matching sequence ran from
+character 35 to 53 in the query sequence and from 69786 to 69804 in the
+fragment on chromosome 7. If you are still reading at this point, you
+are probably interested in finding out more about Computational Biology
+and you might appreciate the following hints.
+
+ 1. There is a book called `Introduction to Computational Biology' by
+ Michael S. Waterman, which is worth reading if you are seriously
+ interested. You can find a good book review on the Internet.
+
+ 2. While Waterman's book can explain to you the algorithms employed
+ internally in the database search engines, most practicioners
+ prefer to approach the subject differently. The applied side of
+ Computational Biology is called Bioinformatics, and emphasizes the
+ tools available for day-to-day work as well as how to actually
+ _use_ them. One of the very few affordable books on Bioinformatics
+ is `Developing Bioinformatics Computer Skills'.
+
+ 3. The sequences _gawk_ and _gnuawk_ are in widespread use in the
+ genetic material of virtually every earthly living being. Let us
+ take this as a clear indication that the divine creator has
+ intended `gawk' to prevail over other scripting languages such as
+ `perl', `tcl', or `python' which are not even proper sequences.
+ (:-)
+
+
+File: gawkinet.info, Node: Links, Next: GNU Free Documentation License, Prev: Some Applications and Techniques, Up: Top
+
+Related Links
+*************
+
+ This section lists the URLs for various items discussed in this
+major node. They are presented in the order in which they appear.
+
+`Internet Programming with Python'
+ `http://www.fsbassociates.com/books/python.htm'
+
+`Advanced Perl Programming'
+ `http://www.oreilly.com/catalog/advperl'
+
+`Web Client Programming with Perl'
+ `http://www.oreilly.com/catalog/webclient'
+
+Richard Stevens's home page and book
+ `http://www.kohala.com/~rstevens'
+
+The SPAK home page
+ `http://www.userfriendly.net/linux/RPM/contrib/libc6/i386/spak-0.6b-1.i386.html'
+
+Volume III of `Internetworking with TCP/IP', by Comer and Stevens
+ `http://www.cs.purdue.edu/homes/dec/tcpip3s.cont.html'
+
+XBM Graphics File Format
+ `http://www.wotsit.org/download.asp?f=xbm'
+
+GNUPlot
+ `http://www.cs.dartmouth.edu/gnuplot_info.html'
+
+Mark Humphrys' Eliza page
+ `http://www.compapp.dcu.ie/~humphrys/eliza.html'
+
+Yahoo! Eliza Information
+ `http://dir.yahoo.com/Recreation/Games/Computer_Games/Internet_Games/Web_Games/Artificial_Intelligence'
+
+Java versions of Eliza
+ `http://www.tjhsst.edu/Psych/ch1/eliza.html'
+
+Java versions of Eliza with source code
+ `http://home.adelphia.net/~lifeisgood/eliza/eliza.htm'
+
+Eliza Programs with Explanations
+ `http://chayden.net/chayden/eliza/Eliza.shtml'
+
+Loebner Contest
+ `http://acm.org/~loebner/loebner-prize.htmlx'
+
+Tck/Tk Information
+ `http://www.scriptics.com/'
+
+Intel 80x86 Processors
+ `http://developer.intel.com/design/platform/embedpc/what_is.htm'
+
+AMD Elan Processors
+ `http://www.amd.com/products/epd/processors/4.32bitcont/32bitcont/index.html'
+
+XINU
+ `http://willow.canberra.edu.au/~chrisc/xinu.html'
+
+GNU/Linux
+ `http://uclinux.lineo.com/'
+
+Embedded PCs
+ `http://dir.yahoo.com/Business_and_Economy/Business_to_Business/Computers/Hardware/Embedded_Control/'
+
+MiniSQL
+ `http://www.hughes.com.au/library/'
+
+Market Share Surveys
+ `http://www.netcraft.com/survey'
+
+`Numerical Recipes in C: The Art of Scientific Computing'
+ `http://www.nr.com'
+
+VRML
+ `http://www.vrml.org'
+
+The VRML FAQ
+ `http://www.vrml.org/technicalinfo/specifications/specifications.htm#FAQ'
+
+The UMBC Agent Web
+ `http://www.cs.umbc.edu/agents'
+
+Apache Web Server
+ `http://www.apache.org'
+
+National Center for Biotechnology Information (NCBI)
+ `http://www.ncbi.nlm.nih.gov'
+
+Basic Local Alignment Search Tool (BLAST)
+ `http://www.ncbi.nlm.nih.gov/BLAST/blast_overview.html'
+
+NCBI Home Page
+ `http://www.ncbi.nlm.nih.gov'
+
+BLAST Pages
+ `http://www.ncbi.nlm.nih.gov/BLAST'
+
+BLAST Demonstration Client
+ `ftp://ncbi.nlm.nih.gov/blast/blasturl/'
+
+BLAST anonymous FTP location
+ `ftp://ncbi.nlm.nih.gov/blast/network/netblast/'
+
+BLAST 2.0 Executables
+ `ftp://ncbi.nlm.nih.gov/blast/executables/'
+
+IUB/IUPAC Amino Acid and Nucleic Acid Codes
+ `http://www.uthscsa.edu/geninfo/blastmail.html#item6'
+
+FASTA/Pearson Format
+ `http://www.ncbi.nlm.nih.gov/BLAST/fasta.html'
+
+Fasta/Pearson Sequence in Java
+ `http://www.kazusa.or.jp/java/codon_table_java/'
+
+Book Review of `Introduction to Computational Biology'
+ `http://www.acm.org/crossroads/xrds5-1/introcb.html'
+
+`Developing Bioinformatics Computer Skills'
+ `http://www.oreilly.com/catalog/bioskills/'
+
+
+File: gawkinet.info, Node: GNU Free Documentation License, Next: Index, Prev: Links, Up: Top
+
+GNU Free Documentation License
+******************************
+
+ Version 1.1, March 2000
+
+ Copyright (C) 2000 Free Software Foundation, Inc.
+ 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA
+
+ Everyone is permitted to copy and distribute verbatim copies
+ of this license document, but changing it is not allowed.
+
+
+
+ 0. PREAMBLE
+
+ The purpose of this License is to make a manual, textbook, or other
+ written document "free" in the sense of freedom: to assure everyone
+ the effective freedom to copy and redistribute it, with or without
+ modifying it, either commercially or noncommercially. Secondarily,
+ this License preserves for the author and publisher a way to get
+ credit for their work, while not being considered responsible for
+ modifications made by others.
+
+ This License is a kind of "copyleft", which means that derivative
+ works of the document must themselves be free in the same sense.
+ It complements the GNU General Public License, which is a copyleft
+ license designed for free software.
+
+ We have designed this License in order to use it for manuals for
+ free software, because free software needs free documentation: a
+ free program should come with manuals providing the same freedoms
+ that the software does. But this License is not limited to
+ software manuals; it can be used for any textual work, regardless
+ of subject matter or whether it is published as a printed book.
+ We recommend this License principally for works whose purpose is
+ instruction or reference.
+
+
+ 1. APPLICABILITY AND DEFINITIONS
+
+ This License applies to any manual or other work that contains a
+ notice placed by the copyright holder saying it can be distributed
+ under the terms of this License. The "Document", below, refers to
+ any such manual or work. Any member of the public is a licensee,
+ and is addressed as "you".
+
+ A "Modified Version" of the Document means any work containing the
+ Document or a portion of it, either copied verbatim, or with
+ modifications and/or translated into another language.
+
+ A "Secondary Section" is a named appendix or a front-matter
+ section of the Document that deals exclusively with the
+ relationship of the publishers or authors of the Document to the
+ Document's overall subject (or to related matters) and contains
+ nothing that could fall directly within that overall subject.
+ (For example, if the Document is in part a textbook of
+ mathematics, a Secondary Section may not explain any mathematics.)
+ The relationship could be a matter of historical connection with
+ the subject or with related matters, or of legal, commercial,
+ philosophical, ethical or political position regarding them.
+
+ The "Invariant Sections" are certain Secondary Sections whose
+ titles are designated, as being those of Invariant Sections, in
+ the notice that says that the Document is released under this
+ License.
+
+ The "Cover Texts" are certain short passages of text that are
+ listed, as Front-Cover Texts or Back-Cover Texts, in the notice
+ that says that the Document is released under this License.
+
+ A "Transparent" copy of the Document means a machine-readable copy,
+ represented in a format whose specification is available to the
+ general public, whose contents can be viewed and edited directly
+ and straightforwardly with generic text editors or (for images
+ composed of pixels) generic paint programs or (for drawings) some
+ widely available drawing editor, and that is suitable for input to
+ text formatters or for automatic translation to a variety of
+ formats suitable for input to text formatters. A copy made in an
+ otherwise Transparent file format whose markup has been designed
+ to thwart or discourage subsequent modification by readers is not
+ Transparent. A copy that is not "Transparent" is called "Opaque".
+
+ Examples of suitable formats for Transparent copies include plain
+ ASCII without markup, Texinfo input format, LaTeX input format,
+ SGML or XML using a publicly available DTD, and
+ standard-conforming simple HTML designed for human modification.
+ Opaque formats include PostScript, PDF, proprietary formats that
+ can be read and edited only by proprietary word processors, SGML
+ or XML for which the DTD and/or processing tools are not generally
+ available, and the machine-generated HTML produced by some word
+ processors for output purposes only.
+
+ The "Title Page" means, for a printed book, the title page itself,
+ plus such following pages as are needed to hold, legibly, the
+ material this License requires to appear in the title page. For
+ works in formats which do not have any title page as such, "Title
+ Page" means the text near the most prominent appearance of the
+ work's title, preceding the beginning of the body of the text.
+
+
+ 2. VERBATIM COPYING
+
+ You may copy and distribute the Document in any medium, either
+ commercially or noncommercially, provided that this License, the
+ copyright notices, and the license notice saying this License
+ applies to the Document are reproduced in all copies, and that you
+ add no other conditions whatsoever to those of this License. You
+ may not use technical measures to obstruct or control the reading
+ or further copying of the copies you make or distribute. However,
+ you may accept compensation in exchange for copies. If you
+ distribute a large enough number of copies you must also follow
+ the conditions in section 3.
+
+ You may also lend copies, under the same conditions stated above,
+ and you may publicly display copies.
+
+
+ 3. COPYING IN QUANTITY
+
+ If you publish printed copies of the Document numbering more than
+ 100, and the Document's license notice requires Cover Texts, you
+ must enclose the copies in covers that carry, clearly and legibly,
+ all these Cover Texts: Front-Cover Texts on the front cover, and
+ Back-Cover Texts on the back cover. Both covers must also clearly
+ and legibly identify you as the publisher of these copies. The
+ front cover must present the full title with all words of the
+ title equally prominent and visible. You may add other material
+ on the covers in addition. Copying with changes limited to the
+ covers, as long as they preserve the title of the Document and
+ satisfy these conditions, can be treated as verbatim copying in
+ other respects.
+
+ If the required texts for either cover are too voluminous to fit
+ legibly, you should put the first ones listed (as many as fit
+ reasonably) on the actual cover, and continue the rest onto
+ adjacent pages.
+
+ If you publish or distribute Opaque copies of the Document
+ numbering more than 100, you must either include a
+ machine-readable Transparent copy along with each Opaque copy, or
+ state in or with each Opaque copy a publicly-accessible
+ computer-network location containing a complete Transparent copy
+ of the Document, free of added material, which the general
+ network-using public has access to download anonymously at no
+ charge using public-standard network protocols. If you use the
+ latter option, you must take reasonably prudent steps, when you
+ begin distribution of Opaque copies in quantity, to ensure that
+ this Transparent copy will remain thus accessible at the stated
+ location until at least one year after the last time you
+ distribute an Opaque copy (directly or through your agents or
+ retailers) of that edition to the public.
+
+ It is requested, but not required, that you contact the authors of
+ the Document well before redistributing any large number of
+ copies, to give them a chance to provide you with an updated
+ version of the Document.
+
+
+ 4. MODIFICATIONS
+
+ You may copy and distribute a Modified Version of the Document
+ under the conditions of sections 2 and 3 above, provided that you
+ release the Modified Version under precisely this License, with
+ the Modified Version filling the role of the Document, thus
+ licensing distribution and modification of the Modified Version to
+ whoever possesses a copy of it. In addition, you must do these
+ things in the Modified Version:
+
+ A. Use in the Title Page (and on the covers, if any) a title
+ distinct from that of the Document, and from those of
+ previous versions (which should, if there were any, be listed
+ in the History section of the Document). You may use the
+ same title as a previous version if the original publisher of
+ that version gives permission.
+
+ B. List on the Title Page, as authors, one or more persons or
+ entities responsible for authorship of the modifications in
+ the Modified Version, together with at least five of the
+ principal authors of the Document (all of its principal
+ authors, if it has less than five).
+
+ C. State on the Title page the name of the publisher of the
+ Modified Version, as the publisher.
+
+ D. Preserve all the copyright notices of the Document.
+
+ E. Add an appropriate copyright notice for your modifications
+ adjacent to the other copyright notices.
+
+ F. Include, immediately after the copyright notices, a license
+ notice giving the public permission to use the Modified
+ Version under the terms of this License, in the form shown in
+ the Addendum below.
+
+ G. Preserve in that license notice the full lists of Invariant
+ Sections and required Cover Texts given in the Document's
+ license notice.
+
+ H. Include an unaltered copy of this License.
+
+ I. Preserve the section entitled "History", and its title, and
+ add to it an item stating at least the title, year, new
+ authors, and publisher of the Modified Version as given on
+ the Title Page. If there is no section entitled "History" in
+ the Document, create one stating the title, year, authors,
+ and publisher of the Document as given on its Title Page,
+ then add an item describing the Modified Version as stated in
+ the previous sentence.
+
+ J. Preserve the network location, if any, given in the Document
+ for public access to a Transparent copy of the Document, and
+ likewise the network locations given in the Document for
+ previous versions it was based on. These may be placed in
+ the "History" section. You may omit a network location for a
+ work that was published at least four years before the
+ Document itself, or if the original publisher of the version
+ it refers to gives permission.
+
+ K. In any section entitled "Acknowledgements" or "Dedications",
+ preserve the section's title, and preserve in the section all
+ the substance and tone of each of the contributor
+ acknowledgements and/or dedications given therein.
+
+ L. Preserve all the Invariant Sections of the Document,
+ unaltered in their text and in their titles. Section numbers
+ or the equivalent are not considered part of the section
+ titles.
+
+ M. Delete any section entitled "Endorsements". Such a section
+ may not be included in the Modified Version.
+
+ N. Do not retitle any existing section as "Endorsements" or to
+ conflict in title with any Invariant Section.
+
+ If the Modified Version includes new front-matter sections or
+ appendices that qualify as Secondary Sections and contain no
+ material copied from the Document, you may at your option
+ designate some or all of these sections as invariant. To do this,
+ add their titles to the list of Invariant Sections in the Modified
+ Version's license notice. These titles must be distinct from any
+ other section titles.
+
+ You may add a section entitled "Endorsements", provided it contains
+ nothing but endorsements of your Modified Version by various
+ parties-for example, statements of peer review or that the text has
+ been approved by an organization as the authoritative definition
+ of a standard.
+
+ You may add a passage of up to five words as a Front-Cover Text,
+ and a passage of up to 25 words as a Back-Cover Text, to the end
+ of the list of Cover Texts in the Modified Version. Only one
+ passage of Front-Cover Text and one of Back-Cover Text may be
+ added by (or through arrangements made by) any one entity. If the
+ Document already includes a cover text for the same cover,
+ previously added by you or by arrangement made by the same entity
+ you are acting on behalf of, you may not add another; but you may
+ replace the old one, on explicit permission from the previous
+ publisher that added the old one.
+
+ The author(s) and publisher(s) of the Document do not by this
+ License give permission to use their names for publicity for or to
+ assert or imply endorsement of any Modified Version.
+
+
+ 5. COMBINING DOCUMENTS
+
+ You may combine the Document with other documents released under
+ this License, under the terms defined in section 4 above for
+ modified versions, provided that you include in the combination
+ all of the Invariant Sections of all of the original documents,
+ unmodified, and list them all as Invariant Sections of your
+ combined work in its license notice.
+
+ The combined work need only contain one copy of this License, and
+ multiple identical Invariant Sections may be replaced with a single
+ copy. If there are multiple Invariant Sections with the same name
+ but different contents, make the title of each such section unique
+ by adding at the end of it, in parentheses, the name of the
+ original author or publisher of that section if known, or else a
+ unique number. Make the same adjustment to the section titles in
+ the list of Invariant Sections in the license notice of the
+ combined work.
+
+ In the combination, you must combine any sections entitled
+ "History" in the various original documents, forming one section
+ entitled "History"; likewise combine any sections entitled
+ "Acknowledgements", and any sections entitled "Dedications". You
+ must delete all sections entitled "Endorsements."
+
+
+ 6. COLLECTIONS OF DOCUMENTS
+
+ You may make a collection consisting of the Document and other
+ documents released under this License, and replace the individual
+ copies of this License in the various documents with a single copy
+ that is included in the collection, provided that you follow the
+ rules of this License for verbatim copying of each of the
+ documents in all other respects.
+
+ You may extract a single document from such a collection, and
+ distribute it individually under this License, provided you insert
+ a copy of this License into the extracted document, and follow
+ this License in all other respects regarding verbatim copying of
+ that document.
+
+
+ 7. AGGREGATION WITH INDEPENDENT WORKS
+
+ A compilation of the Document or its derivatives with other
+ separate and independent documents or works, in or on a volume of
+ a storage or distribution medium, does not as a whole count as a
+ Modified Version of the Document, provided no compilation
+ copyright is claimed for the compilation. Such a compilation is
+ called an "aggregate", and this License does not apply to the
+ other self-contained works thus compiled with the Document, on
+ account of their being thus compiled, if they are not themselves
+ derivative works of the Document.
+
+ If the Cover Text requirement of section 3 is applicable to these
+ copies of the Document, then if the Document is less than one
+ quarter of the entire aggregate, the Document's Cover Texts may be
+ placed on covers that surround only the Document within the
+ aggregate. Otherwise they must appear on covers around the whole
+ aggregate.
+
+
+ 8. TRANSLATION
+
+ Translation is considered a kind of modification, so you may
+ distribute translations of the Document under the terms of section
+ 4. Replacing Invariant Sections with translations requires special
+ permission from their copyright holders, but you may include
+ translations of some or all Invariant Sections in addition to the
+ original versions of these Invariant Sections. You may include a
+ translation of this License provided that you also include the
+ original English version of this License. In case of a
+ disagreement between the translation and the original English
+ version of this License, the original English version will prevail.
+
+
+ 9. TERMINATION
+
+ You may not copy, modify, sublicense, or distribute the Document
+ except as expressly provided for under this License. Any other
+ attempt to copy, modify, sublicense or distribute the Document is
+ void, and will automatically terminate your rights under this
+ License. However, parties who have received copies, or rights,
+ from you under this License will not have their licenses
+ terminated so long as such parties remain in full compliance.
+
+
+ 10. FUTURE REVISIONS OF THIS LICENSE
+
+ The Free Software Foundation may publish new, revised versions of
+ the GNU Free Documentation License from time to time. Such new
+ versions will be similar in spirit to the present version, but may
+ differ in detail to address new problems or concerns. See
+ `http://www.gnu.org/copyleft/'.
+
+ Each version of the License is given a distinguishing version
+ number. If the Document specifies that a particular numbered
+ version of this License "or any later version" applies to it, you
+ have the option of following the terms and conditions either of
+ that specified version or of any later version that has been
+ published (not as a draft) by the Free Software Foundation. If
+ the Document does not specify a version number of this License,
+ you may choose any version ever published (not as a draft) by the
+ Free Software Foundation.
+
+
+ADDENDUM: How to use this License for your documents
+====================================================
+
+ To use this License in a document you have written, include a copy of
+the License in the document and put the following copyright and license
+notices just after the title page:
+
+
+ Copyright (C) YEAR YOUR NAME.
+ Permission is granted to copy, distribute and/or modify this document
+ under the terms of the GNU Free Documentation License, Version 1.1
+ or any later version published by the Free Software Foundation;
+ with the Invariant Sections being LIST THEIR TITLES, with the
+ Front-Cover Texts being LIST, and with the Back-Cover Texts being LIST.
+ A copy of the license is included in the section entitled ``GNU
+ Free Documentation License''.
+If you have no Invariant Sections, write "with no Invariant
+Sections" instead of saying which ones are invariant. If you have no
+Front-Cover Texts, write "no Front-Cover Texts" instead of "Front-Cover
+Texts being LIST"; likewise for Back-Cover Texts.
+
+ If your document contains nontrivial examples of program code, we
+recommend releasing these examples in parallel under your choice of
+free software license, such as the GNU General Public License, to
+permit their use in free software.
+
+
+File: gawkinet.info, Node: Index, Prev: GNU Free Documentation License, Up: Top
+
+Index
+*****
+
+* Menu:
+
+* /inet/raw special files: File /inet/raw.
+* /inet/tcp special files: File /inet/tcp.
+* /inet/udp special files: File /inet/udp.
+* agent <1>: MOBAGWHO.
+* agent: Challenges.
+* AI: Challenges.
+* apache <1>: MOBAGWHO.
+* apache: WEBGRAB.
+* Bioinformatics: PROTBASE.
+* BLAST, Basic Local Alignment Search Tool: PROTBASE.
+* blocking: Making Connections.
+* Boutell, Thomas: STATIST.
+* CGI <1>: MOBAGWHO.
+* CGI <2>: Interacting Service.
+* CGI: Web page.
+* client: Making Connections.
+* Clinton, Bill: Challenges.
+* Computational Biology: PROTBASE.
+* Contest: Challenges.
+* cron: STOXPRED.
+* CSV format: STOXPRED.
+* dark corner: File /inet/raw.
+* Dow Jones Industrial Index: STOXPRED.
+* ELIZA program: Simple Server.
+* FASTA/Pearson format: PROTBASE.
+* finger utility: Setting Up.
+* FTP: Basic Protocols.
+* getline built-in function: TCP Connecting.
+* GETURL program: GETURL.
+* gif image format <1>: STATIST.
+* gif image format: Web page.
+* GNU/Linux <1>: REMCONF.
+* GNU/Linux <2>: Interacting.
+* GNU/Linux: Troubleshooting.
+* GNUPlot utility <1>: STATIST.
+* GNUPlot utility: Interacting Service.
+* GUI <1>: Simple Server.
+* GUI: Interacting Service.
+* Hoare, C.A.R. <1>: PROTBASE.
+* Hoare, C.A.R.: MOBAGWHO.
+* HTML: Web page.
+* HTTP <1>: Web page.
+* HTTP: Basic Protocols.
+* HTTP server, core logic: Interacting Service.
+* Humphrys, Mark: Simple Server.
+* image format <1>: STATIST.
+* image format: Interacting Service.
+* JavaScript <1>: STATIST.
+* JavaScript: Some Applications and Techniques.
+* Linux <1>: REMCONF.
+* Linux <2>: Interacting.
+* Linux: Troubleshooting.
+* Lisp: MOBAGWHO.
+* Loebner, Hugh: Challenges.
+* Loui, Ronald P.: Challenges.
+* MAZE: MAZE.
+* Microsoft Windows <1>: WEBGRAB.
+* Microsoft Windows <2>: Setting Up.
+* Microsoft Windows: Troubleshooting.
+* MiniSQL: REMCONF.
+* MOBAGWHO program: MOBAGWHO.
+* NCBI, National Center for Biotechnology Information: PROTBASE.
+* network <1>: Caveats.
+* network <2>: Gawk Special Files.
+* network: Using Networking.
+* Numerical Recipes: STATIST.
+* PANIC program: PANIC.
+* Perl: Using Networking.
+* Perlis, Alan: MAZE.
+* png image format <1>: STATIST.
+* png image format: Web page.
+* POP: Email.
+* PostScript: STATIST.
+* PROLOG: Challenges.
+* PROTBASE: PROTBASE.
+* ps image format: STATIST.
+* Python: Using Networking.
+* RAW: File /inet/raw.
+* REMCONF program: REMCONF.
+* reserved ports: Setting Up.
+* RFC 1939: Email.
+* RFC 1945: Web page.
+* RFC 2068 <1>: Interacting Service.
+* RFC 2068: Web page.
+* RFC 2616: Web page.
+* RFC 821: Email.
+* robot <1>: WEBGRAB.
+* robot <2>: GETURL.
+* robot: Challenges.
+* server <1>: Setting Up.
+* server: Making Connections.
+* SMTP <1>: Email.
+* SMTP: Basic Protocols.
+* SPAK utility: File /inet/raw.
+* STATIST program: STATIST.
+* STOXPRED program: STOXPRED.
+* synchronous communications: Making Connections.
+* Tcl/Tk <1>: Some Applications and Techniques.
+* Tcl/Tk: Using Networking.
+* TCP <1>: Interacting.
+* TCP: File /inet/tcp.
+* UDP <1>: Interacting.
+* UDP: File /inet/udp.
+* URLCHK program: URLCHK.
+* VRML: MAZE.
+* WEBGRAB program: WEBGRAB.
+* Weizenbaum, Joseph: Simple Server.
+* xbm image format: Interacting Service.
+* Yahoo: STOXPRED.
+* Yahoo! <1>: REMCONF.
+* Yahoo! <2>: Simple Server.
+* Yahoo!: Web page.
+* |& I/O operator: TCP Connecting.
+
+
+
+Tag Table:
+Node: Top1119
+Node: Preface3953
+Node: Introduction5331
+Node: Stream Communications6355
+Node: Datagram Communications7523
+Node: The TCP/IP Protocols9148
+Ref: The TCP/IP Protocols-Footnote-19824
+Node: Basic Protocols9981
+Node: Ports11288
+Node: Making Connections12685
+Ref: Making Connections-Footnote-115256
+Node: Using Networking15303
+Node: Gawk Special Files17627
+Node: Special File Fields19649
+Node: Comparing Protocols24957
+Node: File /inet/tcp25537
+Node: File /inet/udp26550
+Node: File /inet/raw27658
+Ref: File /inet/raw-Footnote-130678
+Node: TCP Connecting30758
+Node: Troubleshooting33093
+Ref: Troubleshooting-Footnote-136090
+Node: Interacting36609
+Node: Setting Up39332
+Node: Email42818
+Node: Web page45139
+Ref: Web page-Footnote-147939
+Node: Primitive Service48142
+Node: Interacting Service50869
+Ref: Interacting Service-Footnote-159992
+Node: CGI Lib60024
+Node: Simple Server66994
+Ref: Simple Server-Footnote-174716
+Node: Caveats74817
+Node: Challenges75958
+Node: Some Applications and Techniques84617
+Node: PANIC87073
+Node: GETURL88786
+Node: REMCONF91404
+Node: URLCHK96875
+Node: WEBGRAB100705
+Node: STATIST105150
+Ref: STATIST-Footnote-1116851
+Node: MAZE117296
+Node: MOBAGWHO123476
+Ref: MOBAGWHO-Footnote-1137412
+Node: STOXPRED137467
+Node: PROTBASE151742
+Node: Links164833
+Node: GNU Free Documentation License168265
+Node: Index188159
+
+End Tag Table
--
cgit v1.2.3